| Literature DB >> 21029474 |
Aijun Sun1, Yanpeng Li, Jingyan Wang, Shuai Su, Hongjun Chen, Hongfei Zhu, Jiabo Ding, Zhizhong Cui.
Abstract
BACKGROUND: The 1.8-kb mRNA was reported as one of the oncogenesis-related genes of Marek's disease virus (MDV). In this study, the bacterial artificial chromosome (BAC) clone of a MDV field strain GX0101 was used as the platform to generate mutant MDV to examine the functional roles of 1.8-kb mRNA.Entities:
Mesh:
Substances:
Year: 2010 PMID: 21029474 PMCID: PMC2984594 DOI: 10.1186/1743-422X-7-294
Source DB: PubMed Journal: Virol J ISSN: 1743-422X Impact factor: 4.099
Figure 1Analysis of PCR products of GX0101Δ(A+C)-BAC DNA. Lane M: DL2000 marker (TaKaRa Bio-Company, China); 1: the PCR product of GX0101Δ1 (A+C); 2: the PCR product of GX0101Δ (A+C). The bigger band demonstrated one of ORF (A+C) was replaced by kana gene (in lanes 1 and 2). The smaller band demonstrated the deletion of the second ORF(A+C) in GX0101Δ(A+C)-BAC DNA (in lane 2) compared to the smaller band that not deleted the second ORF(A+C) in GX0101Δ1(A+C)-BAC DNA (in lane 1).
Figure 2Comparison of plaque characteristic of bac-GX0101Δ(A+C) and parental virus GX0101 in CEF. A: plaque of GX0101Δ(A+C); B: plaque of GX0101. GX0101 and GX0101Δ(A+C) were inoculated onto six-well plates seeded with CEFs and incubated at 37°C, 5% CO2, respectively. Visible viral plaques were confirmed by IFA with monoclonal antibody H19. The plaque size of GX0101Δ(A+C) was smaller than that of GX0101 at 96 h after infected in fresh CEF cells.
Figure 3Growth curves of GX0101Δ(A+C) and GX0101 in vitro. 100 PFU GX0101 and GX0101Δ(A+C) were inoculated onto six-well plates seeded with 2×106 CEFs and incubated at 37°C, 5% CO2, respectively. At hours 0, 24, 48, 72, 96, 120 and 144 p.i., the infected cells were trypsinized and serial 10-fold dilutions were added onto six-well plates of CEFs, visible viral plaques were counted on days 5 p.i. by IFA. The means ± SD at each time point were shown, *P < 0.05 compared with those in GX0101 group. It was demonstrated that the mutant virus GX0101Δ(A+C) exhibited a decreased replication ability in CEF compared with GX0101 at hours 72, 96, 120 and 144 p.i. (P < 0.05).
Comparision of viremia levels between GX0101 and GX0101Δ(A+C) infected SPF chickens (n = 10)
| Days post inoculation | Viremia (PFU/ml) | |
|---|---|---|
| GX0101 | GX0101Δ(A+C) | |
| 7 | 156.5 ± 40.5 a | 123.8 ± 27.3 a |
| 14 | 475.8 ± 55a | 255.0 ± 39.5 b |
| 21 | 1567.4 ± 253.6 a | 455.4 ± 98.7 b |
| 28 | 1244.3 ± 242.6 a | 513.4 ± 188.9 b |
The numbers in the table indicate: mean ± standard deviation. The same letters following values indicate that the differences were not significant (P > 0.05) between treatments at each time. The different letters following values indicate that the differences were significant (P < 0.05) between treatments at each time.
Comparision of CAT expression levels under the promoter in opposite directions in GX0101Δ(A+C)-CEF or GX0101-CEF (n = 5)
| Transfected plasmids | Transfected CEF | ||
|---|---|---|---|
| GX0101Δ(A+C)-CEF | GX0101-CEF | CEF | |
| pP(pp38)-CAT | 0.069 ± 0.013b | 0.413 ± 0.045a | 0.002 ± 0.0002c |
| pP(1.8-kb)-CAT | 0.073 ± 0.024b | 0.505 ± 0.068a | 0.001 ± 0.0004c |
| Control | 0.000 ± 0.000a | 0.000 ± 0.000a | 0.000 ± 0.000a |
The numbers in the table indicate: mean ± standard deviation of five replicate assays with a given reporter plasmid. The same letters following values indicate that the differences were not significant (P > 0.05) between treatments. The different letters following values indicate that the differences were significant (P < 0.05) between treatments.
Comparisons of growth rates of birds challenged with GX0101Δ(A+C) or GX0101
| Weeks post inoculation | Groups | ||
|---|---|---|---|
| Control | GX0101Δ(A+C) | GX0101 | |
| 3 | 117.91 ± 9.40 (13) a | 111.62 ± 18.62 (34) a | 117.88 ± 17.63 (33) a |
| 4 | 189.17 ± 18.44 (13) a | 175.74 ± 33.62 (34) a | 174.84 ± 32.44 (31) a |
| 5 | 275.42 ± 30.34 (13) a | 243.24 ± 46.9 (34) b | 233.83 ± 51.82 (30) b |
| 6 | 401.25 ± 41.24 (13) a | 335.61 ± 62.71 (33) b | 309.66 ± 91.74 (29) b |
| 8 | 672.92 ± 72.53 (13) a | 571.72 ± 102.58 (32) b | 510.19 ± 155.27 (26) b |
The numbers in the table indicate: mean ± standard deviation. Different letters indicate that the differences were significant (P < 0.05) between treatments at each time.
Comparison of the mortality and oncogenicity in SPF chickens
| Strain | Mortality (%) | Oncogenicity (%) |
|---|---|---|
| GX0101 | 20/40 (50.0) | 9/40 (22.5) |
| GX0101Δ(A+C) | 16/40 (40.0) | 5/40 (12.5) |
| Control | 0/13 (0) | 0/13 (0) |
Influence of GX0101Δ(A+C) and GX0101 virus infections on HI antibody titers to NDV, AIV-H5 and AIV-H9 after vaccination
| Strain | HI titers (log2) | ||
|---|---|---|---|
| NDV | AIV-H5 | AIV-H9 | |
| GX0101 | 9.71 ± 1.46(28)b | 4.45 ± 2.92(28)b | 3.48 ± 2.06(28)c |
| GX0101Δ(A+C) | 10.07 ± 1.23(33)a | 5.63 ± 2.77(33)b | 5.50 ± 2.39(33)b |
| Control | 10.57 ± 0.76(13)a | 7.15 ± 1.41(13)a | 7.00 ± 1.41(13)a |
The numbers in the table indicate: mean ± standard deviation. Different letters indicate that the differences were significant (P < 0.05) between treatments.
List of primers used for the deletion of ORF A and C
| Primers | Sequence 5'-3' |
|---|---|
| 1.8-kb mRNA(A+C)-kanR-F | 5'-aaaggatctcaattaatagaacggcgattttttatttacggcgatatttg |
| 1.8-kb mRNA(A+C)-kanR-R | 5'-aaacagtttctaatcgaaagcgttaccgaacttgtctttaatgagaatcc |
For primers 1.8-kb(A+C)-kanR-F, 1.8-kb(A+C)-kanR-R, underlined sequences indicate the sequences from pKD13 used to amplify the KanR gene cassete with FRT, and sequences in bold indicate MDV sequence flanking the ORF (A+C).