Comparative sequence analysis of the potato cyst nematode resistance locus H1 reveals a major lack of co-linearity between three haplotypes in potato (Solanum tuberosum ssp.).

The H1 locus confers resistance to the potato cyst nematode Globodera rostochiensis pathotypes 1 and 4. It is positioned at the distal end of chromosome V of the diploid Solanum tuberosum genotype SH83-92-488 (SH) on an introgression segment derived from S. tuberosum ssp. andigena. Markers from a high-resolution genetic map of the H1 locus (Bakker et al. in Theor Appl Genet 109:146-152, 2004) were used to screen a BAC library to construct a physical map covering a 341-kb region of the resistant haplotype coming from SH. For comparison, physical maps were also generated of the two haplotypes from the diploid susceptible genotype RH89-039-16 (S. tuberosum ssp. tuberosum/S. phureja), spanning syntenic regions of 700 and 319 kb. Gene predictions on the genomic segments resulted in the identification of a large cluster consisting of variable numbers of the CC-NB-LRR type of R genes for each haplotype. Furthermore, the regions were interspersed with numerous transposable elements and genes coding for an extensin-like protein and an amino acid transporter. Comparative analysis revealed a major lack of gene order conservation in the sequences of the three closely related haplotypes. Our data provide insight in the evolutionary mechanisms shaping the H1 locus and will facilitate the map-based cloning of the H1 resistance gene.

Introduction

Potato (Solanum tuberosum) is the fourth most important food crop in the world. Worldwide more than 19 million ha of potatoes are grown with a total economic value higher than 31 billion US$ (http://www.potato2008.org/en/world/index.html). Potato was brought to Europe by Spanish explorers in the sixteenth century from the Andean region of South America (Bradshaw and Ramsay 2005). Since then, it has been cultivated as a food crop by vegetative propagation of tubers. Together with the potatoes, the potato cyst nematodes (PCN) species Globodera pallida and G. rostochiensis became introduced into the old world. With the rapidly increasing acreage of cultivated potato in years following its introduction, the nematodes spread along over the European continent, and later on into other potato growing regions all over the world. Most current estimates suggest that the annual potato production worldwide is diminished by at least 10% due to infestations with potato cyst nematodes (Oerke et al. 1994).

Potato cyst nematodes have a narrow host range parasitizing exclusively on members of the Solanaceae family, including potato, eggplant and tomato (Sullivan et al. 2007). Potato cyst nematodes are sedentary endoparasites, whose survival and reproduction fully depends on a sophisticated feeding site induced by the nematodes inside a plant root (Gheysen and Mitchum 2009; Sobczak and Golinowski 2009). At the end of their life cycle, the fertilized adult females die and their dead hardened bodies form a protective cyst containing the eggs with the next generation of juveniles (Williamson and Hussey 1996). The cyst allows dormant PCN to survive for many years in the soil in temperate climate regions. Moreover, the juveniles of PCN will only hatch from the eggs when a suitable host plant is present. This long survival in the absence of host plants makes crop rotation not a very cost-effective method to control this pathogen. On the other hand, control of PCN by soil disinfection with unspecific pesticides presents its own disadvantages because of the environmental impact of the chemicals used. To prevent this damage the EU has recently introduced legislation to remove from use almost all active compounds effective against plant-parasitic nematodes (Rosso et al. 2009). Therefore, breeding nematode-resistant cultivars is gaining currently weight as a durable and environmentally friendly alternative for the other methods to control PCN.

So far, 14 PCN resistance gene loci have been mapped on eight linkage groups in potato. These resistances originate from wild potato species like S. tuberosum ssp. andigena, S. vernei, S. spegazzinni, S. tuberosum ssp. tuberosum, S. tarijense and S. sparsipilum (reviewed by Tomczak et al. 2009). They confer partial (Gro1.2, Gro1.3, Gro1.4 (Kreike et al. 1996); GpaIV (Moloney et al. 2010); Gpa (Kreike et al. 1994); Gpa5, Gpa6 (Rouppe van der Voort et al. 2000 ); Grp1 (Rouppe van der Voort et al. 1998); GpaV , GpaXI (Caromel et al. 2005); GpaM1, GpaM2, GpaM3 (Caromel et al. 2003a, 2003b); GpaXI (Tan et al. 2009)) or nearly absolute (H1 (Bakker et al. 2004; Kreike et al. 1993; Pineda et al. 1993); GroVI (Jacobs et al. 1996); Gro1 (Ballvora et al. 1995; Barone et al. 1990; Paal et al. 2004) and Gpa2 (Rouppe van der Voort et al. 1997; Van der Vossen et al. 2000)) resistance to one or more PCN pathotypes. The loci associated with nematode resistance often map to the regions known for carrying resistances to other plant pathogens, so called hot spots for resistance (Gebhardt and Valkonen 2001). To date, two PCN resistance genes have been characterized at the molecular level, viz. Gpa2 from S. tuberosum ssp. andigena (Van der Vossen et al. 2000) and Gro1 from S. spegazzinni (Paal et al. 2004). They both encode NB-LRR proteins, representing the largest class of resistance genes in plants.

The H1 resistance gene was discovered in 1952 in S. tuberosum ssp. andigena, a genotype present in the Commonwealth Potato Collection. Since then, it has been introgressed into many commercially available cultivars. The H1 gene is known for its durability (Evans 1993) and even today after many decades of use, the gene is still effective against G. rostochiensis in many areas. H1 is also the only nematode resistance gene, for which a gene-for-gene interaction was genetically proven (Janssen et al. 1991). It confers resistance to PCN by triggering a hypersensitive response in a layer of cells surrounding the young feeding site, which leads to the degeneration of the syncytium in less than 1 week after its induction (Rice et al. 1985). The food supply thus becomes a strongly limiting factor for the nematodes and hence, the majority of them develop into males while following epigenetic sex-related developmental cues (Trudgill 1991). The H1 locus has been mapped to the distal end of the long arm of chromosome V together with the two closely linked RFLP markers CP113 and CD78 (Gebhardt et al. 1993; Pineda et al. 1993). In 2004, Bakker et al. constructed a high-resolution genetic map of the H1 locus in the diploid potato clone SH83-92-488 (SH) with a bulked-segregant analysis and the use of the ultra-dense genetic map of potato (Van Os et al. 2006; https://cbsgdbase.wur.nl/UHD/). In this high-resolution map, the AFLP markers EM1 and CM1 were in coupling phase and tightly linked to the H1 resistance gene (0.25 and 0 cM, respectively; Bakker et al. 2004).

Because of their tight linkage with H1 resistance, we used the markers CM1 and EM1 to screen a BAC library of SH to construct a physical map spanning the H1 locus. In addition, a physical map was also constructed for the matching regions of the two haplotypes of the susceptible diploid potato genotype RH89-039-16 (RH). Analysis of the three homologous genomic sequences revealed the presence of a large cluster of CC-NB-LRR genes on all three haplotypes. However, the sequences further revealed a substantial variation in the genomic organization at the H1 locus among the three closely related haplotypes. We found only two co-linear regions, one of which is located outside the R gene cluster. Our data demonstrate that the H1 resistance gene is located in a region that is highly divergent between haplotypes, occupied by large R gene clusters, rich in repeats and showing repressed recombination rates. All these findings implicate that a map-based cloning strategy may be not sufficient for cloning the functional H1. Hence, the extensive comparative sequence analysis presented in this paper may facilitate the identification of this durable nematode resistance gene.

Materials and methods

Plant material and DNA extraction

A diploid mapping population of a cross between the two potato clones SH83-92-488 (further referred to as SH) and RH89-039-16 (further referred to as RH) has been previously developed for dissecting nematode resistances (Rouppe van der Voort et al. 1997). The female parent SH contains in a background of S. tuberosum an introgression segment originating from the wild accession S. tuberosum ssp. andigena CPC1673, which carries resistance to pathotype Ro1 and Ro4 of Globodera rostochiensis. The male parent RH has been selected for its fertility and the production of vigorous offspring and lacks resistance to any known PCN pathotype. It descends from the cross between SUH2293 and BC1034 and contains S. tuberosum ssp. tuberosum and S. phureja in genetic background. Plant genomic DNA was extracted from frozen leaf tissue of in vitro plants using the DNeasy Plant Mini Kit (QIAGEN Benelux B.V., Venlo, The Netherlands).

BAC library screening

The BAC library from the diploid clone SH83-92-488 consists of 97,920 clones and represents between 9 and 10 haploid genome equivalents. This BAC library is an extension of the BAC library containing 60,000 clones described by (Rouppe van der Voort et al. 1999). Pooling and preparation of the BAC clones into 255 pools for screening was done as previously described in Kanyuka et al. (1999) and Bakker et al. (2003). Plate pools were screened using primer pairs based on genetic markers and R gene sequences (Table 1). The BAC coordinates of positive clones were identified by columns/rows PCR on bacterial cultures. The single BAC DNA was extracted from 500 ml culture on LB medium supplemented with 12.5 μg/ml of chloramphenicol for selection. Plasmid DNA was isolated using “Very Low-Copy Plasmid/Cosmid Purification” protocol included in the Plasmid Midi Kit (Qiagen, Hilden, Germany).

Table 1

Overview of markers and primer combinations used for screening of the BAC library and mapping of the BACs

Marker/primers pair	Type	F, R	Primer sequence	Anneal. temp. (°C)	Restriction enzymes	Selective nucleotides	Band size (bp)	References
H1LRR		F	CCTTATGTTAAACACCTCCTC	55			888
		R	CGCAATATCTCCAAAACTGTC	55
H1NBS		F	TTTCAAAGTTGGAAGAAGTTGG	55			689
		R	GATCTTTTCTACGGTATCAGG	55
CMI	AFLP				SacI/MseI	aga/cac	233	Bakker et al. (2004)
EMI	AFLP				EcoRI/MseI	atg/gca	152	Bakker et al. (2004)
C43M51 318bp	AFLP				SacI/MseI	ata/cca	322	Van Os et al. (2006)
P22M39 152bp	AFLP				PstI/MseI	gt/aga	154.8	Van Os et al. (2006)
C39M50_53bp	AFLP				SacI/MseI	aga/cat	54.2	Van Os et al. (2006)
57R	SCAR	F	TGCCTGCCTCTCCGATTTCT	63			450
		R	GGTTCAGCAAAAGCAAGGACGTG	63
110L	SCAR	F	GGCCCTCCCCGATGATAATTAGTTTC	65			560
		R	GGCTGTTATGGGTTATTTGGTGGGC	65
202Sp6	SNP (LNA)	F	GGCAATGCTATGATGGAECTAG	64			216
		R	TACGTTTAAAAGEACCTZCCAC	64
micro_ttg_20	SSR	F	TGACTCCCGCTTTGGTTATC	60			231
		R	AAGTGGGGTTTGGAGGGTAG	60
micro_taa_129	SSR	F	TAGAATACGTGGGGGACTCG	59			277
		R	AATCCTTTGCCAAATCATGG	59

The RH BAC library consists of 78,336 clones (5× coverage of the diploid genome) and originates from the diploid potato clone RH89-039-16 (Borm 2008). To screen the RH library, a primer pair (H1probe3F: aca ttg gat gag cta aca ag; H1probe3R: atg act cca ccg att aga tc) was designed on the nucleotide binding domains of the R gene homologues in the region with 93–98% nucleotide identity. A 272-bp DNA probe was synthesized by PCR using an incubation at 94°C for 2 min, followed by 30 cycles of 94°C for 30 s, 58°C for 30 s and 72°C for 90 s, while finishing with an elongation step at 72°C for 5 min. Hybridization was performed on filters onto which the RH BAC library was spotted in duplo. Preparation of the filters and hybridization were performed by Greenomics, Wageningen, The Netherlands.

Physical mapping

To build scaffolds and contigs of positively selected SH BACs, the BAC inserts were fingerprinted using AFLP with EcoRI/MseI restriction enzymes and adapters without selective nucleotides as described by (Vos et al. 1995). Similarly, the RH BACs were fingerprinted with a capillary sequencer as described by (Borm 2008). Band files were processed by the software package Finger Printed Contigs (FPC, Soderlund et al. 1997) to construct the minimal tiling paths.

Genetic mapping

AFLP analysis was performed using primer combinations from the UHD map of potato (http://www.plantbreeding.wur.nl/potatomap/) and the protocol described previously (Vos et al. 1995). The DNA sequences of the PCR primers, the corresponding thermal cycling conditions and details about the AFLP markers are listed in Table 1. Simple sequence repeat (SSR) primer pairs (Table 1) were used on BAC DNA and genomic potato DNA using the following thermal cycling conditions: 94°C for 5 s followed by 25 cycles of 94°C for 30 s, 56°C for 30 s and 72°C for 30 s, followed by 7 min incubation at 72°C. Visualisation of SSR markers was carried out using a Li-cor sequencer (Li-cor, Lincoln, NB, USA) according to the manufacturer’s description. To map the SSR markers, a mapping population of 136 F1 genotypes from the cross between the diploid potato clones RH × SH was available (Rouppe van der Voort et al. 1997). The 45 most informative genotypes from a mapping population were selected using the software package MapPop (http://www.bio.unc.edu/faculty/vision/lab/mappop/) based on the maximum number of recombination events distributed over the genome. The UHD map of potato (Van Os et al. 2006) was used as input for MapPop. Segregating bands were mapped with the software package BINmap+ (Borm 2008). Mapping of SH BACs was performed using SCAR, SNP and AFLP markers (Table 1) on the set of 30 genotypes used previously for the construction of an high-resolution map (Bakker et al. 2004), and on 34 new recombinants based on recombination events between two PCR markers flanking the H1 locus.

BAC sequencing and sequence analysis

Whole BAC clones were sequenced by shotgun sequencing with 6×, 10× or a full coverage (Greenomics, Wageningen, The Netherlands and GATC Biotech AG, Konstanz, Germany). Dotter (Sonnhammer and Durbin 1995) and MUMmer (Kurtz et al. 2004) were used for comparing genomic sequences, which were then aligned using the program ClustalW (integrated in VectorNTI suite, InforMax, Bethesda, US) and the sequence assembly program SeqMan (part of the package DNAstar v6, DNASTAR, Madison, US). The sequences of SH BACs which could be ordered and oriented in H1 contig were deposited in NCBI/GenBank as a gapped contig under accession number HQ223091. The sequence fragments of BAC SH202H07 were deposited in NCBI/GenBank under accession number HQ223092.

Genes were annotated by combining predicted open reading frames from the gene finder program (FGENESH (Salamov and Solovyev 2000), using tomato as a model) with alignments of homologous sequences in public databases using Blastn and Blastp algorithms (Altschul et al. 1990). Annotation was also supported by finding a similarity with domains from curated domain databases at Interpro (Zdobnov and Apweiler 2001). The above-mentioned three types of data were used for manual curation resulting in the identification of genes at each haplotype.

Long terminal repeats (LTR) retrotransposons were identified using the LTR-finder tool (Xu and Wang 2007). Transposable elements were identified using CENSOR (Kohany et al. 2006) and transposon-related genes were identified with BLASTX search on NCBI (Altschul et al. 1990). Tandem repeats were predicted using Tandem Repeats Finder (Benson 1999). Simple repeats were identified with help of a DNA microsatellite repeat search utility called SPUTNIK (http://www.cbib.u-bordeaux2.fr/pise/sputnik.html).

Results

Physical map construction of the H1 locus for the resistant haplotype SH0

According to the previously constructed high-resolution map of the H1 locus (Bakker et al. 2004), the AFLP markers CM1 and EM1 are in coupling phase with the H1 resistance gene in the diploid potato genotype SH83-92-488. Marker CM1 could not be separated from resistance, while EM1 is separated by 0.25 cM. These findings were confirmed by screening an additional 1,116 progeny of the same SH × RH F1 mapping population (data not shown). Testing the additional progeny for CAPS marker 239E4left added 17 recombinants, which diminished its genetic distance from resistance to 2.1 cM. To identify the genome segment corresponding to markers CM1 and EM1, the SH BAC library comprising 97,920 clones with an estimated five times coverage of the diploid genome (Rouppe van der Voort et al. 1999) was screened for the presence of these markers. This resulted in the identification of eight BAC clones, five of them selected with marker CM1 (i.e., SH196L20, SH057A05, SH110I21, SH245E19, and SH185K02) and three with marker EM1 (SH192L10, SH210E14, SH224A08), which were used for constructing a physical map of the resistant haplotype, which will be referred to as SH0.

For each of the eight selected BAC clones, an AFLP fingerprint was made with the restriction enzymes EcoRI and MseI (Vos et al. 1995). Based on common bands in the fingerprints, a minimal tiling path was obtained consisting of four BACs (SH192L10; SH210E14; SH110I21, and SH057A05), which were all sequenced by shotgun sequencing. Analysis of the sequences confirmed the presence of the AFLP markers CM1 and EM1 and the presence of eight NB-LRR resistance gene homologues. Two other BACs reacting to either the CM1 or EM1 probes (SH245E19 and SH185K02) were fully overlapping with the minimal tiling path and as such, they were excluded from further study. The two remaining BACs (SH196L20 and SH224A08) that did not fit in the minimal tiling path were also sequenced. Surprisingly, their sequences contain neither the markers EM1 nor CM1 and do not overlap with any other BACs in the contig. They do, however, harbour three NB-LRR sequences that are highly homologous (88–90% similarity) to those on the four BACs that form one contig.

To extend the physical map of SH in this region, specific primer pairs were then developed on the sequence of: (1) conserved stretches of the LRR domains from the 11 resistance gene homologues present on the BACs, (2) the BAC ends delineating the minimal tiling path and (3) the BAC ends of the two BACs that could not be placed in the minimal tiling path. Screening the SH BAC library resulted in the identification of a novel BAC clone (SH202H07) that was positive for primers designed on one end of the minimal tiling path (SH057A05), for the LRR, and for a BAC end of BAC SH224A08. After sequencing this BAC, the overlapping regions could be confirmed and the physical map was extended with BAC SH224A08 and BAC SH202H07, resulting in an estimated total length of 341 kb.

In order to resolve the genetic position and haplotype of BACs SH057A05 and SH202H07, we designed a SCAR-marker for the end of BAC SH057A05 (57R) and an SNP marker for the end of BAC SH202H07 (202Sp6) and tested their behaviour in an SH × RH mapping population. Both markers were mapped to the H1 locus and always co-segregated with nematode resistance. Using the sequences of the AFLP markers EM1 and CM1, which are closely linked to H1 resistance, we further orientated the physical map and delimited the H1 region for the resistant haplotype SH0 as presented in Fig. 1.

Fig. 1

An integrated physical and genetic map of the H1 locus on chromosome V of the resistant haplotype of the diploid potato clone SH83-92-488 (SH0), and two susceptible haplotypes of the diploid potato clone RH89-039-16 (RH0 and RH1). Light grey areas are corresponding to the co-linear regions between haplotypes. The dotted line shows orientation of the map on the chromosome and the number placed below and above this line refers to its relative position in the ultra-high-density map of SH/RH (Van Os et al. 2006). The grey bars represents a non-sequenced BAC clones. Physical distance is indicated in kilobase

Physical map construction of the H1 locus for the two susceptible haplotypes of RH

To develop a similar physical map of the H1 locus in the susceptible diploid potato clone RH89-039-16, a probe was designed based on the NBS region of the resistance gene homologues (RGHs) identified on the SH0 genome sequence. A BAC library of RH consisting of 78,336 clones and an estimated five times coverage of the diploid genome was spotted in duplo on hybridization filters. Hybridizing the probe under high-stringency conditions on the filters resulted in 157 positive BACs. Like for the SH BACs, the 157 RH BACs were fingerprinted using an AFLP reaction with the restriction enzymes EcoRI and MseI, without selective nucleotides. Overlap between BACs was determined with FPC, resulting in 26 contigs. For each contig, one representative BAC was selected for sequencing. Sequence analysis revealed that 11 BACs harbour NB-LRR genes with high similarity to those present on the H1 locus in SH0 (i.e. RH001G02, RH009O14, RH181H24, RH045N13, RH051N09, RH085B11, RH186C17, RH154J09, RH125E08, RH053N17, and RH140O20; 69–100% aa identity). Two of them (RH181H24 and RH009O14) showed a minimal overlap with each other. Querying the HTGS nucleotide database of GenBank with the sequences of the 11 identified RH BACs using blastn algorithm (megablast) resulted in selecting 6 additional BACs (i.e. RH105N06, RH028L14, RH086K18, RH184L04, RH144F10 and RH056K04) which harbour H1 homologues and/or showed an overlap with any of the 11 initially sequenced BACs from the RH library .

By using software for rapid aligment of genomes (MUMmer, Kurtz et al. 2004), followed by a BLAST search against the BAC-end-sequences database (BAC-end-tool, Borm 2008) and blastn (Altschul et al. 1990), it was possible to build two contigs of two (RH085B11 and RH184L04) and nine BACs (RH001G02, RH009O14, RH181H24, RH045N13, RH105N06, RH028L14, RH086K18, RH144F10 and RH056K04), respectively. Application of the BAC-end-tool a second time resulted in the extension of the smallest contig with two additional BACs, i.e. RH051N09 and RH193K20. For RH051N09 the BAC sequence was available, whereas for RH193K20 only BAC-end sequences were available. Only 12 out of in total 17 identified and sequenced RH BACs could be physically mapped in H1 region of RH, while remaining 5 anchored further from this region or on other chromosomes of potato (data not shown). Hence, the estimated physical lengths of the two contigs are approximately 700 and 319 kb.

Based on the presence of the three AFLP markers C34M51_(318bp), P22M39_(152bp) and C39M50_(53bp), which were previously mapped in the H1 locus of RH in the ultra-dense genetic map of potato (Van Os et al. 2006), we could place the two contigs on two different haplotypes (from now on referred as RH0 and RH1; Fig. 1). Additionally, two BACs (RH051N09 and RH181H24) belonging to contigs mapped on two different haplotypes could be mapped in the same region (RH UHD map bin65–67 and bin60–62, respectively) by using SSR markers (Table 1). This further supported the anchoring of both contigs to the H1 region on chromosome V of potato. Furthermore, identification of BAC RH056K04 sequence stretches of 96 and 99.1% identity with, respectively, the left and right end of the SH239E4 BAC, from which CAPS marker 239E4left was derived (Bakker et al. 2004), provides additional support for anchoring the RH0 contig to the H1 genetic map.

Co-linearity between the three haplotypes SH0, RH0 and RH1 at the H1 locus

To study the co-linearity between the three physical maps, we have made a pairwise sequence comparison of all possible combinations of contiguous BAC sequences of SH0, RH0, and RH1 in a dot plot followed by a direct alignment of sequences. This allowed us to delineate a 92 kb region in SH0 and RH0 showing 100% identity (Fig. 2). The beginning of the co-linear stretch seems to be inverted, but we cannot completely exclude single BAC sequence assembly errors. In RH0 and RH1 a stretch of 102 kb was found with 95% overall sequence identity (Fig. 2). The sequences of RH1 and SH0, however, are completely non-linear and seem to share only a number of tandem repeats.

Fig. 2

Dot-plot (MUMmer) graphs comparing pairs of haplotypes: SH0 versus RH0, RH1 versus RH0 and RH1 versus SH0. Grey or red lines show forward matches and black or blue lines show the reverse matches between two sequences. The units for the labeled axes are bases

All the RH BACs and SH202H07 were sequenced with 6× coverage, resulting in 3–16 BAC sequence fragments. These fragments were assembled into scaffolds based on sequence identity/overlap between single BACs and co-linearity between the three haplotypes. Five BAC sequence scaffolds of SH0, 16 of RH0 and 12 of RH1 could be ordered and oriented (Fig. 3). For the remaining 31 scaffolds, this was not possible due to lack of sequence similarity between the 3 haplotypes, and insufficient overlap with other BACs from the same haplotype.

Fig. 3

Schematic overview of the genomic organization of the H1 locus in SH and RH. Position and orientation of the ORFs were determined based on the genomic sequence of the resistant haplotype SH0 and the two susceptible haplotypes RH0 and RH1 derived from the diploid potato clones SH and RH, respectively. Empty bars represent sequence contigs with known orientation and order, and grey bars represent contigs for which orientation and order could not be determined. Light grey areas are corresponding to the co-linear regions between haplotypes. The putative start of the introgression fragment from S. tuberosum spp. andigena is indicated by a black arrow. Positions of all predicted ORFs are indicated by numbers that correspond to the numbers in Table S2. All ORFs annotated as RGHs, transposons, amino acid transporters and extensin-like genes are shown as rectangles with arrowheads indicating the direction of transcription. Dotted line connects RGHs that are highly similar between SH0 and RH0

The co-linear region between RH0 and SH0 harbours 3 RGHs that are 100% identical. Between RH0 and RH1, a 102-kb stretch of 95% identity does not harbour any RGHs. The remaining part of the SH0, RH0 and RH1 sequences do not share any identical RGHs. Pairwise identity between full-length RGHs from all three haplotypes varies from 69 to 100% at the protein level (data not shown). Lack of synteny conservation observed between the major parts of SH0 and RH0 maps could be explained by the presence of the segment derived from S. tuberosum ssp. andigena that harbours the H1 gene and has been introgressed into the S. tuberosum ssp. tuberosum background of SH. In that case we would expect that the region from marker 202Sp6 to the centromere is derived from S. tuberosum ssp. tuberosum. The two RGHs from the centromeric side of 202Sp6 are identical to RGHs from RH0 and are therefore no candidates for the functional nematode resistance gene H1. However, it is possible that a region between marker 202Sp6 and BAC SH239E4, which ends show very high identity with RH0 BACs, contains more divergent RGH sequences co-segregating with resistance. This should be investigated in the future. From the side of the telomere, the region harbouring functional candidates for the H1 gene is delimited by the EM1 marker, which is not linked to resistance in a total of five per 2,189 offsprings (0.22 cM). This narrows down the genomic fragment carrying H1 candidate resistance genes to 160 kb, between the markers 202Sp6 and EM1.

Genomic organization of the H1 locus in SH and RH: transposable elements and other repeats

While combining the gene predictions and sequence similarity data, we found 60, 105, and 58 open reading frames in three sequenced haplotypes SH0, RH0 and RH1 of the H1 locus, respectively (Fig. 3; Table S2). This is an average of one gene per 5.2–6.6 kb. Twelve, 15 and 9 open reading frames in the SH0, RH0 and RH1 haplotypes code for proteins typically associated with transposable elements. In total, transposable elements occupy 17, 14 and 12% of the total sequence at SH0, RH0 and RH1, respectively.

The largest transposons found at all three haplotypes belong to the class of LTR-retrotransposons. SH0 includes eight predicted LTR-retrotransposons ranging in size from 2.6 to 11 kb. Six of them are in between resistance gene homologs, while two of them contain RGH coding sequences. Sixteen LTR-retrotransposons were predicted (1.7–15 kb in size) in RH0. They are mostly interspersed between RGHs, but one LTR-retrotransposon carries an RGH-like sequence and three are located outside the R gene cluster. In RH1, four LTR-retrotransposons (4.8–13.8 kb in size) are present within a 39-kb fragment and one of them also carries an RGH-like sequence. The retrotransposons in SH0 and RH0 belong to the class I transposable element superfamilies Copia (4 and 6) and Gypsy (4 and 10) (Wicker et al. 2007). The RH1 haplotype, however, mostly harbours transposable elements from the Gypsy superfamily, clustered within a 40-kb region. Outside the RGH region in RH0, we found two additional clusters of transposable elements both consisting of at least three predicted retrotransposons. These latter retrotransposons stem from the Copia, Gypsy and LINE superfamilies (class I transposable elements), but are situated next to a class II transposable element named Mutator.

As the RH0 haplotype consists of a 400 kb large R gene cluster, flanked by regions that contain no RGHs, we could compare these two regions in terms of repetitive sequence composition. The region outside the R gene cluster has a lower percentage of repetitive sequences than the cluster itself (11 compared to 14%). The number and total length of the LTR-retrotransposons is lower outside the RGH cluster than inside, wherein LTR-retrotransposons account for more that 40% of the repeats. Furthermore, the resistance cluster in SH0 consists of 17% repeat sequences with an average length of 204 bp, while the RH0 and RH1 haplotypes have lower repeats content with smaller average sizes (14% and 189 bp and 12% with 163 bp, respectively). We have compared the transposable element content of the H1 cluster and two other resistance gene clusters, viz. Gpa2/Rx1 (AF265664) from potato and Bs2 (AY702979) from pepper. At the H1 locus (SH0) transposable elements occupy 3–4% more of the sequence than at the Rx1/Gpa2 locus, but 8% less than at the Bs2 locus. On average the LTR-retrotransposons are more abundant in the Rx1/Gpa2 and Bs2 clusters (60% of total TE length compared to 50% for H1). Furthermore, in the H1 cluster the number of predicted LTRs larger than 1 kb belonging to the Copia-like family equals the number of Gypsy-like elements (1:1 ratio), while in both Rx1/Gpa2 and Bs2 we found a more typical ratio for potato of 2:1 Gypsy to Copia LTR-retrotransposons.

In addition to the large LTR-retrotransposons, which account for more than 40% of the total sequence encoding TEs, a substantial amount of smaller TEs and other repetitive sequences were discovered at the H1 locus (Table S1). Sequence fragments with similarity to TEs from other orders of class I elements (LINE and SINE) and to the TEs from class II such as Mutator, Helitron, hAT, EnSpm and few others were identified in all three haplotypes based on the sequence identity. Ten simple repeats were found in SH0, while RH0 and RH1 harbour 45 and 29 simple repeats, respectively. More than 5% of the sequence of each haplotype was predicted to comprise tandem repeats. SH0 contains 147 tandem repeats with a unit length varying from 7 to 335 bp and a copy number ranging from 1.9 to 20.4. RH0 contains 277 tandem repeats with a unit length from 7 to 335 bp and a copy number ranging from 1.8 to 23.9, while RH1 contains 116 tandem repeats of 9 to 232 bp long that are repeated 1.8 to 119.5 times.

Comparing the open reading frames in the haplotype sequences with expressed sequence tag data from the SGN database (Mueller et al. 2005) suggests that 40–51% of them code either for truncated proteins and short protein fragments. In the physical map of RH0, which covers the largest distance, two large regions (192 kb to the north and 102 kb to the south) without predicted RGHs flank the region harbouring 17 RGH-like sequences, which delimits the complete RGH cluster to approximately 400 kb. Two regions situated outside the predicted R gene clusters in RH0 and RH1 (Fig. 3, ORFs: RH0 1-28; 92–105 and RH1 42-58) harbour genes with homology to known functional genes, including DNA repair proteins, several transferases, sugar transporters, integrases, aspartic proteinases precursor, lipases, putative C2H2-type zinc finger proteins, glutamate decarboxylases, UDP-glucose pyrophosphorylases and ubiquitin protein ligases. The most significant Genbank hits and corresponding e-values are listed in Table S2.

Genomic organization of the H1 locus in SH and RH: resistance gene homologs

The resistance gene homologues in all three haplotypes are located in single clusters, interspersed with several other genes, mostly occurring as single copies and coding for putative proteins without predicted homology. Two gene classes, however, occur as multiple copies and code for proteins with known function, namely, amino acid transporters and extensin-like proteins (Table S2; Fig. 3). Thirteen, nine and six copies of genes with high similarity to a transmembrane amino acid transporter from Populus trichocarpa (50% identity, XP_002316138) are present in SH0, RH0 and RH1, respectively. A transcript encoding a similar transmembrane amino acid transporter was not found in the potato expressed sequence tag database (at SGN), indicating that the gene is not abundantly expressed in potato. In comparison to the poplar genes most of the amino acid transporter-like genes we found in the H1 cluster are truncated or contain indels, suggesting that they are non-functional. The genes with homology to an extensin-like gene show the highest similarity with an extensin-like protein from Solanum tuberosum (CAA06000) and five, four and one copies are present at SH0, RH0 and RH1, respectively. An expressed sequence tag with 98% identity to the extensin-like protein was found in the potato ESTs collection (SGN-E558357).

A total of 55 RGHs were predicted in the haplotypes SH0, RH0, and RH1. They showed the highest amino acid identity (52%) to Rpi-blb2, a gene that confers resistance to Phythophthora infestans in S. bulbocastanum and that belongs to the CC-NB-LRR class of plant resistance genes (Van der Vossen et al. 2005). In SH0 17 RGHs were identified, of which only 5 were predicted to encode complete CC-NB-LRR type of resistance proteins. Two other open reading frames indicated as truncated (Fig. 3, SH0, ORFs 1 and 60) are located at the ends of BAC inserts. For these ORFs a part of the coding sequence information is missing and we are unable to predict whether these genes are full length. The rest of the open reading frames are most likely pseudogenes due to large deletions in the N-terminal, CC domains and LRR domains, or due to the occurrence of premature stop codons. In RH0 we found 25 RGHs, while 17 RGHs seem to be present in the RH1 haplotypes. Eight genes in RH0 and five genes in RH1 likely encode complete resistance proteins, while eight RGHs contain either deletions or premature stop codons resulting in truncated R genes. For one RGH some sequence information is missing because of its position at a BAC end. Position and orientation of all the RGHs located in this genomic region in SH0 and RH were determined and presented in Fig. 3. A detailed overview of the annotation of the H1 locus is shown in Table S2.

Discussion

Here we describe the construction of physical maps of the H1 locus on chromosome V in the diploid S. tuberosum clone SH83-92-488 and the corresponding genomic region in the two haplotypes of the diploid susceptible potato clone RH89-039-16. The H1 locus was introgressed from the subspecies S. tuberosum ssp. andigena because it confers durable resistance to specific pathotypes of the potato cyst nematode Globodera rostochiensis. Although the H1 resistance gene has not been identified yet, comparing the resistant haplotype sequence with the two susceptible haplotypes at the H1 locus provides crucial insights that may help us to home in on the gene. The sequence information obtained in this study can also be used to develop specific markers and a candidate gene approach for the identification of the GroVI gene, which is another single dominant resistance gene against G. rostochiensis that has been mapped in a syntenic region on chromosome V at an introgression segment from Solanum vernei (Jacobs et al. 1996).

The sequences of the three haplotypes indeed revealed a number of remarkable features of this locus in S. tuberosum. First of all, each haplotype harbours a large cluster of resistance gene homologues from the CC-NB-LRR resistance gene class with significant sequence similarity to the late blight resistance gene Rpi-blb2 identified at chromosome VI of potato (Van der Vossen et al. 2005). Surprisingly, only three RGHs on the resistant haplotype (SH0) have identical genes on one of the susceptible haplotypes (RH0), while no matching sequences were found on the second susceptible haplotype (RH1). One could argue that positive selection in the RGHs at the H1 locus has been so extensive at this locus that accelerated evolution yielded highly diverse RGHs. However, also outside the coding regions no similarity was observed causing an overall lack of synteny between the different haplotypes in a major part of the R gene cluster. In fact, only 92 of 341 kb of the resistant haplotype is co-linear with the susceptible haplotype (with 100% identity in RH0), while another segment of only 102 out of 700 kb in RH0 is co-linear with RH1 (with 95% identity).

The physical maps were constructed by using the two AFLP markers CM1 and EM1. On the genetic map CM1 was at 0 cM distance from the H1 resistance, while EM1 was positioned at 0.25 cM distance. The region between these two markers in the physical maps spans more than 65 kb. A remarkable difference in the recombination rate was observed between two sub-regions of the physical map of the resistant haplotype SH0. In the centromeric part of the SH map 65 kb equals 0.25 cM genetic distance, whereas no recombination was observed in the northern region of the map resulting in a complete linkage of a more than 170 kb genomic fragment with the resistance trait. Such a considerable disparity between the genetic and physical distances pointing at a strong repression of recombination was found previously in the maps of the I3 resistance locus in tomato (Lim et al. 2008), the R1 locus in potato (Kuang et al. 2005) and the Mla locus in barley (Wei et al. 1999). For the Mi-1 locus, which was introgressed into L. esculentum from its wild relative L. peruvianum, an even more severe suppression of recombination could be observed resulting in the complete linkage of a 550 kb region to resistance. This repression of recombination is thought to be the consequence of the exogenous origin of the DNA segment, resulting in hemizygosity between haplotypes. A similar phenomenon was also observed for other R genes introgressed from wild species in various crosses (Ganal and Tanksley 1996). In case of Mi-1, the proximity to the centromere may also contribute to the repression of recombination in tomato (Kaloshian et al. 1998). Hence, the suppression of recombination that we observed north of the H1 locus in resistant plants is likely caused by the sequence divergence between the S. tuberosum ssp. andigena introgression segment and S. tuberosum ssp. tuberosum background. It is therefore hypothesized that the structural differences between the homologous chromosomes could interfere with chromosome pairing and crossing-over during meiosis (Ballvora et al. 2007).

After aligning the sequences of the three physical maps, complete loss of co-linearity was found in a region of 250 kb between the SH0 haplotype and the two RH haplotypes. A significant homology in this part of the map is observed only between two fragments carrying RGHs sequences, but the position of these fragments is not syntenic when both maps are aligned and their flanking sequence differ substantially. As this region is flanked by a region almost identical between the SH0 and RH0 haplotype, and harbours four RGH-like sequences, it would be interesting to see if sequence co-linearity continues further on the centromeric side of the H1 locus. The finding of two other co-linear BACs from SH and RH that have been preliminary mapped centromeric to the H1 cluster (data not shown) as well as the identification within the RH0 sequence both ends of the BAC SH239E4, from which marker 239E4left was generated and mapped at a distance of 2.1 cM from H1 resistance, suggest that this indeed may be the case. A lack of co-linearity was observed also for a major part between the two susceptible haplotypes, reflecting possible differences in the genetic background of RH89-039-16 in this region likely related to presence of genetic material derived from S. phureja (Ramanna 1983). Beyond this part, in the region on the telomeric side, it was not possible to further distinguish between the RH0 and RH1 haplotypes. Apparently, the two haplotypes are very homozygous in this region resulting in a single BAC contig when constructing the physical map. Such large differences in synteny between haplotypes are comparable to that observed for the R1 cluster in S. demissum (Kuang et al. 2005) and S. tuberosum (Ballvora et al. 2002). High sequence divergence was also found between the resistant and susceptible haplotype of SH83-92-488 at the Rx1/Gpa2 locus in potato, as these two haplotypes could only be aligned using SSR markers (Butterbach 2007). In heterozygous, outbreeding species like potato such a high divergence between haplotypes potentially generates a high diversity of immune receptors, which is advantageous in responding to quickly changing pathogen populations (Hughes and Yeager 1998). In general, the high level of natural intraspecific polymorphisms between haplotypes can often be correlated with complex R gene clusters and provides evidence for strong evolutionary forces shaping these parts of the plant genome.

Transposable elements (TEs) in general are thought to have a major impact on the differentiation of plant species at the level of genome structure (Bennetzen 2005). In various plant species, including potato, tomato, wheat, Poncirus, Arabidopsis, wheat, barley and soybean, R gene clusters like the H1 locus were found to co-localize with repetitive sequences and TEs (Ballvora et al. 2007; Gao and Bhattacharyya 2008; Kuang et al. 2005; Noel et al. 1999; Panstruga et al. 1998; Seah et al. 2007; Wei et al. 2002; Wicker et al. 2001; Yang et al. 2003). An extreme example is the Mla region in barley, where all major classes of TEs are represented forming two large nested complexes, flanking two RGHs sequences, likely contributing to repression of recombination in this region (Wei et al. 2002). Presence of similar copies of TEs in one R gene cluster enable unequal crossing-over causing expansion or contraction of the locus (Wicker et al. 2007), while on the other hand the TEs diversity in the same region may prevent unequal crossing-overs (Kuang et al. 2005; Song et al. 1997). As a result of similar TEs copies on different genome locations, sequence exchange can also occur between otherwise non-homologous regions (Meyers et al. 2003). Like shown for the Bs2 locus in pepper (Mazourek et al. 2009), we observed erosion and truncation of TE related sequences in the H1 region. This can be explained by multiple insertions followed by sequence drift. More detailed sequence analysis should be performed in the future in order to assess the variety of TEs in the H1 cluster and to explain their influence on the evolutionary history of this R gene locus.

Apart from TEs and RGHs, resistance gene clusters often harbour not many other functional genes. For example, in soybean at the Rps1-k locus only a few full-length genes were predicted within a distance of 118 kb, including two R genes and four retrotransposons (Gao and Bhattacharyya 2008). Some of the non-R genes present in R gene clusters have functions related to plant defence such as is reported for the Mla locus in barley (Wei et al. 2002), the Mi-1 locus in tomato (Seah et al. 2007) and the R1 and Rx1/Gpa2 loci in potato (Ballvora et al. 2007; Butterbach 2007). At the H1 locus, the RGH regions in all three haplotypes are interspersed by several copies of genes coding for extensin-like proteins. Although the expression of a potato extensin-like gene is induced by wounding and Erwinia carotovora infection of potato tubers (Rumeau et al. 1990), its possible role in plant defence remains to be shown (Dey et al. 1997). Recently, microarray studies have shown that extensins are also up-regulated during cyst nematode infections (Ithal et al. 2007; Khan et al. 2004; Puthoff et al. 2003). They may function in strengthening of the cell wall as an early plant defence response as well as in strengthening the syncytium wall in favour of nematodes (Khan et al. 2004). The presence of multiple copies of extensin-like genes at the H1 locus may point at a role for these genes in defence responses against potato cyst nematodes. Another plausible explanation for the occurrence of similar gene copies distributed throughout the three RGH clusters in SH and RH is that they derive from a common ancestor after tandem duplication together with the flanking RGH and subsequent genetic erosion.

At the H1 locus we found, besides full-length RGHs, ORFs coding for short fragments of resistance gene homologues. The occurrence of such duplicated partial R gene fragments inserted upstream or downstream of R genes has been reported previously (Mazourek et al. 2009). Although their postulated role in controlling R gene expression has not been proven yet, it opens a new field for speculations and functional studies. One possibility is that the translation of such small R gene paralogues could have a role in the regulation of R gene function through the forming of heteroduplexes (Huang et al. 2005), as it was shown that the intermolecular and intramolecular interactions between R protein domains might function as activation switches upon recognition of the cognate elicitors (Moffett et al. 2002). The need for additional protein components in the formation of functional R gene complexes could be an explanation for the phenomena that R genes loose their full effectiveness upon introduction in another genetic background (Jacquet et al. 2005). An alternative explanation for the presence of so many R gene fragments and truncated homologs at the H1 cluster is that they are the result of frequent rearrangements occurring at this locus and constitute a reservoir of variation and the generation of new resistance specificities (Michelmore and Meyers 1998).

In this paper, we describe the integration of the physical and genetic map of the H1 locus, which shows that four R gene homologues in SH0 with sequence similarity to the CC-NBS-LRR genes Mi-1 (Milligan et al. 1998; Vos et al. 1998) from tomato and Rpi-blb2 from potato (Van der Vossen et al. 2005) are linked to nematode resistance. Therefore, they are considered to be good candidate genes for the potato cyst nematode resistance gene H1. The low level of recombination together with the highly repetitive nature of R gene loci (Hulbert et al. 2001) is a major obstacle in the positional cloning of R genes (Huang et al. 2005). Moreover, the heterozygosity of the potato genome adds to the difficulties associated with this approach (Kanyuka et al. 1999). Hence, it is crucial to support the positional cloning of R genes with alternative strategies including the candidate gene approach and comparative genomics (Huang et al. 2005; this paper). Soon, the complete potato genome sequence will be available, which can boost the identification of genes underlying important resistance traits in the future.

Below is the link to the electronic supplementary material.

Supplementary material Figure S1 (PDF 122 kb)

Supplementary material Table S1 (PDF 74 kb)

Supplementary material Table S2 (PDF 100 kb)