Literature DB >> 21212128

Silencing microRNA by interfering nanoparticles in mice.

Jie Su1, Huricha Baigude, Joshua McCarroll, Tariq M Rana.   

Abstract

MicroRNAs (miRNAs) are small endogenous non-coding RNAs that regulate post-transcriptional gene expression and are important in many biological processes. Disease-associated miRNAs have been shown to become potential targets for therapeutic intervention. Functions of miRNAs can be inhibited by using antisense oligonucleotides, called anti-miRs, complimentary to the miRNA sequences. Here, we show that systemic delivery of a chemically stabilized anti-miR-122 complexed with interfering nanoparticles (iNOPs) effectively silences the liver-expressed miR-122 in mice. Intravenous administration of 2 mg kg(-1) chemically modified anti-miR-122 complexed with iNOP-7 resulted in 83.2 ± 3.2% specific silencing of miR-122, which was accompanied by regulating gene expression in liver and lowering of plasma cholesterol. The specific silencing of miR-122 was long lasting and did not induce an immune response. Our results demonstrate that iNOPs can successfully deliver anti-miR to specifically target and silence miRNA in clinically acceptable and therapeutically affordable doses.

Entities:  

Mesh:

Substances:

Year:  2011        PMID: 21212128      PMCID: PMC3064800          DOI: 10.1093/nar/gkq1307

Source DB:  PubMed          Journal:  Nucleic Acids Res        ISSN: 0305-1048            Impact factor:   16.971


INTRODUCTION

MicroRNAs (miRNAs) are small endogenous non-coding RNAs that post-transcriptionally regulate gene expression by binding with imperfect complementarity in 3′-untranslated regions (3′-UTR) of their target mRNAs (1–4). miRNAs have been shown to play an important role in development, and cell growth and differentiation (5,6). Recent studies have highlighted the role of miRNAs in various disease states and in regulating host–pathogen interactions (7). For example, mRNAs have been implicated in cardiovascular disease (8), inflammation (9), viral infections (10–13) and cancers (14,15). Hence, disease-associated miRNAs could become potential targets for therapeutic intervention (7). MicroRNA-122 (miR-122) is a liver-specific miRNA, with suggested roles in cholesterol, fatty acid and lipid metabolism (16–18). miR-122 interacts with hepatitis C virus genome facilitating viral replication in host cell (10,19,20). In vivo silencing of miR-122 has been achieved by systemic administration of antagomirs or modified antisense oligonucleotides in mice or non-human primates (16–18,21). These studies were very encouraging in providing proof of the concept for silencing miRNA by its anti-miR sequences in vivo. Recently, therapeutic silencing of miR-122 in primates with chronic hepatitis C virus infection has been reported by using locked nucleic acid (LNA) modified oligonucleotide (SPC3649) complimentary to miR-122 (22). Remarkably, SPC3649 treatment caused long-lasting suppression of HCV viremia in primates with no apparent evidence of side effects or viral resistance indicating that the anti-miR therapeutic strategy could lead to the development of new drugs for viral infections. We recently reported successful silencing of apoB mRNA by iNOP-7 after systemic administration of 1 mg kg−1 siRNA in mice (23). iNOP-7 is a new nanomaterial for systemic delivery of RNAi developed by our laboratory, which is a lysine-containing nanoparticle with the surface functional groups modified with lipid chains (23,24). A clear correlation between siRNA localization, cellular uptake and RNAi activity was observed when siRNA was delivered into cells using siRNA-TAT47–57-peptide, siRNA-TAT47–57-derived oligocarbamate conjugates or nanoparticles (25). For successful RNAi, the localization of siRNA was distinctly cytoplasmic suggesting that siRNA is targeted to these regions for interactions with RISC to induce RNAi (25). Recent advances in understanding the rules for chemically modifying siRNA sequences without compromising their gene-silencing efficiency [(26–28), reviewed in (4)] have allowed the design and synthesis of therapeutically effective siRNA molecules that can silence target genes in vivo [(29–31), reviewed in (32)]. We reasoned that a chemically stabilized anti-miR could be assembled with iNOP-7 to target miRNA sequences and inhibit their functions in vivo. To enhance the stability of anti-miR molecules, we chemically stabilized the oligonucleotides according to modification rules established in our previous studies [(27,28), reviewed in (4)]. In this study, we tested this concept and determined the silencing efficiency of miR-122 using iNOP-7 in mice.

MATERIALS AND METHODS

Oligonucleotides

RNAs were purchased from Dharmacon (Lafayette, CO, USA) and consisted of 23-24 nucleotides length with modifications as specified: chemically modified anti-miR-122 (CM): 5′-ACFAAACFACFCFAUUGUCACACUCCA-3′; chemically modified mismatch anti-miR-122 (MM): 5′-UCACFAACFCUCCFUAGAAAGAGUAGA-3′. The superscript letter F represents 2′-O-F modified nucleotides. Chemical modifications were designed based on our previously published rules established in our laboratory [(27,28), reviewed in (4)]. The complexes were prepared by mixing CM or MM anti-miR with iNOP-7 at a ratio of 1:10 (w/w) in HEPES saline or Opti-MEM culture medium (Invitrogen, Carlsbad, CA, USA) and incubating at room temperature for 20 min (see below).

In vitro silencing miR-122

Huh-7 cells (kindly provided by John Taylor, Fox Chase Cancer Center) were maintained at 37°C with 5% CO2 in DMEM with High Glucose culture medium (Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum, 100 U ml−1 penicillin and 100 µg ml−1 streptomycin. Cells were regularly passaged and plated in 6-well culture plates for 16 h before transfection at 70% confluency. The anti-miRs were transfected in Opti-MEM serum free culture medium for 4 h at 37°C, and then changed to normal medium with 10% FBS. Efficiency of silencing was determined by northern blotting as described below.

Dual luciferase assay

The miR-122 luciferase constructs were engineered by inserting the full 23-bp sequence complementary to the mature miR-122 into the 3′-UTR of pGL3-Control (Promega, Madison WI, USA). Huh-7 cells were seeded in 24-well culture plates and transfected with 0.1 µg miR-122 pGL3-control plasmid and 0.015 µg pRL-TK plasmid (Promega, Madison WI, USA) for normalization using iNOP-7. After 4 h of transfection, cells were treated with complete media. Cells were lysed 48 h later, unless otherwise indicated, and luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, Madison WI, USA). These quantitative assays were conducted in multiple replicates for each concentration.

In vivo silencing miR-122

All animal procedures were approved by the Institutional Animal Care and Use Committee (University of Massachusetts Medical School). Six- to eight-week-old male C57BL/6 mice (Charles River Laboratories, Wilmington, MA, USA) were maintained under a 12 h dark cycle in a pathogen-free animal facility. Mice were administrated with either phosphate buffered saline (PBS) pH 7.4 or iNOP-7 complexes (as indicated) at 2 mg kg−1 body weight in 0.2 ml per injection as bolus injection via the lateral tail vein at 0, 12 and 36 h. Measurements of miRNA or mRNA levels in tissues were performed 24 h after the last injection unless indicated otherwise. Liver and plasma were collected and stored in −80°C until analysis. The in vivo silencing experiments were repeated at least twice and multiple samples were collected from tissues for quantitative analysis.

Northern blotting

RNA from cell culture or mouse livers was homogenized in TRIZOL (Invitrogen, Carlsbad, CA, USA) and isolated according to the manufacturer’s instructions. Total RNA was separated on a 14% acrylamide/20% formamide/8 M urea gel, then electroblotted onto Hybond-XL nylon membrane (GE Healthcare, Piscataway, NJ, USA). The probe with γ-32P-labeled oligonucleotides for miRNA or rRNA was hybridized to the membrane at 42°C. The blots were visualized by scanning in a FLA-5000 scanner (Fujifilm, Stamford, CT, USA).

Quantitative RT/PCR

To determine regulations of mRNA levels in mouse tissues after anti-miR treatment, total RNA was extracted with TRIZOL (Invitrogen, Carlsbad, CA, USA) and treated with TURBO DNA-free kit (Applied Biosystems, Foster City, CA, USA) before quantification. At least two liver regions were used to extract total RNA from individual animals in each group of three animals. In preparation for quantitative PCR, total RNA (400 ng) was reverse transcribed by using SuperScript II (Invitrogen, Carlsbad, CA, USA) and random primers according to the manufacturer’s protocol. The expression of mRNA was measured using ABsolute QPCR SYBR green mix (ThermoFisher Scientific, Epsom, Surrey, UK) normalized to GAPDH according to the manufacturer’s instructions. Quantitative PCR was performed by using a Chromo4 Real-Time PCR Detection System (BioRad, Hercules, CA, USA). We used the following primers: ACACB forward: GGGCTCCCTGGATGACAAC, reverse: TTCCGGGAGGAGTTCTGGA; Acas2 forward: GTGGCCATATGCTGACCCCTCTCC, reverse: GGCAGCCATCTCCGGTCACATAGT; AldoA forward: CAGGAAAGCAACTGCCACCGGCAC, reverse: GGATTCACACGGTCGTCTGCAGTC; ApoB forward: TTCCAGCCATGGGCAACTTTACCT, reverse: TACTGCAGGGCGTCAGTGACAAAT; FASN forward: ACGAGTGAGTGTACGGGAGG, reverse: GACCAGGGTGTCTCCAAGTC; GAPDH forward: ATCAAGAAGGTGGTGAAGCAGGCA, reverse: TGGAAGAGTGGGAGTTGCTGTTGA; GYS1 forward: CGGCTTTGGCTGCTTTATG, reverse: ACCTCCGATCCAGAATGTAAATG; HMGCR forward: TCTGGCAGTCAGTGGGAACTATT, reverse: CCTCGTCCTTCGATCCAATTT; P4HA1 forward: CTGTTCTGCCGCTACCATGA, reverse: CCCACTCGTCCTCCTGCTT; SCD1 forward: TTCCGCCACTCGCCTACA, reverse: CTTTCCCAGTGCTGAGATCGA; SLC7A1 forward: GCAACTTGGACCAGTGCAAA, reverse: ACCCGTCAACCGCTGTCA.

Measurement of total cholesterol levels in plasma

Plasma cholesterol was measured by Cholesterol E kit according to the manufacturer’s instructions (Wako, Richmond, VA, USA). Three animals in each group and two aliquots of plasma samples were used for measurement of cholesterol.

In vivo interferon induction

To assess for any non-specific immune response to injected iNOP-containing anti-miR, mouse liver tissue RNA was analyzed for expression of the IFN-inducible genes by quantitative RT-PCR. At least two liver regions were used to extract total RNA from individual animals in each group of three animals.

Statistical analysis

Results are given as means±SD. Statistical analyses were preformed with Student’s t-test, and the null hypothesis was rejected at the 0.05 levels. We also performed one-way ANOVA analysis and the results showed that chemically modified group was significantly different from other two groups (P < 0.5).

RESULTS AND DISCUSSION

We first evaluated the silencing potency of iNOP-7 containing chemically modified anti-miR-122 in Huh-7 cells. We transfected these cells by iNOP-7-containing anti-miR-122 and analyzed the miR-122 by northern blotting (Figure 1A). iNOP-7 efficiently delivered anti-miR-122 into the cells and specifically silenced miR-122 in a dose-dependent manner. The endogenous miR-122 was slightly reduced by 10 pM of anti-miR-122 compared with nontransfected control and ∼90% of miR-122 was silenced at 1 nM, which is at least 50 times lower than 2′-OMe and/or LNA modified anti-miR inhibitors transfected by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) (33). These results suggest that iNOP-7 can efficiently deliver our chemically modified anti-miR to cytoplasm and the released anti-miR results in lowering the miR-122 levels in cell (17). To determine the specificity of our anti-miR delivery by iNOP, we analyzed miR-22. Since miR-22 is highly expressed both in Huh-7 cell line and mouse liver tissue, therefore, miR-22 quantitation should serve as a control for the specificity of anti-miR-122. Our results showed that the expression level of miR-22 was unaffected by the transfection, indicating that the anti-miR silencing was miRNA specific (Figure 1A and B).
Figure 1.

Specific silencing of miR-122 in a dose-dependent manner by iNOP-7 in vitro. (A) Huh-7 cells were transfected by iNOP-7 containing anti-miR-122 at varying concentrations as indicated for 4 h. Total RNA was isolated from cells 24 h after transfection and separated on 14% polyacrylamide gels. Membrane was probed for miR-122 and miR-22, respectively. 5S rRNA is shown as a loading control. (B) Quantification of reduced miR-122 levels in Huh-7 cells after transfected with iNOP-7 containing anti-miR-122. Northern blots of miR-122 and miR-22 (panel A) were analyzed by densitometry and normalized to 5S rRNA.

Specific silencing of miR-122 in a dose-dependent manner by iNOP-7 in vitro. (A) Huh-7 cells were transfected by iNOP-7 containing anti-miR-122 at varying concentrations as indicated for 4 h. Total RNA was isolated from cells 24 h after transfection and separated on 14% polyacrylamide gels. Membrane was probed for miR-122 and miR-22, respectively. 5S rRNA is shown as a loading control. (B) Quantification of reduced miR-122 levels in Huh-7 cells after transfected with iNOP-7 containing anti-miR-122. Northern blots of miR-122 and miR-22 (panel A) were analyzed by densitometry and normalized to 5S rRNA. To evaluate the specific anti-miRNA effectiveness, we incorporated the perfectly complementary miR-122 binding sites into the 3′-UTR of a luciferase sensor plasmid as previously reported (34–36). When the reporter was transfected into Huh-7 cells, the endogenously expressed miR-122 strongly repressed the luciferase sensor expression by binding with perfect complementarity and causing cleavage of the mRNA. Introduction of anti-miR-122 by iNOP-7 prevented this miR-122-mediated repression, resulting in increased luciferase expression (Figure 2). The results are inversely consistent with the silencing effect of endogenous miR-122 by iNOP-7 containing anti-miR-122 detected by northern blotting in Figure 1.
Figure 2.

Inhibition of miR-122 by iNOP-7 in vitro determined by dual luciferase assays. Huh-7 cells were transfected with miR-122 luciferase construct containing sequence complementary to the mature miR-122 into the 3′-UTR and varying amounts of anti-miR oligonucleotides using iNOP-7 for 4 h. Cells were lysed 48 h later, and luciferase activities were measured using the Dual-Luciferase Reporter Assay System as described previously (39,40). FL and RL represent firefly luciferase and renilla luciferase, respectively.

Inhibition of miR-122 by iNOP-7 in vitro determined by dual luciferase assays. Huh-7 cells were transfected with miR-122 luciferase construct containing sequence complementary to the mature miR-122 into the 3′-UTR and varying amounts of anti-miR oligonucleotides using iNOP-7 for 4 h. Cells were lysed 48 h later, and luciferase activities were measured using the Dual-Luciferase Reporter Assay System as described previously (39,40). FL and RL represent firefly luciferase and renilla luciferase, respectively. We next determined the ability of iNOP-7 to deliver anti-miR-122 to its target and silence miR-122 in vivo. In our previous experiments, we observed efficient silencing of ApoB as reported by Soutschek et al. (30) when we injected mice with 80 mg kg−1 chemically modified siRNA conjugated with cholesterol (data not shown). Since 80 mg kg−1 doses of RNA are not clinically feasible, our goal in this study was to test the ability of iNOP-7 to inhibit miRNA functions at clinically acceptable doses. Therefore, we did not pursue in vivo experiments using RNA without the iNOP-7 assembly. Mice were injected via tail vein with iNOP-7 complexed to either chemically modified anti-miR-122 or its mismatch on three consecutive days, and samples of liver and plasma were analyzed. miR-122 was significantly lower in liver tissue from mice treated with 2 mg kg−1 iNOP-7 containing chemically modified anti-miR-122 (83.2 ± 6.4%, n = 3 animals) than in livers from control mice (Figure 3). The effects of anti-miR-122 were found to be specific because mice injected with iNOP-7 containing mismatched anti-miR-122 has no effect on miR-122. Furthermore, the expression of miR-22 was unaffected in mice treated with anti-miR-122 and its mismatch, suggesting that silencing was miRNA specific.
Figure 3.

Specific silencing of miR-122 in mice treated with iNOP-7 assembled with chemically modified anti-miR-122. (A) Mice were intravenously injected with 2 mg kg−1 of iNOP-7 containing chemically modified anti-miR-122, mismatched chemically modified anti-miR-122, or PBS at 0, 12 and 36 h. Tissues were harvested at 24 h after the last injection to measure miRNA or mRNA levels. Total RNA was isolated from mouse liver 24 h after last injection. Samples were separated in 14% polyacrylamide gel and membrane was probed for miR-122, miR-22 and 5S rRNA. 5S rRNA is shown as a loading control. (B) Quantification of reduced miR-122 levels in mice after treatment with iNOP-7 containing anti-miR-122. Northern blots of miR-122 and miR-22 (A) were analyzed by densitometry after normalized to 5S rRNA. Data are expressed as percent of control (two or three animals).

Specific silencing of miR-122 in mice treated with iNOP-7 assembled with chemically modified anti-miR-122. (A) Mice were intravenously injected with 2 mg kg−1 of iNOP-7 containing chemically modified anti-miR-122, mismatched chemically modified anti-miR-122, or PBS at 0, 12 and 36 h. Tissues were harvested at 24 h after the last injection to measure miRNA or mRNA levels. Total RNA was isolated from mouse liver 24 h after last injection. Samples were separated in 14% polyacrylamide gel and membrane was probed for miR-122, miR-22 and 5S rRNA. 5S rRNA is shown as a loading control. (B) Quantification of reduced miR-122 levels in mice after treatment with iNOP-7 containing anti-miR-122. Northern blots of miR-122 and miR-22 (A) were analyzed by densitometry after normalized to 5S rRNA. Data are expressed as percent of control (two or three animals). We also tested the duration of silencing that could be achieved after the injection of iNOP-7 containing chemically modified anti-miR-122. Mice were injected with 2 mg kg−1 of iNOP-7 containing chemically modified anti-miR-122 via tail vein, isolating liver tissues at various times after injection, and analyzing liver for miR-122 levels. At day 1, miR-122 level was significantly decreased (over 80% compared to PBS control mice), and the effect lasted at least for 9 days, indicating that silencing of miRNA by iNOP-7 containing chemically modified anti-miR-122 is long lasting effects (Figure S1). MicroRNA can regulate the mRNA levels of their targets in 3′-UTR (37,38) and pharmacological silencing miRNAs using iNOP-7 containing chemically modified anti-miR-122 might therefore lead to the regulation of many mRNAs. To demonstrate the efficacy of the miRNA inhibition in vivo, the levels of a set of miR-122 target mRNAs identified previously (16,17) were evaluated in quantitative RT-PCR (Figure 4). Four of ten target mRNAs were increased in the anti-miR-122 treated mice, among which SLC7A1 mRNA was most sensitive to miR-122 inhibition (fold increase 5.7 ± 0.7) (Figure 4A). The other six mRNAs were down-regulated after the inhibition of miR-122 and SCD1 was decreased to 4.3 ± 1.7% of control after the inhibition (Figure 4B). No target mRNA changes were observed in mice treated with mismatched anti-miR-122, demonstrating specific inhibition of miR-122 activity in liver.
Figure 4.

Regulations of gene expression by anti-miR-122-iNOP-7 treatment in mice. Mice were intravenously injected with 2 mg kg−1 of iNOP-7 containing chemically modified anti-miR-122, mismatched chemically modified anti-miR-122, or PBS at 0, 12 and 36 h. Tissues were harvested at 24 h after the last injection to measure miRNA or mRNA levels. Total RNA was isolated from mouse liver 24 h after last injection. mRNA levels were up-regulated (A) or down-regulated (B) in liver 24 h after last injection. Values represent the mean ± SD of tissue samples for two liver regions (three animals). Data are expressed as percent of PBS treated mice. AldoA, aldolase 1, A isoform; GYS1, glycogen synthase 1; P4HA1, procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide; SLC7A1, solute carrier family 7 (cationic amino acid transporter, y+ system), member 1; ACACB, acetyl-coenzyme A carboxylase beta; Acas2, acetyl-coenzyme A synthetase 2; ApoB, apolipoprotein B; FASN, fatty acid synthase; HMGCR, 3-hydroxy-3-methylglutaryl-coenzyme A reductase; SCD1, stearoyl-coenzyme A desaturase 1. (C) Total cholesterol in plasma after anti-miR-122 treatment of mice. Mice were injected with 2 mg kg−1 of iNOP-7 containing chemically modified anti-miR-122, mismatched chemically modified anti-miR-122 and PBS on three consecutive days. Plasma was collected at 24 h after last injection and total cholesterol was measured by Cholesterol E kit from Wako (n = 3 animals). *P < 0.05.

Regulations of gene expression by anti-miR-122-iNOP-7 treatment in mice. Mice were intravenously injected with 2 mg kg−1 of iNOP-7 containing chemically modified anti-miR-122, mismatched chemically modified anti-miR-122, or PBS at 0, 12 and 36 h. Tissues were harvested at 24 h after the last injection to measure miRNA or mRNA levels. Total RNA was isolated from mouse liver 24 h after last injection. mRNA levels were up-regulated (A) or down-regulated (B) in liver 24 h after last injection. Values represent the mean ± SD of tissue samples for two liver regions (three animals). Data are expressed as percent of PBS treated mice. AldoA, aldolase 1, A isoform; GYS1, glycogen synthase 1; P4HA1, procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha 1 polypeptide; SLC7A1, solute carrier family 7 (cationic amino acid transporter, y+ system), member 1; ACACB, acetyl-coenzyme A carboxylase beta; Acas2, acetyl-coenzyme A synthetase 2; ApoB, apolipoprotein B; FASN, fatty acid synthase; HMGCR, 3-hydroxy-3-methylglutaryl-coenzyme A reductase; SCD1, stearoyl-coenzyme A desaturase 1. (C) Total cholesterol in plasma after anti-miR-122 treatment of mice. Mice were injected with 2 mg kg−1 of iNOP-7 containing chemically modified anti-miR-122, mismatched chemically modified anti-miR-122 and PBS on three consecutive days. Plasma was collected at 24 h after last injection and total cholesterol was measured by Cholesterol E kit from Wako (n = 3 animals). *P < 0.05. To investigate the physiological effects of miR-122 silencing on cholesterol metabolism, we measured total plasma cholesterol levels in mice 24 h after the last injection. Chemically modified anti-miR-122 mediated regulation of gene expression in liver caused the reduction of total cholesterol in plasma (26.3 ± 12.5%) as shown in Figure 4C. Cholesterol levels were unchanged in mice receiving control treatments or treated with iNOP-7 containing chemically modified, mismatched anti-miR-122. This result demonstrates that iNOP-7-mediated targeting of miR-122 could provide a clinically significant new approach to reducing cholesterol levels in patients with hypercholesterolemia. To address the concern of eliciting a non-specific immune response by injecting animals with iNOP-7 containing chemically modified anti-miR-122, liver tissue RNA was assessed by quantitative PCR for the induction of the interferon inducible genes interferon-induced protein with tetratricopeptide repeats 1 (IFIT1), signal transducers and activators of transcription 1 (STAT1) and 2′,5′-oligoadenylate synthetase 1 (OAS1). Our results showed that injecting mice with iNOP-7 containing either chemically modified or mismatched anti-miR-122 did not alter the expression of these genes in the liver, suggesting iNOP-7 treatment did not induce an immune response in mice (Figure S2). Anti-miR-122 was well tolerated after injection of 2 mg kg−1 of chemically modified anti-miR-122 complexed with iNOP-7 on three consecutive days; no alterations in overall health, body weight and food intake were detected. Together, these data indicate that iNOP-7 containing chemically modified anti-miR-122 participates in regulation of the cholesterol biosynthetic pathway and that silencing of a miRNA can be achieved without apparent toxicities. Taken together, our results show that the newly designed nanoparticles can be used to deliver both duplex siRNA as we reported previously (23) and single-stranded anti-miR oligonucleotides to silence disease-related endogenous genes or miRNA in clinically acceptable and therapeutically affordable doses. When we injected iNOP-7 containing chemically modified anti-miR into animals, miRNA was specifically silenced and the expression of target genes were subsequently altered in liver, total plasma cholesterol was lowered. In addition, iNOP-7 treatment was non-toxic and did not induce an immune response. An important benefit of employing anti-miR oligonucleotides at low doses as presented here is that these strategies would avoid non-specific effects generated by the presence of excess anti-miR during purification and analysis procedures. Furthermore, iNOP-7 can be modified to target specific tissues and to modulate pharmacological properties to develop tissue-specific RNAi-based therapies. Although additional studies will be needed to optimize the dosing regimen and to assess the biodistribution and safety after long-term treatment, our findings highlight the utility of nanoparticles to deliver chemically modified anti-miR to liver tissues to silence endogenous miRNA in mice at clinical feasible doses.

SUPPLEMENTARY DATA

Supplementary Data are available at NAR Online.

FUNDING

Institutional support and National Institutes of Health (AI 41404, AI 43198, NS060856 to T.M.R., partial). Funding for open access charge: NIH. Conflict of interest statement. None declared.
  40 in total

1.  RNAi in human cells: basic structural and functional features of small interfering RNA.

Authors:  Ya-Lin Chiu; Tariq M Rana
Journal:  Mol Cell       Date:  2002-09       Impact factor: 17.970

Review 2.  The role of RNAi and microRNAs in animal virus replication and antiviral immunity.

Authors:  Jennifer L Umbach; Bryan R Cullen
Journal:  Genes Dev       Date:  2009-05-15       Impact factor: 11.361

3.  Potent RNAi by short RNA triggers.

Authors:  Chia-Ying Chu; Tariq M Rana
Journal:  RNA       Date:  2008-07-24       Impact factor: 4.942

4.  Cellular microRNA and P bodies modulate host-HIV-1 interactions.

Authors:  Robin Nathans; Chia-Ying Chu; Anna Kristina Serquina; Chih-Chung Lu; Hong Cao; Tariq M Rana
Journal:  Mol Cell       Date:  2009-06-26       Impact factor: 17.970

5.  New hope for a microRNA therapy for liver cancer.

Authors:  John J Rossi
Journal:  Cell       Date:  2009-06-12       Impact factor: 41.582

6.  Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection.

Authors:  Robert E Lanford; Elisabeth S Hildebrandt-Eriksen; Andreas Petri; Robert Persson; Morten Lindow; Martin E Munk; Sakari Kauppinen; Henrik Ørum
Journal:  Science       Date:  2009-12-03       Impact factor: 47.728

Review 7.  miRiad roles for the miR-17-92 cluster in development and disease.

Authors:  Joshua T Mendell
Journal:  Cell       Date:  2008-04-18       Impact factor: 41.582

Review 8.  Delivery of therapeutic RNAi by nanovehicles.

Authors:  Huricha Baigude; Tariq M Rana
Journal:  Chembiochem       Date:  2009-10-12       Impact factor: 3.164

Review 9.  The promises and pitfalls of RNA-interference-based therapeutics.

Authors:  Daniela Castanotto; John J Rossi
Journal:  Nature       Date:  2009-01-22       Impact factor: 49.962

Review 10.  MicroRNAs: target recognition and regulatory functions.

Authors:  David P Bartel
Journal:  Cell       Date:  2009-01-23       Impact factor: 41.582

View more
  27 in total

Review 1.  The duality of oncomiR addiction in the maintenance and treatment of cancer.

Authors:  Christopher J Cheng; Frank J Slack
Journal:  Cancer J       Date:  2012 May-Jun       Impact factor: 3.360

Review 2.  Therapeutic targeting of microRNAs: current status and future challenges.

Authors:  Zhonghan Li; Tariq M Rana
Journal:  Nat Rev Drug Discov       Date:  2014-07-11       Impact factor: 84.694

Review 3.  Epigenetics and genetics. MicroRNAs en route to the clinic: progress in validating and targeting microRNAs for cancer therapy.

Authors:  Andrea L Kasinski; Frank J Slack
Journal:  Nat Rev Cancer       Date:  2011-11-24       Impact factor: 60.716

Review 4.  MicroRNA silencing and the development of novel therapies for liver disease.

Authors:  Gyongyi Szabo; Peter Sarnow; Shashi Bala
Journal:  J Hepatol       Date:  2012-04-12       Impact factor: 25.083

5.  Nanoparticle-based therapy in an in vivo microRNA-155 (miR-155)-dependent mouse model of lymphoma.

Authors:  Imran A Babar; Christopher J Cheng; Carmen J Booth; Xianping Liang; Joanne B Weidhaas; W Mark Saltzman; Frank J Slack
Journal:  Proc Natl Acad Sci U S A       Date:  2012-06-08       Impact factor: 11.205

Review 6.  Progress in microRNA delivery.

Authors:  Yu Zhang; Zaijie Wang; Richard A Gemeinhart
Journal:  J Control Release       Date:  2013-09-25       Impact factor: 9.776

Review 7.  Canonical and non-canonical barriers facing antimiR cancer therapeutics.

Authors:  Christopher J Cheng; W Mark Saltzman; Frank J Slack
Journal:  Curr Med Chem       Date:  2013       Impact factor: 4.530

Review 8.  MicroRNAs in liver disease.

Authors:  Gyongyi Szabo; Shashi Bala
Journal:  Nat Rev Gastroenterol Hepatol       Date:  2013-05-21       Impact factor: 46.802

9.  Lactosylated gramicidin-based lipid nanoparticles (Lac-GLN) for targeted delivery of anti-miR-155 to hepatocellular carcinoma.

Authors:  Mengzi Zhang; Xiaoju Zhou; Bo Wang; Bryant C Yung; Ly J Lee; Kalpana Ghoshal; Robert J Lee
Journal:  J Control Release       Date:  2013-04-06       Impact factor: 9.776

Review 10.  Gene regulation by non-coding RNAs.

Authors:  Veena S Patil; Rui Zhou; Tariq M Rana
Journal:  Crit Rev Biochem Mol Biol       Date:  2013-10-28       Impact factor: 8.250

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.