| Literature DB >> 21031026 |
Mukesh Tanwar1, Manoj Kumar, Tanuj Dada, Ramanjit Sihota, Rima Dada.
Abstract
PURPOSE: To screen the myocilin (MYOC) and forkhead box protein C1 (FOXC1) genes for sequence variations in primary congenital glaucoma (PCG).Entities:
Mesh:
Substances:
Year: 2010 PMID: 21031026 PMCID: PMC2956699
Source DB: PubMed Journal: Mol Vis ISSN: 1090-0535 Impact factor: 2.367
Clinical phenotype and CYP1B1 mutation status of PCG cases.
| PCG01 | By birth | M | 12 years | 15x15/15x15.5 | OU | 40 | 30 | OU | Total cupping | OU | R390H (H) | Medical and OU 3XTrab/Trab+MMC |
| PCG02 | By birth | F | 10 years | 13x13/13x13 | OU | 36 | 40 | OU | 0.5:1/0.6:1 | OU | R390H (H) | Medical and OU 1XTrab/Trab+MMC |
| PCG03 | By birth | F | 7 months | 15x14/15x15 | OU; OD>OS | 26 | 38 | Absent | Hazy MEDIA | Absent | R390H (H) | Medical and OU 1XTrab/Trab+MMC; OS 1XTrab/Trab+MMC |
| PCG04 | By birth | M | 10 months | 12x11/12x12 | Absent | 22 | 24 | Absent | 0.4:1/0.4:1 | Absent | — | Medical and OU Trab/Trab+MMC |
| PCG05 | 4 months | M | 5 months | 14.5x15/15x15 | OU; OD>OS | 28 | 28 | OU | 0.7:1/0.7:1 | OU | R368H (H) | Medical and OU 2XTrab/Trab+MMC |
| PCG06 | By birth | M | 4 months | 12x13/12x13 | OU | 22 | 23 | OU | 0.5:1/0.5:1 | OU | — | Medical and OU Trab/Trab+MMC |
| PCG07 | By birth | F | 18 months | 12x13/11x11.5 | OS | 38 | 14 | Absent | 0.4:1/0.4:1 | Absent | — | Medical and OU Trab/Trab+MMC |
| PCG08 | 1 month | F | NA | OD | 23 | 25 | Absent | Hazy media | One eye | — | Medical and OD Trab/Trab+MMC | |
| PCG09 | 2 months | 13 months | 12x12/12x12 | Absent | 22 | 22 | Absent | NA | Absent | — | Medical and OU Trab/Trab+MMC | |
| PCG010 | 1 month | F | 1 month | NA | OD | 23 | 24 | Absent | NA | One eye | — | Medical and OD Trab/Trab+MMC |
| PCG011 | 1 year | M | 4 months | 14x14/14x15 | OU; OD>OS | 26 | 22 | Absent | NA | Absent | E229K (h) | Medical and OU 1XTrab/Trab+MMC |
| PCG012 | By birth | M | 58 months | 14x14.5/14x14.4 | OU | 32 | 32 | Absent | NA | Absent | R368H (h) | Medical and OU 1XTrab/Trab+MMC |
| PCG013 | By birth | F | 2 months | 14x14/14x14 | OU | 31 | 30 | Absent | Hazy media | Absent | R390H (H) | Medical and OU 2XTrab/Trab+MMC |
| PCG014 | By birth | F | 1 month | NA | OU | 25 | 24 | Absent | Hazy media | Absent | E229K (h) | Medical and OU 2XTrab/Trab+MMC |
| PCG015 | By birth | M | 3 months | 14.5x14/13.5x13 | OU; OS>ODR | 32 | 32 | Absent | 0.6:1/0.6:1 | Absent | M132R (H) | Medical and OU 2XTrab/Trab+MMC |
| PCG016 | By birth | M | 6 months | 11x11/12x12.5 | OD | 18 | 26 | Absent | 0.4:1/0.5:1 | Absent | — | Medical and OD Trab/Trab+MMC |
| PCG017 | By birth | M | 9 months | 14x14/14x14.5 | OU | 30 | 28 | Absent | NA | Absent | Ter@223 (H) | Medical and OU 2XTrab/Trab+MMC |
| PCG018 | By birth | M | 3.4 years | 14.5x14/14x14 | OU; OS>OD | 20 | 20 | Absent | NA | Absent | — | Medical and OU Trab/Trab+MMC |
| PCG019 | By birth | F | 7 months | 12x12.5/12x12 | OU | 22 | 22 | Absent | 0.5:1 1 | Absent | Ter@223 (h) | Medical and OU 2XTrab/Trab+MMC |
| PCG020 | By birth | M | 7 years | 12x13/13x13 | OU; OD>OS | 18 | 37 | Absent | Hazy media | Absent | — | Medical and OU1X Trab/Trab+MMC |
| PCG021 | By birth | M | 2 years | 15x16/11.5x12 | OS | 32 | 15 | OU | Hazy media | Absent | Ter@223 (h) | Medical and 2X Trab/Trab+MMC OS |
| PCG022 | By birth | F | 10 months | 15x15/16x16 | OU; OD>OS | 28 | 28 | OU | 0.7:1/0.5:1 | Absent | p.L24R (H) | Medical and OS 2XTrab/Trab+MMC |
| PCG023 | By birth | F | 4 months | 14x15/14x15 | OU | 34 | 36 | OU | Hazy media | OU | — | Medical and OU 1X Trab/Trab+MMC |
| PCG024 | By birth | M | 1 months | 14x13/14x13 | OU | 30 | 24 | Absent | 0.7:1/0.7:1 | OU | — | Medical and OU 1X Trab/Trab+MMC |
| PCG025 | By birth | F | 18 years | NA | Absent | 32 | 10 | Absent | NA | Absent | — | Medical and OS Trab/Trab+MMC |
| PCG026 | By birth | M | 2 years | 14x15/14x15 | OU | 22 | 22 | Absent | Hazy media | OU | — | Medical and OU Trab/Trab+MMC |
| PCG027 | By birth | F | 2 years | 13x13.5/15x14.5 | OU; | 22 | 22 | Absent | 0.8:1/0.8:1 | Absent | — | Medical and OU 1X Trab/Trab+MMC |
| PCG028 | By birth | M | 2.5 years | 13x13.5/13x13.5 | OU | 20 | 20 | Absent | hazy media | One eye | — | Medical and OU 1X Trab/Trab+MMC |
| PCG029 | By birth | F | 3 months | 15x15/14x14 | OU | 28 | 27 | OU | Hazy media | OU | Ter@223 (h) | Medical and 2X Trab/Trab+MMC |
| PCG030 | By birth | M | 1 month | 13x13.5/13.5x13 | OU | 26 | 26 | Absent | 0.7:1/0.7:1 | One eye | — | Medical and 1X OU Trab/Trab+MMC |
| PCG031 | By birth | M | 4 months | 11x14/14x15 | OU | 34 | 36 | Absent | Hazy media | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG032 | By birth | M | 10 months | 15x15/12x12 | OS | 18 | 14 | Absent | 0.3:1/0.3:1 | Absent | — | Medical and 1X OS Trab/Trab+MMC |
| PCG033 | By birth | M | 1 year | 13x13/11x11 | OS | 12 | 12 | Absent | 0.2:1/NO glow | One eye | — | Medical and 1X OS Trab/Trab+MMC |
| PCG034 | By birth | M | 2 months | 14x14/14x14 | OU | 22 | 24 | Absent | NA | Absent | R390H (h); Ter@223 (h | Medical and 1X OU Trab/Trab+MMC |
| PCG035 | By birth | M | 3 months | 13x13/13x12 | OS | 18 | 16 | Absent | no glow | Absent | — | Medical and 1X OS Trab/Trab+MMC |
| PCG036 | By birth | M | 1 month | 15x15/15x15.5 | OU | 25 | 26 | Absent | 0.8:1 1 | Absent | R390H (H); E229K (h) | Medical and 1X OD Trab/Trab+MMC |
| PCG037 | By birth | M | 1 month | 14x14/11x11 | OU;OS>OD | 18 | 22 | Absent | Hazy media | One eye | — | Medical and 1X OU Trab/Trab+MMC |
| PCG038 | By birth | M | 3.5 years | corneal: Dulcer/14x14 | OD | 18 | 20 | Absent | hazy media | OU | — | Medical and 1X OD Trab/Trab+MMC |
| PCG039 | By birth | M | 4.5 years | 13x13/12x13.5 | OU | 36 | 34 | Absent | NT cupping | OU | R368H (h); Ter@223 (h) | Medical and 1X OUTrab/Trab+MMC |
| PCG040 | By birth | F | 2 months | 11.5x12.5/12x13 | OU; OD>OS | 23 | 23 | Absent | Hazy media | OU | Ter@223 (h) | Medical and OD 1XTrab/Trab+MMC |
| PCG041 | By birth | M | 11 months | 12x10/12x12.5 | OU; OD>OS | 40 | 26 | Absent | Hazy media | OU | R390H (H): Ter@223 (h) | Medical and OU 1XTrab/Trab+MMC;
1XTrab+Trab+mmc OD, 1XPK |
| PCG042 | By birth | M | 5 days | 13x13/13x13 | OU | 22 | 24 | Absent | Hazy media | OU | R368H (H) F190L (H) | Medical and 1XTrab/Trab+MMC OU |
| PCG043 | By birth | F | I2 months | 12x12/12x12 | OU | 22 | 26 | OU | 0.8:1 1 | Absent | R390H (h) G329D (h) | Medical and 1X OU Trab/Trab+MMC |
| PCG044 | By birth | M | 4 years | 14x14/14x14 | OU | 26 | 24 | Absent | 0.8:1/0.9:1 | Absent | Ter@223(h) | Medical and 1X OU Trab/Trab+MMC |
| PCG045 | By birth | M | 1 month | 12x12/12x12.5 | OU | 20 | 22 | Absent | 0.5:1/0.5:1 | Absent | E229K (h), R390H (h) | Medical and 1X OU Trab/Trab+MMC |
| PCG046 | By birth | M | 6 months | 13x13/13x13.5 | OU | 24 | 16 | Absent | 0.5:1/0.3:1 | OU | — | Medical and1X OU Trab/Trab+MMC |
| PCG047 | By birth | F | 5 months | 14.5x14/14x14 | OU | 30 | 20 | Absent | 0.7:1/0.9:1 | One eye | — | Medical and 1X OU Trab/Trab+MMC |
| PCG048 | By birth | M | 11 months | 13x13.5/12x13 | OU | 28 | 26 | Absent | NA | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG049 | By birth | M | 6 months | 18x20/14x16 | OU | 24 | 22 | Absent | OS no glow/0.5:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG050 | By birth | F | 11x11.5/11x11.5 | OU | 26 | 30 | Absent | 0.3:1/0.3:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC | |
| PCG051 | By birth | F | 36 months | 11x11.5/13x13 | OU;OD>OS | 22 | 28 | Absent | 0.8:1/0.9:1 | OU | — | Medical and 1X OU Trab/Trab+MMC;
OU cataract surgery |
| PCG052 | By Birth | F | 2 months | 12.5x13/12.5x13 | OU | 20 | 20 | Absent | Hazy media/0.5:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG053 | By birth | F | 4 months | 11.5x12/12x12 | OU; OD>OS | 40 | 23 | Absent | Hazy media | OU | — | Medical and 1X OU Trab/Trab+MMC |
| PCG054 | By birth | M | 9 months | 15x14.5/15x14.5 | OU | 26 | 26 | Absent | Absent glow | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG055 | By birth | M | 8 months | Phthisic eye/12x12 | OD; OS Phthisic eye | na | 37 | Absent | NA/0.9:1 | OU | p.I94X (H) | Medical and 1X OD Trab/Trab+MMC |
| PCG056 | By birth | F | 12 months | 14.5x14.5/14x14 | OU; OS>OD | 30 | 28 | OU +ve | Hazy media | OU | p.Q340H (H) + p.R390H (H) | Medical and 1X OU Trab/Trab+MMC |
| PCG057 | By birth | M | 3 months | 13x13/13.5x13.5 | OU; OD>OS | 28 | 30 | Absent | 0.7:1/0.7:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG058 | By birth | M | 15 months | 14x14/12.5x12.5 | OU; OS>OD | 20 | 16 | Absent | total cupping/ 0.5:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG059 | By birth | F | 10 months | 14x14.5/13.5x14 | OU; OS>OD | 31 | 31 | OS | NA | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG060 | 7 months | F | 41 months | 14x14/13x13.5 | OU; OS>OD | 24 | 18 | Absent | 0.4:1/0.6:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG061 | By birth | M | 4 months | 15.5x15/14x14 | OU; OS>OD | 30 | 34 | OU | Not visible/0.9:1 | OU | p.H279D (h) | Medical and 1X OU Trab/Trab+MMC |
| PCG062 | By birth | M | 8 months | 11x11.5/10x11.5 | OU; OS>OD | 22 | 16 | Absent | 0.6:1/0.6:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG063 | 3 months | M | 12 months | 12x12/11x12.5 | OU; OS>OD | 22 | 23 | Absent | 0.4:1/0.4:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG064 | By birth | M | 1 month | 12x12/11.5x11.5 | OU; OS>OD | 28 | 24 | Absent | not visible/0.7:1 | Absent | p.R390C (h) | Medical and 1X OU Trab/Trab+MMC |
| PCG065 | By birth | M | 6 months | 13x13/12.5x13 | OU; OS>OD | 25 | 26 | Absent | 0.7:1/0.7:1 | OU | p.E229K (h) | Medical and 1X OU Trab/Trab+MMC |
| PCG066 | 3 months | M | 13 months | 12.5x12/12.5x12 | OU | 22 | 24 | Absent | 0.4:1/0.4:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG067 | 11 months | M | 132 months | 12x13/13x14 | OU; OD>OS | 21 | 24 | Absent | not visible | OU | — | Medical and 1X OU Trab/Trab+MMC |
| PCG068 | By birth | M | 6 months | 13x13/13.5x14 | OU; OD>OS | 26 | 28 | Absent | 0.8:1/0.8:1 | OU | p.R368H (H) | Medical and 1X OU Trab/Trab+MMC |
| PCG069 | By birth | M | 4 months | 13x13/12x13 | OU; OS>OD | 24 | 26 | Absent | 0.5:1/0.6:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG070 | By birth | M | 45 days | 15x15/15x14.5 | OU/; OS>OD | 30 | 40 | Not visible | not visible | OU | p.R355X (H) | Medical and 1X OU Trab/Trab+MMC |
| PCG071 | 13 months | M | 18 months | 12x12/12x12 | OU | 22 | 23 | Absent | 0.4:1/0.4:1 | Absent | — | Medical and 1X OU Trab/Trab+MMC |
| PCG072 | By birth | M | 45 days | 12x12/12x11.5 | OU; OS>OD | 20 | 24 | Absent | no glow | OU | — | Medical and 1X OU Trab/Trab+MMC |
| PCG073 | By birth | M | 2 months | 12.5x13/11x12 | OU; OS>OD | 22 | 22 | Absent | Hazy media | OU | — | Medical and 1X OU Trab/Trab+MMC |
| PCG074 | By birth | M | 8 months | 14x14.5/15x15 | OU;OS>OD | 28 | 24 | OU | No glow | OU | p.R368 (H) | Medical and 1X OU Trab/Trab+MMC |
| PCG075 | By birth | M | 1 year | 13x13.5/14x14 | 0U; OD>OS | 20 | 20 | Absent | No glow | OU | R390H (H) | Medical and 1X OU Trab/Trab+MMC |
Key: M- male; F- female; H- homozygous; h-heterozygous; X- times; Trab/Trab+MMC- combined trabeculotomy trabeculectomy and mitomycin C treatment; OD- right eye; OS- left eye; OU- both eyes; NA- not available.
FOXC1 primers used in this study.
| 1 | 1F- CCCGGACTCGGACTCGGC | 649 bp |
| 1R- TCTCCTCCTTGTCCTTCACC | ||
| 2 | 2F- GAGAACGGCAGCTTCCTG | 708 bp |
| 2R-TTGCAGGTTGCAGTGGTAGGT | ||
| 3 | 3F-GGCCAGAGCTCCCTCTACA | 636 bp |
| 3R-CTGCTTTGGGGTTCGATTTA |
Figure 1DNA sequence chromatogram of MYOC equivalent to bases −121 to −132. A: The reference sequence derived from control is shown. B: Sequence derived from congenital glaucoma patient PCG043 shows heterozygous −126T>C nucleotide change.
Figure 2DNA sequence chromatogram of MYOC equivalent to bases −76 to −88. A: The reference sequence derived from control is shown. B: Sequence derived from congenital glaucoma patient PCG015 shows homozygous −83G>A nucleotide change.
Figure 3DNA sequence chromatogram of MYOC exon 1 equivalent to codon 75–78. A: The reference sequence derived from control is shown. B: Sequence derived from congenital glaucoma patient PCG005 shows homozygous c.127G>A, which predicts a codon change AGA>AAA and p.R76K change.
Figure 4DNA sequence chromatogram of MYOC equivalent to IVS2+31 to IVS2+42 A: The reference sequence derived from control is shown. B: Sequence derived from congenital glaucoma patient PCG004 shows homozygous IVS2+35G>A nucleotide change.
Figure 5DNA sequence chromatogram of MYOC exon 3 equivalent to codon 346–348. A: The reference sequence derived from control is shown. B: Sequence derived from congenital glaucoma patient PCG029 shows heterozygous c.1041T>C, which predicts a codon change TAT>TAC and p.Y347Y change.
MYOC gene variations identified in this study with p-value at 95% confidence interval by using Pearson χ2/Fisher’s exact test.
| 1 | Promoter | −126T>C | - | - | 2 | 0 | 0.496 | - |
| 2 | Promoter | −83G>A | - | - | 9 | 2 | 0.055 | 4.97 (1.03–23.87) |
| 3 | Exon 1 | c.227 G>A | AGA>AAA | p.R76K | 30 | 12 | 0.001 | 3.50 (1.61–7.56) |
| 4 | Intron 2 | IVS2+35 G>A | - | - | 60 | 25 | <0.001 | 8.00 (3.80–16.80) |
| 5 | Exon 3 | c.1041T>C | TAT>TAC | p.Y347Y | 5 | 0 | 0.058 | - |
FOXC1 variations identified in this study with p-value at 95% confidence interval by using Pearson χ2/Fisher’s exact test.
| 1 | Ins GCC | GGC375ins | 5 | 4 | 0.240 | 2.3 (0.66–8.00) |
| 2 | Ins CGG | GGC447ins | 6 | 5 | 1 | 1.12 (0.32–3.94) |