The hylEfm gene in pHylEfm of Enterococcus faecium is not required in pathogenesis of murine peritonitis.

BACKGROUND: Plasmids containing hylEfm (pHylEfm) were previously shown to increase gastrointestinal colonization and lethality of Enterococcus faecium in experimental peritonitis. The hylEfm gene, predicting a glycosyl hydrolase, has been considered as a virulence determinant of hospital-associated E. faecium, although its direct contribution to virulence has not been investigated. Here, we constructed mutants of the hylEfm-region and we evaluated their effect on virulence using a murine peritonitis model.
RESULTS: Five mutants of the hylEfm-region of pHylEfmTX16 from the sequenced endocarditis strain (TX16 [DO]) were obtained using an adaptation of the PheS* system and were evaluated in a commensal strain TX1330RF to which pHylEfmTX16 was transferred by mating; these include i) deletion of hylEfm only; ii) deletion of the gene downstream of hylEfm (down) of unknown function; iii) deletion of hylEfm plus down; iv) deletion of hylEfm-down and two adjacent genes; and v) a 7,534 bp deletion including these four genes plus partial deletion of two others, with replacement by cat. The 7,534 bp deletion did not affect virulence of TX16 in peritonitis but, when pHylEfmTX16Δ7,534 was transferred to the TX1330RF background, the transconjugant was affected in in vitro growth versus TX1330RF(pHylEfmTX16) and was attenuated in virulence; however, neither hylEfm nor hylEfm-down restored wild type function. We did not observe any in vivo effect on virulence of the other deletions of the hylEfm-region
CONCLUSIONS: The four genes of the hylEfm region (including hylEfm) do not mediate the increased virulence conferred by pHylEfmTX16 in murine peritonitis. The use of the markerless counterselection system PheS* should facilitate the genetic manipulation of E. faecium in the future.

Background

Enterococcus faecium is a common enterococcal species increasingly isolated from hospital-associated infections in the USA [1]. Compelling evidence suggests that this substantial increase in E. faecium nosocomial infections is due to the worldwide occurrence of a genetic subcluster (designated clonal cluster 17, CC17) which encompasses clones that appear to have evolved independently [2-4]. Several genes have been associated with CC17 E. faecium including ) esp, encoding a surface protein which has been associated with increased biofilm formation and urinary tract infection (UTI) [4-6]; ) some fms genes (two of which are also designated pilA and pilB), encoding putative microbial surface components recognizing adhesive matrix molecules (MSCRAMMs) or components of enterococcal pili (including the pilus operon ebpABC, which appear to play a role in biofilm formation and experimental UTI) [2,7-10]; ) an intact acm gene encoding a collagen adhesin which was shown to be important in the pathogenesis of endocarditis [8] and, ) plasmids carrying the hylgene [11-14].

It has been previously shown that hylis carried by large transferable megaplasmids of different sizes (145 to 375 kb) in hospital-associated E. faecium which are widely distributed worldwide [11-13,15] These plasmids also can harbour antibiotic resistance determinants and some pilus-encoding genes of E. faecium which are present with hylin the same plasmid [15,16]. The acquisition of the hyl-plasmid by an E. faecium laboratory strain (D344SRF) from a US clinical isolate (C68) increased the colonization of the gastrointestinal tract of mice, an effect that was independent of the presence of antibiotic resistance determinants [17]. Moreover, the acquisition of the hyl-plasmid from another US clinical strain (TX16) increased the virulence of a commensal strain E. faecium TX1330RF in experimental peritonitis [11].

The HylEfm protein was initially predicted to have homology with hyaluronidases which have been associated with virulence in other gram-positive pathogens [18,19], although hyaluronidase activity has not been detected in E. faecium isolates carrying this gene [15]. The most recent annotation and sequence comparisons indicate that this protein is likely to encode a family 84 glycosyl hydrolase [12,13]. In fact, the homolog of hylin Streptococcus pyogenes (spy1600) encoded in a genetic locus with a similar organization to that of the hyl-region and sharing 42% identity at the amino acid level (61% similarity), was recently shown not to have any detectable hyaluronidase activity. Spy1600 was characterized as a family 84 glycosyl hydrolase with β-N-acetyl-glucosaminidase specificity after purification and substrate analysis [20] and expression of spy1600 in S. pyogenes was found to be up-regulated during phagocytosis [21]. For this reason, and because of the almost exclusive occurrence of hylin isolates from clinical origin in different surveillance studies [14,22-24], this gene has been postulated as an important pathogenic determinant of hospital-associated E. faecium. However, its exact role in virulence has not been established. In this work, we assess the role of the hyl-region in E. faecium pathogenesis of experimental peritonitis.

Methods

Bacterial strains and plasmids

Table 1 and Figure 1 show the strains and plasmids used in this work and depict the genetic organization of the hyl-region in E. faecium strains and mutants.

Table 1

E. faecium strains and plasmids used in this work

Strains/Plasmids	Relevant Characteristics	Reference
Strains
E. faecium
TX16 (DO)	Sequenced endocarditis clinical isolate, Emr, Smr. ST-16a http://www.hgsc.bcm.tmc.edu	[35]
TX1330RF	Fsr and Rfr derivative of TX1330, a faecal colonizing strain from a healthy human volunteer	[11]
TX1330RF (pHylEfmTX16)	Derivative of TX1330RF to which the hylEfm-containing plasmid (pHylEfmTX16) was transferred by conjugation from TX16 (DO) (~250 kb)	[11]
TX1330RF (pHylEfmTX16Δ7,534)	Mutant with deletion of part or all of 6 genes of the hylEfm region of TX1330RF(pHylEfmTX16)	This work
TX1330RF (pHylEfmTX16Δ4genes)	Non-polar deletion of 4 genes of the hylEfm region of TX1330RF(pHylEfmTX16)	This work
TX1330RF (pHylEfmTX16Δhyl)	Non-polar deletion mutant of hylEfm of TX1330RF(pHylEfmTX16)	This work
TX1330RF (pHylEfmTX16Δhyl-down)	Non-polar deletion of hylEfm plus its downstream gene of TX1330RF(pHylEfmTX16)	This work
TX1330RF (pHylEfmTX16Δdown)	Non-polar deletion of the gene downstream of hylEfm of TX1330RF(pHylEfmTX16)	This work
E. faecalis
CK111	OG1Sp upp4::P23 repA4	[25]
Plasmids
pHylEfmTX16	Conjugative and transferable megaplasmid (ca. 250 kb) of TX16 (DO) containing hylEfm	[11]
pCJK47	Conjugative donor plasmid for markerless mutagenesis; oriTpCF10 and pheS* pORI280 derivative; confers Emr	[25]
pHOU1	Derivative of pCJK47 in which the erm(C) gene was replaced by aph-2'-ID; confers Gmr	This work
pHOU2	Derivative of pCJK47 in which the erm(C) gene was replaced by aph-2'-ID and cat was incorporated in the cloning site for allelic replacements; confers Gmr.	This work
pTEX5501ts	E. coli-enterococcal shuttle plasmid for mutagenesis using a temperature-sensitive replicon	[27]
pAT392	oriRpAMβ1, oriRpUC oriTRK2 spc lacZα P2 aac(6')-aph(2")	[30]
pAT392::hylEfm	Derivative of pAT392 containing hylEfm (cloned with SacI and SmaI) under the control of the P2 promoter	This work
pAT392::hylEfm-down	Derivative of pAT392 containing both the hylEfm plus downstream genes (cloned with SacI and SmaI) under the control of the P2 promoter	This work

Emr, erythromycin resistance; Fsr, fusidic acid resistance; Gmr, gentamicin resistance, Rfr, rifampin resistance; Smr, high-level resistance to streptomycin. aST refers to sequence type after multi-locus sequence typing. ST16 is part of CC17

Figure 1

Physical map of the -region in pHyl. The annotated predicted function of the corresponding genes is shown above the genes. The genes were divided into three groups (metabolism, transport [in gray] and regulation based on putative functions). Strain nomenclature follows that specified in Table 1. Black arrows above the genes indicate the position of the primers used to obtain DNA fragments for mutagenesis and follow the nomenclature of Table 2. The crosses depict the genes that were deleted. The asterisks indicate only partial deletion of the gene was obtained. The number refers to the glycosyl hydrolase family with hyldepicted in bold; allelic replacement with the chloramphenicol acetyl transferase gene (cat) was performed. NA, not applicable.

Construction of a deletion mutant of the hyl-region using the pheS* counter-selection system in TX16(pHylEfmTX16) and its transfer to TX1330RF

The pheS* system (previously used in Enterococcus faecalis) [25] is based on the acquired sensitivity of bacteria to p-chloro-phenylalanine (p-Cl-Phe) if they carry a pheS* allele encoding a phenylalanine tRNA synthetase with altered substrate specificity [25,26]. In order to apply this approach to E. faecium strains, which are commonly macrolide resistant, we constructed a derivative of the pheS* vector pCJK47 by replacing its erm(C) gene with aph2"-ID, which confers resistance to gentamicin. The full aph-2"-ID gene (including promoter and terminator regions) was amplified by PCR using plasmid pTEX5501ts [27] as the template with primers A and B (Table 2). The amplified fragment (1,089 bp) was digested with NsiI and BglII and ligated with pCJK47 digested with the same enzymes resulting in pHOU1 (Figure 2A). Subsequently, pHOU1 was digested with BamHI and PstI and ligated with a 992 bp fragment released from pTEX5501ts after digestion with the same enzymes and containing the chloramphenicol acetyl-transferase gene (cat), obtaining a 7,906 bp vector designated pHOU2 (Figure 2B).

Table 2

Primers used in this work

Primer	Sequence (5'-3')	Relevant Characteristics
A	gaagatctgagataggttatgcaagat	Forward, BglII site (underlined), used amplification of aph-2"-ID
B	ccaatgcatgattccggattctaaaaaagg	Reverse, NsiI site (underlined), used amplification of aph-2"-ID
C	cgggatccgtttaaaaccagctggaaaag	Forward, BamHI site (underlined), located 1,251 nucleotides upstream of the start codon of the gene encoding a putative glycosyl hydrolase family 20 (Figure 1.)
D	ccgctcgagcaattcaacattgcaaagac	Reverse, XhoI site (underlined), located 294 nucleotides upstream of the start codon of the gene encoding a putative glycosyl hydrolase family 20 (Figure 1.)
E	cgagggcccgtgaagtattgccagatgt	Forward, ApaI site (underlined); located 592 nucleotides downstream of the down gene (hypothetical, Figure 1.)
F	ccggaattcaaaagcagaattggaaatca	Reverse, EcoRI site, 1,571 nucleotides downstream of the down gene (hypothetical, Figure 1.)
G	gcgagctcgattactttcaaaggaga	Forward, SacI site (underlined), ribosomal binding site of hylEfm (italics) (Figure 1.)
H	tcccccgggctaacttttgataatttgctc	Reverse, SmaI site, (underlined) and stop codon of hylEfm (Figure 1.)
I	tcccccgggttagcgattgatcgagc	Reverse, SmaI site (underlined), stop codon of down (Figure 1.)
J	cgggatcccaatcaagaagtagcggatt	Forward, BamH site (underlined) 438 nucleotides upstream of the stop codon of carbohydrate ABC transporter gene (Figure 1.)
K	gcggccgctcgagggcccttagtgcgattgtatctgac	Reverse, stop codon of the gene that encodes to transmembrane protein (Figure 1.)
L	gggcccctcgaggcggccgcaaaattaaataaaaaatgg	Forward, ApaI, XhoI, NotI site, stop codon down (Figure 1.)
M	catgcatgaatcaggaactgaaactgc	Reverse, NsiI site, 1,091 nucleotides upstream of stop codon of GMP synthase (opposite orientation) (Figure 1.)
N	ccggaattccagtaaaaggcacagagc	Forward, EcoRI site (underlined), located 2,138 nucleotides down-stream of glycosyl hidrolase family 45-2 start codon (Figure 1.)
O	tcatctattttctcctttgaaagtaatcactatattcc	Reverse, stop codon of glycosyl hydrolase family 45-2 (Figure 1.)
P	tcaaaggagaaaatagatgaatatcttaaaaaataaaaagc	Forward, located 40 nucleotides upstream of down gene start codon (Figure 1.)
Q	ataagaatgcggccgcttagcgattgatcgagcg	Reverse, NotI site (underlined), stop codon of down (Figure 1.)
R	ataagaatgcggccgccagtaaaaggcacagagc	Forward, NotI site (underlined), located 2,138 nucleotides down-stream of glycosyl hydrolase family 45-2 start codon (Figure 1.)
S	tcatctattttctcctttgaaagtaatcactatattcc	Reverse, stop codon of glycosyl hydrolase family 45-2 (Figure 1.)
T	tcaaaggagaaaatagatgacaaaattaaataaaaaatgg	Forward, 1,973 nucleotides upstream of stop codon of GMP synthase (Figure 1.)
U	cggaattcgaatttgtatatgtcttcg	Reverse, EcoRI site (underlined), 994 nucleotides upstream of start codon of GMP synthase (opposite direction) (Figure 1.)
V	aaggaaaaaagcggccgccagaatatgataatcgtcatgg	Forward, NotI site (underlined), 902 nucleotides downstream of hylEfm start codon (Figure 1.)
W	tttgttctcctttttcttgctttttattttttaag	Reverse, stop codon of of hylEfm (Figure 1.)
X	gcaagaaaaaggagaacaaacaaaattaaataaaaaatgg	Forward, 1,973 nucleotides upstream of stop codon of GMP synthase (opposite direction) (Figure 1.)
Y	ccggaattcgaatcaggaactgaaactgccc	Reverse, EcoRI site (underlined), 1,094 nucleotides upstream of stop codon of GMP synthase (opposite direction) (Figure 1.)
A1	cgcgtcgtattaaaaatcat	Forward, 143 nucleotides upstream of stop codon of GH20 (Figure 3.)
A2	gatcgataaactggctcgt	Reverse, 139 nucleotides upstream of start codon of GH42 (Figure 3.)
B1	acgcgtcgacagcagctggatatgctga	Forward, SalI site (underlined), 2,316 nucleotides downstream of start codon of GH42 (Figure 3.)
B2	ggaagatctccggtttccagacttctt	Reverse, BglII site (underlined), 159 nucleotides downstream of start codon of hylEfm (Figure 3.)
C1	gttagaagaagtctggaaaccg	Forward, 138 nucleotides downstream of start codon of hylEfm (Figure 3.)
C2	tgctaagatattcctctactcg	Reverse, 798 nucleotides upstream of stop codon of hylEfm (Figure 3.)
D1	acatgcatgcagaattggagccttggtt	Forward, SphI site (underlined), 169 nucleotides upstream of stop codon of hylEfm (Figure 3.)
D2	cggaattctgcttccgcataagaaa	Reverse, EcoRI site (underlined), 319 nucleotides upstream of stop codon of down gene (Figure 3.)
E1	gcaaggcttcttagaga	Forward, ddl E. faecium [32,33]
E2	catcgtgtaagctaacttc	Reverse, ddl E. faecium [32,33]

Figure 2

Physical map of the plasmids pHOU1 and pHOU2 for targeted mutagenesis of . A, plasmid used for construction of TX1330RF (pHylEfmTX16Δ4genes), TX1330RF(pHylEfmTX16Δ), TX1330RF(pHylEfmTX16Δ) and TX1330RF (pHylEfmTX16Δ) deletion mutants (Figure 1); B, plasmid used for construction of the TX1330RF(pHylEfmTX16Δ7,534) deletion mutant (Figure 1)

In order to create a deletion mutant of the hyl-region (which contains genes predicted to be involved in carbohydrate metabolism and transport; Figure 1), fragments upstream (977 bp) and downstream (999 bp) of this region were amplified by PCR (with primers C-D and E-F, respectively; Table 2) and cloned upstream and downstream of the cat gene in pHOU2, respectively, using BamHI and XhoI for the upstream fragment and ApaI and EcoRI for the downstream fragment; the correct insert was confirmed by sequencing in both directions. This recombinant plasmid was introduced into E. faecalis CK111 by electroporation as described previously [25,28] and blue colonies were recovered on brain heart infusion (BHI) agar plates containing gentamicin (125 μg/ml) and X-Gal (200 μg/ml). Subsequently, the pHOU2 derivatives were introduced into strain TX16 by filter mating [29] with E. faecalis CK111 as the donor. Single cross-over integrants were selected on gentamicin (170 μg/ml) and erythromycin (200 mg/ml) and purified colonies were then resuspended in 50 μl of normal saline and plated on MM9YEG media (salts and yeast extract) supplemented with 7 mM of p-Cl-Phe [25] and incubated for 48 h at 37°C. To confirm that colonies which grew on MM9YEG media supplemented with p-Cl-Phe were excisants, the corresponding colonies were grown simultaneously on BHI agar in the presence and absence of gentamicin. Colonies that were susceptible to gentamicin were further screened by PCR, pulsed field gel electrophoresis (PFGE) and hybridizations with hyland cat probes as described before [11]. The mutated region was also sequenced in order to confirm deletion of the corresponding genes. Subsequently, the mutated hyl-containing plasmid (pHylEfmTX16Δ7,534) was transferred from E. faecium TX16 to TX1330RF (a fusidic and rifampin resistant derivative of the commensal strain TX1330, Table 1) by filter mating as described previously [11] to obtain the strain TX1330RF(pHylEfmTX16Δ7,534). Acquisition of the mutated plasmid by TX1330RF was also confirmed by PFGE, PCR, hybridizations and sequencing. S1 nuclease digestion and PFGE was performed with the mutant to confirm that no other plasmid had transferred during the conjugation event as previously described [11].

Complementation of the hyl-region mutant TX1330RF(pHylEfmTX16Δ7,534)

The hylgene was PCR amplified with primers G and H (including the ribosomal binding site and the stop codon of hyl) (Table 2) using total DNA from TX16 as template, and the DNA fragment (1,685 bp) cloned into the shuttle plasmid pAT392 [30] under the control of the P2 promoter (which allows constitutive expression of the cloned genes) and upstream of the aac(6')-aph(2") gene (which is co-transcribed from the same promoter) using SacI and SmaI sites (plasmid pAT392::hyl). In order to evaluate if the deletion of hylhad an effect in the downstream gene (encoding a hypothetical protein of 331 amino acids of unknown function), the hyland down genes (Figure 1) were also cloned together into pAT392 following a similar strategy and using primers G and I (pAT392::hyl-down). Recombinant pAT392-derivatives were purified from E. coli grown on Luria-Bertani agar containing gentamicin (25 μg/ml) and all their DNA inserts sequenced. Subsequently, they were introduced into E. faecium TX1330RF, and the TX1330RF(pHylEfmTX16Δ7,534) mutant by electroporation. Stability of the plasmid constructs was tested by isolating ca. 100 colonies from overnight cultures (using BHI broth) and from the spleens of dead animals (in different experiments) after intraperitoneal inoculation of the corresponding strain (see below) and plating them simultaneously on BHI and BHI-gentamicin (125 μg/ml).

Construction of additional mutants of the hyl-region in E. faecium TX1330RF(pHylEfmTX16)

To investigate the specific role of the hyllocus in E. faecium pathogenesis, complete in-frame deletions of four genes of the hyl-region, hylalone, hylplus its downstream gene and the gene downstream of hylwere generated using TX1330RF(pHylEfmTX16). Fragments upstream and downstream of each region were amplified by PCR with the corresponding primers (Figure 1 and Table 2). These fragments, with overlapping ends, were subsequently amplified by crossover PCR and cloned into pHOU1 using EcoRI and NotI (for hyl, hylplus its downstream gene and the downstream gene of hylmutants); and BamHI and PstI (for the four gene mutant). The inserts were sequenced in both directions to confirm that no mutations had been introduced during the cloning process. The recombinant plasmids were electroporated or transferred by conjugation (using E. faecalis CK111) into TX1330RF(pHylEfmTX16). Single crossover events and deletions of targeted regions (Figure 1) were obtained by plating in BHI with gentamicin and p-Cl-Phe containing medium, respectively, as previously described [25]. Confirmation of the deletion was performed by PCR, PFGE, hybridizations and DNA sequencing.

RT-PCR

RNA was extracted from bacterial cells (TX16, TX1330RF(pHylEfmTX16), TX1330RF and strains containing pAT392 derivatives) grown in BHI broth at 37°C with mild agitation (logarithmic phase of growth, A600 0.8) as described before [31], and using the RNA isolation kit RNAwiz (Ambion, Austin, TX). RNA was treated twice with DNase (DNase-Free solution, Ambion) and synthesis of cDNA was performed using the commercial kit SuperScript One-Step reverse transcription-PCR (RT-PCR) with Platinum Taq (Invitrogen), according to the manufacturer's instructions. The mixture contained 0.2 μM of each primer, designed to detect overlapping transcripts of the four putative metabolic genes (Figure 3) and an internal transcript of hyl(Table 2). A primer pair directed to detect a 550-bp transcript of the housekeeping gene ddlwas used as an internal control for RT-PCR experiments [32,33].

Figure 3

Transcriptional analysis of genes in the region using reverse transcriptase (RT)-PCR. A, physical map of the hylregion and primers used for RT-PCR experiments. Black arrows above the genes indicate the position of the primers used to amplify DNA sequences from the cDNA obtained after reverse transcription. B, RT-PCR using primers A1-A2; C, RT-PCR using primes B1-B2; D, RT-PCR using primers C1-C2; E, RT-PCR using primers D1-D2; F, RT-PCR with ddl as the target gene using primers E1-E2 (Table 2) [32,33]. Lanes 1 and 2, TX1330RF (RT-PCR reaction and control without RT enzyme, respectively); lanes 3 and 4, TX1330RF(pHylEfm16) (RT-PCR reaction and control without RT enzyme, respectively); lanes 5 and 6 TX16(pHylEfm16) (RT-PCR reaction and control without RT enzyme respectively). The molecular weight of the bands is indicated to the right.

Mouse peritonitis model

Female (4 to 6 week old), outbred ICR mice (Harlan Sprague Dawley, Houston) were used as previously described [34]. Groups of 10 mice per inoculum (ranging from 2.3 × 108 to 3.1 × 109 CFU/ml) were included in each experiment. Inocula for each peritonitis experiment were prepared by growing bacteria initially on BHI agar plates. Subsequently, one colony was grown in BHI broth for 24 h at 37°C and the cells were concentrated in saline (0.9%) to an A600 of ca. 1.2. Strains containing pAT392 and derivatives were handled similarly before the intraperitoneal inoculation, except that the BHI agar and broth contained gentamicin (125 μg/ml). Comparison of the survival curves at similar inocula was performed using a log-rank test with Prism for Windows®. A P < 0.05 was considered significant. All experiments were approved by the Animal Welfare committee, University of Texas Health Science Center at Houston.

Results and Discussion

Deletion of 6 genes in the E. faecium hyl-region altered in vitro growth and attenuated virulence of TX1330RF(pHylEfmTX16) but not TX16(pHylEfmTX16) in murine peritonitis

Since acquisition of the transferable pHylEfmTX16 by TX1330RF conferred increased virulence in experimental peritonitis [11], we explored the possibility that the hylregion was an important mediator of this effect. Using RT-PCR assays, we were able to detect in vitro expression of hylduring the exponential phase of growth in both TX16 and TX1330RF (pHylEfmTX16) (Figure 3). RT-PCR with primers located at the 3' and 5' ends of contiguous genes yielded products of the expected size in each case, suggesting that these genes are likely to be co-transcribed (Figure 3). Then, we adapted the pheS* counter-selection system [25] developed for E. faecalis to obtain several deletions of the hyl-region. The hylgene in E. faecium TX16 (http://www.ncbi.nlm.nih.gov/genomeprj/30627, Genbank accession number ACIY00000000) is located in a cluster of genes whose putative function appears to involve the transport and breakdown of carbohydrates (Figure 1) [13]. As an initial step to test the mutagenesis system, a relatively large deletion (7,534 bp) from pHylEfmTX16 was obtained. The deletion involved three genes predicted to encode glycosyl hydrolases (including hyl) and a gene downstream of hylwhose function is unknown (Figure 1). Part (226 nucleotides) of a gene encoding a hypothetical transmembrane protein and located upstream of the putative family 20 glycosyl hydrolase gene and part (202 nucleotides) of a gene located 1,332 nt downstream of hylencoding a putative GMP-synthase and likely transcribed in the opposite direction from the hylcluster (Figure 1) were also deleted. As it is shown in Figure 4A, the deletion of 7,534 bp in the hyl-region did not affect the virulence of TX16 (DO) in murine peritonitis.

Figure 4

Growth and survival curves in the mouse peritonitis model of ) and TX1330RF(pHyl), carrying an intact -region, and pHyl(6 gene mutant of the -region). A, Survival curve of representative inoculum (5 inocula per experiment in two independent experiments) of TX0016(pHylEfmTX16) vs TX0016(pHylEfmTX16Δ7,534) in mouse peritonitis; B, growth curves of TX1330RF(pHylEfmTX16) vs TX1330RF(pHylEfmTX16Δ7,534) and a second transconjugant [TX1330RF(pHylEfmTX16Δ7,534)-TCII] obtained from the same mating experiment between TX16(pHylEfmTX16Δ7,534) and TX1330RF, expressed as optical density (A600) in brain heart infusion (BHI) broth (results of at least three experiments per strain). C and D, survival curves of TX1330RF(pHylEfmTX16) vs TX1330RF(pHylEfmTX16Δ7,534) obtained in the peritonitis model at different inocula in independent experiments performed at different days.

Next, we considered the possibility that an in vivo effect might be more clearly dissected if studies were performed in the background of a non-clinical strain. We hypothesized that an in vivo effect of a virulence determinant might more likely be seen in strains which are less successful clinically; that is, that a commensal strain such as TX1330RF [11] is likely to have decreased fitness or ability to produce disease compared to TX16 [35] and, thus, acquisition plus subsequent loss of a virulence determinant that alters such fitness would be easier to identify [11]. Thus, the mutated plasmid from strain TX16(pHylEfmTX16Δ7,534) was transferred to TX1330RF by conjugation and the in vivo effect of acquiring the intact plasmid [11] vs the plasmid carrying the deletion was evaluated. The two strains [TX1330RF(pHylEfmTX16) and TX1330RF(pHylEfmTX16Δ7,534)] appeared to differ only in the size of the hylplasmid by PFGE and S1 nuclease assays [11] (not shown). Figure 4B shows that deletion of 7,534 bp in the hylregion of TX1330RF(pHylEfmTX16) caused an in vitro growth defect. The alteration of growth was also seen in a second transconjugant from the same mating experiment between TX16(pHylEfmTX16Δ7,534) and TX1330RF (TC-II in Figure 4B). The mutant strain TX1330RF(pHylEfmTX16Δ7,534) was attenuated in the mouse model of peritonitis (even when an increased intraperitoneal inoculum for the mutant were used) (Figure 4C and 4D) (P < 0.05). Due to the alterations produced in the growth of TX1330RF(pHylEfmTX16Δ7,534), these results suggest that the attenuation in virulence may have also been due to factors other than those specifically related to virulence.

Complementation of the hyl-region mutant with hyland a combination of hyland the downstream gene did not restore the virulence of TX1330RF(pHylEfmTX16Δ7,534)

In order to further evaluate if the attenuation observed in TX1330RF(pHylEfmTX16Δ7,534) (as described above) was mediated by a direct effect of hylin the peritonitis model, we explored complementation of this mutant in trans with the full hylgene and a combination of hyland the downstream gene using the shuttle vector pAT392 [30]. The cloning strategy placed these genes upstream of the aac(6')-aph(2") gene (which confers resistance to gentamicin) resulting in all open reading frames under the control of the constitutive P2 promoter. Up to 80% loss was observed with all strains in the absence of gentamicin; however, in the presence of the antibiotic during inoculum preparation, the TX1330RF(pHylEfmTX16Δ7,534)-derivatives containing the pAT392 constructs were stable both in vitro and in vivo (5% maximum percentage of plasmid loss). Introduction of hylor a combination of hylplus its downstream gene (cloned into pAT392) did not restore the virulence of the mutant strain TX1330RF(pHylEfmTX16Δ7,534), compared to pAT392 alone in the presence of gentamicin (Figure 5A and 5B). The results indicate that constitutive expression of hylalone or in combination with its downstream gene (which was confirmed by RT-PCR, not shown) was not able to restore the phenotypic differences observed in the mutant strain TX1330RF(pHylEfmTX16Δ7,534), supporting the fact that hylmay not be directly responsible of the attenuation observed in the mutant.

Figure 5

Survival curves in the mouse peritonitis model of . A and B show survival curves of the TX1330RF(pHylEfmTX16Δ7,534) (6 gene mutant in the hylregion) complemented with pAT392-derivatives (which include pAT392::hyland pAT392::hyl-down) obtained in the peritonitis model at different inocula in independent experiments performed at different days. The asterisk indicates that the lines are superimposed since values are identical.

Under our experimental conditions, we cannot completely rule out that the in vivo attenuation observed with pHylEfmTX16Δ7,534 in the TX1330RF background may have been caused by the partial deletion of the hypothetical transmembrane protein or the putative GMP-synthase located upstream and downstream of the hyl-cluster, respectively. Indeed, a deletion of 76 amino acids in the C-terminus of the hypothetical membrane protein occurred in this plasmid, resulting in the deletion of three predicted transmembrane helices. Similarly, 68 amino acids in the C-terminus of the putative GMP-synthase were deleted; the removal of these amino acids is likely to disturb the dimerization domain of this protein [36] affecting its function in nucleotide metabolism. Moreover, a second TX1330RF(pHylEfmTX16Δ7,534) mutant also exhibited an almost identical growth defect (Figure 4B). Thus, it is tempting to speculate that changes in these two genes may have affected the "metabolic" fitness of the TX1330RF(pHylEfmTX16Δ7,534) strain. However, since no evident change in fitness or virulence was observed with the mutated plasmid in the TX16 background, another possibility is that an extraneous change elsewhere in the plasmid (or chromosome) occurred during the conjugation process that influenced the in vitro growth of the TX1330RF(pHylEfmTX16Δ7,534) mutant(s) and its virulence.

Additional deletions of genes in the hyl-region did not alter the virulence of TX1330RF(pHylEfmTX16) in the mouse peritonitis model

In order to dissect further the in vivo role of hyland the adjacent genes, we produced several in-frame deletions of these genes (Figure 1) including: ) a four gene mutant of the hyl-region (including hyl) [TX1330RF(pHylEfmTX16Δ4genes)], ) a deletion of hylalone [TX1330RF (pHylEfmTX16Δ)], ) a deletion of hylplus its downstream gene mutant [TX1330RF (pHylEfmTX16Δ)] and, ) a single deletion of the gene located downstream from hyl[TX1330RF (pHylEfmTX16Δ)]. The mutagenesis strategy removed the open reading frame from the start codon of the first gene to the stop codon of the last gene (in case of multiple genes). In case of single gene deletion, the complete ORF (start to stop codon) was removed, leaving the surrounding DNA intact as in the wild type plasmid. None of the four mutants of the hyl-region showed a deleterious effect in the growth kinetics compared to TX1330RF (pHylEfmTX16) (harbouring an intact plasmid, Additional file 1). Moreover, we were unable to observe any attenuation of virulence in the mouse peritonitis model compared to the parental strain with the intact plasmid (Figure 6A-D), which further supports the fact that the four genes of the hylregion do not appear to be directly involved in increasing the pathogenic potential of pHylEfmTX16 in strain TX1330RF(pHylEfmTX16).

Figure 6

Survival curves in the mouse peritonitis model of ) and deletion mutants (Figure 1 and Table 1) showing representative inocula (5 inocula per each experiment). A, TX1330RF(pHylEfmTX16) vs TX1330RF(pHylEfmTX16Δ4genes); B, TX1330RF(pHylEfmTX16) vs TX1330RF (pHylEfmTX16Δhyl); C, TX1330RF(pHylEfmTX16) vs TX1330RF(pHylEfmTX16Δ); D, TX1330RF(pHylEfmTX16) vs TX1330RF(pHylEfmTX16Δ)

Megaplasmids (>145 kb, with or without hyl) have been recently found to be widespread among clinical isolates of E. faecium worldwide [12,13,15]. The proportion of these plasmids carrying hylappears to vary according to geographical location (ca. 11 to 36%) [12,13]. Our findings indicate that the four genes of the hyl-cluster studied here, including hylare not the main mediators of the virulence effect conferred by the plasmid carrying them in experimental peritonitis. Since the pHylEfm plasmids are large, it is presumed that other genes (i.e., upstream or downstream of the glycoside hydrolase-encoding genes) are more relevant in mediating this effect. Additionally, we cannot exclude that the hylcluster studied in this work may play a role in other infections such as endocarditis or urinary tract infections (a subject of our ongoing studies). As a final remark, the adaptation of the pheS* counter-selection system for targeted mutagenesis in plasmid and chromosomal genes of E. faecium will facilitate the understanding of the role of other specific plasmid genes in the pathogenesis of E. faecium infections in the near future.

Conclusions

We provided evidence that four genes of the hyl-region (including hyl) do not mediate the virulence effect of the E. faecium plasmid pHylEfm in experimental peritonitis. The adaptation of the PheS* counter-selection system for targeted mutagenesis of E. faecium should facilitate the study of the role of other pHylEfm genes in the pathogenesis of murine peritonitis.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

DP carried out molecular genetics studies, animal experiments and participated in editing the manuscript. MCM, SR and MFM performed molecular genetics experiments. KVS carried out part of the animal work. BEM and LBR participated in editing the manuscript and data analysis. CAA is the principal investigator, conceived the study, designed the experiments, performed data analysis and wrote the manuscript. All authors read and approved the final version of the manuscript.

Additional file 1

Growth curves of . The strains were incubated in BHI broth and the A600 were measured every hour.

Click here for file