| Literature DB >> 21374415 |
Abstract
A highly conserved repeated DNA element has been identified in the chromosome of Streptococcus pneumoniae (pneumococcus) and given the name of the BOX repetitive element (1). This was the first demonstration of the presence of such a repetitive DNA moiety in a Gram positive bacterial species. Approximately 25 of these elements are found in noncoding regions dispersed throughout the entire pneumococcal genome. The BOX repeat is found to consist of three discriminate regions: boxA, boxB, and boxC, which are 59, 45, and 50 basepairs in length, respectively. Various different combinations of these three elements are found to be present in different BOX loci and limited sequence heterogeneity is encountered among different elements from the same strain or elements sequenced from different strains. The first publication on the BOX repetitive elements also described its intricate secondary structure, supported by compensating basepairing in different loci where the repeat is encountered (see Fig. 1). Moreover, their location in the vicinity of genes involved in the regulation of various aspects of bacterial competence, genetic transformation and virulence suggest that the elements might well be involved in coordination of the control of gene expression. More recently, Saluja and Weiser (2) demonstrated that the presence of a BOX element is associated with variation in colony opacity of the pneumococcus. The frequency with which the colonies switched from transparent to opaque clearly depended on the Fig. 1. Predicted secondary structure of the consensus BOX sequence containing one copy of boxB. The figure is adapted from reference (1). Boxed basepairs indicate interactions that have been supported by phylogenetic comparisons, the basepairs themselves are highlighted by dots. The border between boxA and boxB is at nucleotide position 60, whereas boxB borders boxC at nucleotide 104. The PCR primer locations and the corresponding primer codes can be found in Table 1 . Table 1 Survey of the DNA Sequence for the Different Primers Used in Various Studies on BOX PCR for Typing of Streptococcus pneumoniae Primer Code Sequence 5' →3' Position in Fig. 1 Literature reference boxA1 CGTCAGCGTCGCCTTGCCGTAG 30-51 (5) boxA1R CTACGGCAAGGCGACGCTGACG 51-30 (5,8,9) boxA2R ACGTGGTTTGAAGAGATTTTCG 32-11 (5) boxA ATACTCTTCGAAAATCTCTTCAAAC 3-27 (6,10) boxB1 TTCGTCAGTTCTATCTACAACC 65-86 (5) boxB2 AACCTCAAAACAGTGTTTTGAG 83-104 (5) boxC1 TGCGGCTAGCTTCCTAGTTTGC 110-131 (5) boxC1R AGCAAACTAGGAAGCTAGCCGC 132-111 (5) boxC2 TTGCTCTTTGATTTTCATTGAG 128-149 (5) Note: The primers boxA1R and boxA have been employed most successfully for molecular typing of pneumococci. Although both primers derive from the boxA region there is no overlap in primary structure. Primers boxA1 and boxA1R are each others precise complement, as are primers boxC and boxC1R. See Fig. 1for a precise localisation of some of the primers in the entire BOX element.Entities:
Year: 2001 PMID: 21374415 DOI: 10.1385/1-59259-077-2:159
Source DB: PubMed Journal: Methods Mol Med ISSN: 1543-1894