Literature DB >> 21029423

Genetic variants in mannose receptor gene (MRC1) confer susceptibility to increased risk of sarcoidosis.

Takeshi Hattori1, Satoshi Konno, Ayumu Takahashi, Akira Isada, Kaoruko Shimizu, Kenichi Shimizu, Natsuko Taniguchi, Peisong Gao, Etsuro Yamaguchi, Nobuyuki Hizawa, Shau-Ku Huang, Masaharu Nishimura.   

Abstract

BACKGROUND: Mannose receptor (MR) is a member of the C-type lectin receptor family involved in pathogen molecular-pattern recognition and thought to be critical in shaping host immune response. The aim of this study was to investigate potential associations of genetic variants in the MRC1 gene with sarcoidosis.
METHODS: Nine single nucleotide polymorphisms (SNPs), encompassing the MRC1 gene, were genotyped in a total of 605 Japanese consisting of 181 sarcoidosis patients and 424 healthy controls.
RESULTS: Suggestive evidence of association between rs691005 SNP and risk of sarcoidosis was observed independent of sex and age in a recessive model (P = 0.001).
CONCLUSIONS: These results suggest that MRC1 is an important candidate gene for sarcoidosis. This is the first study to imply that genetic variants in MRC1, a major member of the C-type lectin, contribute to the development of sarcoidosis.

Entities:  

Mesh:

Year:  2010        PMID: 21029423      PMCID: PMC2987761          DOI: 10.1186/1471-2350-11-151

Source DB:  PubMed          Journal:  BMC Med Genet        ISSN: 1471-2350            Impact factor:   2.103


Background

Sarcoidosis is a multi-organ inflammatory disease with exaggerated cellular immune activity that leads to formation of non-caseating granulomas in the affected organs. Although the causes of sarcoidosis remain unclear, several lines of evidence support the idea that sarcoidosis results from exposure of genetically susceptible individuals to unknown environmental triggers [1-9]. Amomg this evidence, environmental pathogens such as Mycobacterium and Propionibacterium species have been suggested to play roles in the pathogenesis of sarcoidosis [7-9]. Recent insights into the complex mechanisms underlying human innate immunity suggest that genetic variability in the genes encoding immune system components plays a role in the development of chronic inflammatory diseases. In particular, the association between sarcoidosis and genetic variants of several pattern recognition receptors (PRRs), such as Toll-like receptors (TLRs), have been extensively analyzed [10-12]. Although TLRs are an important system for microbial sensing, they are not the only PRRs with this function. At the cell-surface, C-type lectin-like molecules, such as the mannose receptor and the β-glucan receptors, also participate in the binding and uptake of microbial components [13,14]. Components of bacteria and viruses that gain entry into the cytoplasm are recognized by cytosolic receptors, through which they induce cytokine production and cell activation [15,16]. Recent studies have shown the genetic association between sarcoidosis and non-TLRs [11,17]. Mannose receptor (MR) is a member of the pattern-recognition C-type lectin receptor (CLR) family, which plays an important role in innate immunity. MR is predominantly present on macrophages and dendritic cells and recognizes glycan structures containing mannose, fucose and N-acetylglucosamine, which are commonly found on the cell walls of pathogenic micro-organisms such as mycobacteria, fungus, parasites and yeast [18]. We therefore speculated that the MRC1 gene may be an excellent candidate for susceptibility to sarcoidosis, and tested for associations between MRC1 polymorphisms and the development of sarcoidosis in our Japanese case-control analysis.

Methods

Subjects

We enrolled unrelated subjects in this case-control study to search for susceptibility genes to sarcoidosis. A total of 181 Japanese subjects with sarcoidosis were recruited from the pulmonary clinic of the First Department of Medicine at Hokkaido University Hospital. Diagnosis of sarcoidosis in each patient was based on compatible clinical findings, histological demonstration of noncaseating epithelioid cell granuloma, and exclusion of other diseases capable of producing a similar histological or clinical picture, as recommended by the American Thoracic Society (ATS)/European Respiratory Society (ERS)/World Association of Sarcoidosis and Other Granulomatous Disorders (WASOG) statement. A total of 424 healthy controls, comprising individuals with no history of asthma or any other chronic pulmonary diseases, were recruited from individuals visiting the clinic for annual routine physical examinations and students at the School of Medicine at Hokkaido University. All subjects were unrelated and of Japanese descent. The medical ethics committee of Hokkaido University Graduate School of Medicine approved this study.

SNP Selection and Genotyping

Initially, we selected and genotyped seven SNPs in the MRC1 gene [12555A/G (rs2477637), 13789G/A (rs2253120), 17023A/C (rs2477631), 24351A/T (rs2477664), 31598A/G (rs692527), 40240G/A (rs1926736) and 111380T/C (rs691005)] based on our previous report [19]. As rs691005 showed a significant association, but major haplotyopes with strong linkage disequilibrium (LD) are not constructed by rs691005 using these 7 SNPs as described below (Figure 1), we genotyped two additional SNPs [11041G/A (rs554995) and 11065G/A (rs554313)] which are located close to rs691005. Additional LD structure using these 3 SNPs was shown in Figure 2. Alleles were identified using an assay combining kinetic (real-time quantitative) PCR with allele-specific amplification, as described elsewhere [19]. Real-time PCR was performed using SYBER Green I Master Mix (Applied Biosystems, Foster City, CA, USA) and an ABI PRISM TM 7700 Sequence Detection System (Applied Biosystems). Primers for allele specific PCR are shown in Table 1. rs554995 and rs554313 were genotyped using the TaqMan system (Applied Biosystems).
Figure 1

Linkage disequilibrium structure (LD) of Black squares represent high pairwise linkage disequilibrium, coloring down to white squares of low pairwise linkage disequilibrium. The numbers in the individual squares are D' multiplied by 100.

Figure 2

Linkage disequilibrium structure (LD) of 3 SNPs (rs544995, rs544313 and rs691005) in Black squares represent high pairwise linkage disequilib. The numbers in the individual squares are D' multiplied by 100.

Table 1

Primers for allele specific PCR

Locus*Primer sequence
12555Forward5' ACTCAGTTACTTTCATTTGTTTATTCCTTAAC 3'
Reverse for A5' CCTTTAATTAAATCAAAATTGAGTTCAT 3'
Reverse for G5' CCTTTAATTAAATCAAAATTGAGTTCAC 3'
13789Forward5' GAATCTCAGATTATGAGTGTTGCATTT 3'
Reverse for A5' CATAGAGAGTGATAGCAACCCAGTCT 3'
Reverse for G5' CATAGAGAGTGATAGCAACCCAGTCC 3'
17023Forward for A5' GGGATTGCAAGCGTGAGACA 3'
Forward for C5' GGGATTGCAAGCGTGAGACC 3'
Reverse5' TTTGCAGATTCTACGACTTGAAAAAG 3'
24351Forward for A5' GAGCTCCTGAGCATCACAGAGATA 3'
Forward for T5' GAGCTCCTGAGCATCACAGAGATT 3'
Reverse for A5' ACTACCTGTCAGGTATGTTTGCTCAT 3'
Reverse for T5' CTTACCTGTCAGGTATGTTTGCTCAT 3'
31598Forward for A5' CAATAAAGGTCTCTGTTTAAAGTTTCAA 3'
Forward for G5' CAATAAAGGTCTCTGTTTAAAGTTTCAG 3'
Reverse for A5' CAACACATCAGGGATACTCTGAGAAT 3'
Reverse for G5' GTACCCAACACATCAGGGATACTCT 3'
40240Forward5' AGGGATGCTCTGACCACCTG 3'
Reverse for A5' GTGTGGATACTTGCGAGGTCTCT 3'
Reverse for G5' TGTGGATACTTGGGAGGTCTCC 3'
111380Forward for C5' TCTCTTTGGTACAACATAGTAAATCTCACC 3'
Forward for T5' TCTCTTTTTGGTACAACATAGTAAATCTCACT 3'
Reverse for C5' TTACCAACTGTTTTCCCATAATTGTG 3'
Reverse for T5' CCAACTGTTTTCCCATAATTGTGAG 3'

* Nucleotide numbering starts from the first nucleotide of the transcription start site.

Linkage disequilibrium structure (LD) of Black squares represent high pairwise linkage disequilibrium, coloring down to white squares of low pairwise linkage disequilibrium. The numbers in the individual squares are D' multiplied by 100. Linkage disequilibrium structure (LD) of 3 SNPs (rs544995, rs544313 and rs691005) in Black squares represent high pairwise linkage disequilib. The numbers in the individual squares are D' multiplied by 100. Primers for allele specific PCR * Nucleotide numbering starts from the first nucleotide of the transcription start site.

Statistical Analysis

Each of the SNPs in the MRC1 gene was tested for deviation from Hardy-Weinberg equilibrium using a χ2 test. Both genotypic and allelic association among subjects with sarcoidosis and healthy controls were statistically compared using the logistic regression analysis adjusting for sex and age. The relative risk was estimated as odds ratios (OR) with 95% confidence intervals (95%CI). For LD mapping, pair-wise LD between polymorphisms in MRC1 was evaluated using Haploview software version 4.2 [20]. For haplotype analyses, we used the haplo.score program, which calculates simulation P values for each haplotype and further adjusts for covariates. Haplotypes with frequency below 5% were excluded from haplotype analysis. These statistical analyses were performed using a program R version 2.11.1 (http://www.R-project.org/) [21]. P values were adjusted using the Bonferroni correction for 10 tests. Levels of significance for all statistical analyses were set to P < 0.005.

Results

Demographic characteristics of the 424 healthy controls and 181 subjects with sarcoidosis from this population are listed in Table 2. Median age was significantly higher for subjects with sarcoidosis than for healthy control subjects (P < 0.05). The sarcoidosis group included significantly more females than the control group (P < 0.05). Pair-wise LD values for 7 SNPs are shown in Figure 1. No significant deviation from the Hardy-Weinberg equilibrium was observed in healthy control subjects (P > 0.05). Genotype and allele frequencies and counts for each SNP in the MRC1 gene are shown in Table 3. When we performed logistic repression analysis using a recessive model adjusted for age and gender, 3 SNPs tended to be associated with sarcoidosis (rs2477637, OR 1.76, 95%CI, 1.09-2.84, P = 0.02; rs692527, OR 1.58, 95%CI 1.02-2.46, P = 0.042; and rs691005, OR 2.53, 95%CI 1.47-4.37, P = 0.001; Table 4). Additional association was observed for SNP rs2253120 (OR 1.62, 95%CI 1.12-2.36, P = 0.011), when analysis was performed under a dominant model. The rs691005 SNP remained statistically significant after Bonferroni correction. The linkage disequilibrium map constructed from 7 SNPs is shown in Figure 1, as measured by D prime and we identified two haplotype blocks. Haplotype block 1 comprised two SNPs (rs2477631 and rs2477664), and haplotype block 2 comprised two SNPs (rs692527 and rs1926736). However, significant association was not found in haplotype analysis (Table 5).
Table 2

Characteristics of 605 Japanese subjects

Japanese populationControl (n = 424)Sarcoidosis (n = 181)P value
Male (%)*65.330.9<0.05
Age (median, range)38, 18-7245, 10-78<0.05
Stage (0/I/II/III/IV)-21/90/59/11/0
Occular lesion (%)-54.7
Cutaneous lesion (%)-17.7
Cardiac lesion (%)-7.2

Data are presented as median (interquartile range). * χ2 test † Mann-Whiteney U test

Table 3

Allele and genotype frequencies for 9 SNPs in MRC1 among subjects with sarcoidosis and control subjects

SNP IDLocus*RoleAA changeAlleleControls n (%)Cases n (%)P GenotypeControls n (%)Cases n (%)P
rs247763712555intron1noneA547 (64.5)213 (58.8)0.062AA180 (42.5)73 (40.3)0.016
G301 (35.5)149 (41.2)AG187 (44.1)67 (37.0)
GG57 (13.4)41 (22.7)
rs225312013789exon2noneG638 (75.2)253 (69.9)0.053GG250 (59.0)86 (47.5)0.016
A210 (24.8)109 (30.1)AG138 (32.5)81 (44.8)
AA36 (8.5)14 (7.7)
rs247763117023intron2noneA443 (52.2)191 (52.8)0.868AA120 (28.3)46 (25.4)0.296
C405 (47.8)171 (47.2)AC203 (47.9)99 (54.7)
CC101 (23.8)36 (19.9)
rs247766424351exon4noneA455 (53.7)191 (52.8)0.776AA131 (30.9)49 (27.1)0.412
T393 (46.3)171 (47.2)AT193 (45.5)93 (51.4)
TT100 (23.6)39 (21.5)
rs69252731598intron5noneA474 (55.9)184 (50.8)0.105AA130 (30.7)50 (27.6)0.145
G374 (44.1)178 (49.2)AG214 (50.5)84 (46.4)
GG80 (18.9)47 (26.0)
rs192673640240exon7Gly/SerG443 (52.2)198 (54.7)0.433GG111 (26.2)56 (30.9)0.455
A405 (47.8)164 (45.3)AG221 (52.1)86 (47.5)
AA92 (21.7)39 (21.5)
rs5449951110413'-UTRnoneG598 (70.5)254 (70.2)0.957GG200 (47.2)88 (48.6)0.526
A250 (29.5)108 (29.8)AG198 (46.7)78 (43.1)
AA26 (6.1)15 (8.3)
rs5449951110653'-UTRnoneG522 (63.4)239 (66.0)0.159GG163 (38.4)75 (41.4)0.148
A326 (39.6)123 (34.0)AG196 (46.2)89 (49.2)
AA65 (15.3)17 (9.4)
rs6910051113803'-UTRnoneT576 (67.9)226 (62.4)0.064TT191 (45.0)79 (43.6)0.003
C272 (32.1)136 (37.6)TC194 (45.8)68 (37.6)
CC39 (9.2)34 (18.8)

* Nucleotide numbering starts from the first nucleotide of the transcription start site.

† Allele frequencies of each SNP were compared between sarcoidosis and controls by χ2 test (2 × 2).

‡ Overall genotype differeneces were compared between sarcoidosis and controls by χ2 test (2 × 3).

Table 4

Odds ratios (OR) and P values for 9 SNPs in MRC1 among subjects with sarcoidosis and control subjects

Dominant modelRecessive model
OR [95% CI]*P value*OR [95% CI]*P value*
rs24776371.04 [0.71-1.52]0.8431.76 [1.09-2.84]0.02
rs22531201.62 [1.12-2.36]0.0110.83 [0.42-1.65]0.593
rs24776311.08 [0.70-1.64]0.7390.79 [0.50-1.24]0.298
rs24776641.18 [0.78-1.78]0.4330.87 [0.56-1.36]0.535
rs6925271.15 [0.76-1.74]0.4961.58 [1.02-2.46]0.042
rs19267360.78 [0.52-1.17]0.2220.97 [0.62-1.53]0.906
rs5549950.90 [0.62-1.31]0.5881.43 [0.70-2.95]0.326
rs5543130.83 [0.57-1..21]0.3360.65 [0.36-1.18]0.159
rs6910051.00 [0.69-1.46]0.9872.53 [1.47-4.37]0.001

* logistic regression model: adjusted by sex and age

Table 5

Estimated haplotype frequencies and association with sarcoidosis

Haplotypecontrols (%)*cases (%)*total (%)*haplotype-specific scoresimulated P
rs2477631-rs2477664
A-A48.648.448.6-0.1710.863
C-T42.742.942.80.0890.929

rs692527-rs1926736
A-A46.041.444.6-1.6010.111
A-G9.89.59.7-0.4280.667
G-G42.445.243.21.0740.279

rs554995-rs554313-rs691005
G-G-T30.630.630.60.0980.916
A-G-C27.729.428.10.7410.452
G-A-T29.336.234.72.2200.028

*Minimum haplortpe frequency was 0.05 for which haplotypes were scored in the model.

†adjusted by sex and age

Characteristics of 605 Japanese subjects Data are presented as median (interquartile range). * χ2 test † Mann-Whiteney U test Allele and genotype frequencies for 9 SNPs in MRC1 among subjects with sarcoidosis and control subjects * Nucleotide numbering starts from the first nucleotide of the transcription start site. † Allele frequencies of each SNP were compared between sarcoidosis and controls by χ2 test (2 × 2). ‡ Overall genotype differeneces were compared between sarcoidosis and controls by χ2 test (2 × 3). Odds ratios (OR) and P values for 9 SNPs in MRC1 among subjects with sarcoidosis and control subjects * logistic regression model: adjusted by sex and age Estimated haplotype frequencies and association with sarcoidosis *Minimum haplortpe frequency was 0.05 for which haplotypes were scored in the model. †adjusted by sex and age Based on LD structure and significant association of rs691005 for initial analysis, we further genotyped two additional SNPs (rs554995 and rs554313) close to rs691005. Unfortunately, these two SNPs did not show significant associations (Tables 3 and 4). Although three SNPs (rs554995, rs554313 and rs691005) showed strong LD, significant associations were not found in haplotype analysis (Table 5).

Discussion

In the present study we demonstrated the association between MRC1 polymorphisms and risk of sarcoidosis in Japanese population. In support of this, the association of one SNP (rs691005) was confirmed considering for multiple testing and Bonferroni correction, suggesting MRC1 gene as a plausible candidate gene for development of sarcoidosis. Of interest, recent genome-wide association analyses have shown that 10p12, where MRC1 is situated, is a susceptibility locus for the development of sarcoidosis [22]. Thus, findings of the current study suggest that MRC1 gene variants may contribute to the development of sarcoidosis. The rs691005 located within the 3'-untranslated region (3'-UTR) of MRC1 showed the strongest association (OR 2.53). Although the real functions of this gene are unclear, variants in the 3'-UTR are known to disrupt a regulatory binding sequence and alter mRNA expression [23]. Alternatively, this variant may be representative of the region or correlated with a true functional variant. Thus, our current results provide a basis for further identification of the causative variants underlying the relationship between MRC1 gene sequences and sarcoidosis. It should be noted that SNPs with two positions were mapped to MRC1 spanning chr10:17,891,368-17,993,183 (HapMap Data Rel 27) and were referred to by their MRC1L1 'rs'numbers (NCBI EntrezSNP database Build 130). Alter et al reported no evidence for a common gene duplication event [24]. The authors suggested that MRC1L is an erroneous annotation caused by the presence of a sequence gap and the incorrect assignment of a polymorphic haplotype. We also reported the association of MRC1 gene polymorphism and risk of asthma in two independent ethnically diverse populations [19], suggesting that MRC1 might be involved in the pathogenesis of a number of chronic inflammatory diseases. Several reports have shown that genetic variants of genes related to PRRs such as TLR4 and CD14 are associated with susceptibility to both diseases [10,11,25-27]. The present study adds further evidence supporting the involvement of macrophage PRRs in the development of sarcoidosis as a chronic inflammatory lung disease. Of the SNPs examined, three SNPs (rs26777637, rs2253120 and rs692427) showed tendency for association with sarcoidosis (P = 0.02, P = 0.011, P = 0.042), but this association did not reach significance after the Bonferroni correction. However, associations of rs691005 remained significant even after Bonferroni correction (P = 0.001). In addition, power calculations based on study subjects of 181 cases and 424 controls, OR of 2.53 showed a sufficient genetic power (0.81) at the level of significance of 0.005. As the sample size of this study is not sufficiently large and is restricted to Japanese population, the present data should be validated in larger samples and in other ethnic groups.

Conclusions

This study suggests that the MRC1 gene may represent an important susceptibility locus for sarcoidosis at chromosome 10p12 and genetic variants in MRC1 may play significant roles in the pathogenesis of sarcoidosis. Importantly, the association we observed between MRC1 polymorphisms and sarcoidosis adds further evidence for the involvement of macrophage PRRs in the development of a number of chronic inflammatory diseases, including sarcoidosis. However, further studies are clearly needed to achieve a comprehensive coverage of genetic variants in and around the MRC1 gene, in order to identify causal variants conferring susceptibility to an increased risk of sarcoidosis.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

The authors TH, SK, PG, SH, NH and MN made substantial contribution to the conception and design of the study, and analysis and interpretation of the data. AT, AI, Kaouruko S, Kenichi S, and NT, and EY made a substantial contribution to the collection of the resources and an intellectual contribution to the study design. All authors read and approved the final version.

Pre-publication history

The pre-publication history for this paper can be accessed here: http://www.biomedcentral.com/1471-2350/11/151/prepub
  26 in total

1.  Association of a promoter polymorphism of the CD14 gene and atopy.

Authors:  G H Koppelman; N E Reijmerink; O Colin Stine; T D Howard; P A Whittaker; D A Meyers; D S Postma; E R Bleecker
Journal:  Am J Respir Crit Care Med       Date:  2001-03       Impact factor: 21.405

2.  Occupational risk factors for sarcoidosis in African-American siblings.

Authors:  Gena P Kucera; Benjamin A Rybicki; Kandace L Kirkey; Steven W Coon; Marcie L Major; Mary J Maliarik; Michael C Iannuzzi
Journal:  Chest       Date:  2003-05       Impact factor: 9.410

3.  Familial aggregation of sarcoidosis. A case-control etiologic study of sarcoidosis (ACCESS).

Authors:  B A Rybicki; M C Iannuzzi; M M Frederick; B W Thompson; M D Rossman; E A Bresnitz; M L Terrin; D R Moller; J Barnard; R P Baughman; L DePalo; G Hunninghake; C Johns; M A Judson; G L Knatterud; G McLennan; L S Newman; D L Rabin; C Rose; A S Teirstein; S E Weinberger; H Yeager; R Cherniack
Journal:  Am J Respir Crit Care Med       Date:  2001-12-01       Impact factor: 21.405

4.  The incidence, prevalence, and severity of sarcoidosis in New York City firefighters.

Authors:  D J Prezant; A Dhala; A Goldstein; D Janus; F Ortiz; T K Aldrich; K J Kelly
Journal:  Chest       Date:  1999-11       Impact factor: 9.410

5.  Quantitative analysis of mycobacterial and propionibacterial DNA in lymph nodes of Japanese and European patients with sarcoidosis.

Authors:  Yoshinobu Eishi; Moritaka Suga; Ikuo Ishige; Daisuke Kobayashi; Tetsuo Yamada; Tamiko Takemura; Touichiro Takizawa; Morio Koike; Shoji Kudoh; Ulrich Costabel; Josune Guzman; Gianfranco Rizzato; Marcello Gambacorta; Ronald du Bois; Andrew G Nicholson; Om P Sharma; Masayuki Ando
Journal:  J Clin Microbiol       Date:  2002-01       Impact factor: 5.948

6.  The mannose receptor family.

Authors:  Lucy East; Clare M Isacke
Journal:  Biochim Biophys Acta       Date:  2002-09-19

7.  A TLR4 polymorphism is associated with asthma and reduced lipopolysaccharide-induced interleukin-12(p70) responses in Swedish children.

Authors:  Malin Fagerås Böttcher; Mounira Hmani-Aifa; Anna Lindström; Maria Christina Jenmalm; Xiao-Mei Mai; Lennart Nilsson; Helena Aniansson Zdolsek; Bengt Björkstén; Peter Söderkvist; Outi Vaarala
Journal:  J Allergy Clin Immunol       Date:  2004-09       Impact factor: 10.793

8.  HLA-DRB1*1101: a significant risk factor for sarcoidosis in blacks and whites.

Authors:  Milton D Rossman; Bruce Thompson; Margaret Frederick; Mary Maliarik; Michael C Iannuzzi; Benjamin A Rybicki; Janardan P Pandey; Lee S Newman; Eleni Magira; Bojana Beznik-Cizman; Dimitri Monos
Journal:  Am J Hum Genet       Date:  2003-08-20       Impact factor: 11.025

9.  Sequence variants of the gene encoding chemoattractant receptor expressed on Th2 cells (CRTH2) are associated with asthma and differentially influence mRNA stability.

Authors:  Jing-Long Huang; Pei-Song Gao; Rasika A Mathias; Tsung-Chieh Yao; Li-Chen Chen; Ming-Ling Kuo; Shih-Chang Hsu; Beverly Plunkett; Alkis Togias; Kathleen C Barnes; Cristiana Stellato; Terri H Beaty; Shau-Ku Huang
Journal:  Hum Mol Genet       Date:  2004-09-02       Impact factor: 6.150

10.  Genetic and functional analysis of common MRC1 exon 7 polymorphisms in leprosy susceptibility.

Authors:  Andrea Alter; Louis de Léséleuc; Nguyen Van Thuc; Vu Hong Thai; Nguyen Thu Huong; Nguyen Ngoc Ba; Cynthia Chester Cardoso; Audrey Virginia Grant; Laurent Abel; Milton Ozório Moraes; Alexandre Alcaïs; Erwin Schurr
Journal:  Hum Genet       Date:  2009-12-25       Impact factor: 4.132

View more
  13 in total

1.  Genetic variants of the MRC1 gene and the IFNG gene are associated with leprosy in Han Chinese from Southwest China.

Authors:  Dong Wang; Jia-Qi Feng; Yu-Ye Li; Deng-Feng Zhang; Xiao-An Li; Qing-Wei Li; Yong-Gang Yao
Journal:  Hum Genet       Date:  2012-03-06       Impact factor: 4.132

2.  The novel human MRC1 gene polymorphisms are associated with susceptibility to pulmonary tuberculosis in Chinese Uygur and Kazak populations.

Authors:  Xing Zhang; Xiang Li; Wanjiang Zhang; Liliang Wei; Tingting Jiang; Zhongliang Chen; Chunping Meng; Jiyan Liu; Fang Wu; Chong Wang; Fujian Li; Xiaojun Sun; Zhongjie Li; Ji-Cheng Li
Journal:  Mol Biol Rep       Date:  2013-05-08       Impact factor: 2.316

Review 3.  Basic and clinical research on the regulation of the intestinal barrier by Lactobacillus and its active protein components: a review with experience of one center.

Authors:  Zhi-Hua Liu; Liang Kang; Jian-Ping Wang
Journal:  Mol Biol Rep       Date:  2014-09-04       Impact factor: 2.316

4.  Involvement of the mannose receptor and p38 mitogen-activated protein kinase signaling pathway of the microdomain of the integral membrane protein after enteropathogenic Escherichia coli infection.

Authors:  Zhihua Liu; Yanlei Ma; Mary Pat Moyer; Peng Zhang; Chenzhang Shi; Huanlong Qin
Journal:  Infect Immun       Date:  2012-01-30       Impact factor: 3.441

Review 5.  Immunogenetics of Disease-Causing Inflammation in Sarcoidosis.

Authors:  Johan Grunewald; Paolo Spagnolo; Jan Wahlström; Anders Eklund
Journal:  Clin Rev Allergy Immunol       Date:  2015-08       Impact factor: 8.667

6.  The Immunogenetics of Granulomatous Diseases.

Authors:  Gizem Filazi Kök; Ümit Türsen
Journal:  Adv Exp Med Biol       Date:  2022       Impact factor: 2.622

7.  M. tuberculosis-Initiated Human Mannose Receptor Signaling Regulates Macrophage Recognition and Vesicle Trafficking by FcRγ-Chain, Grb2, and SHP-1.

Authors:  Murugesan V S Rajaram; Eusondia Arnett; Abul K Azad; Evelyn Guirado; Bin Ni; Abigail D Gerberick; Li-Zhen He; Tibor Keler; Lawrence J Thomas; William P Lafuse; Larry S Schlesinger
Journal:  Cell Rep       Date:  2017-10-03       Impact factor: 9.423

8.  C-type lectin receptors and RIG-I-like receptors: new points on the oncogenomics map.

Authors:  Anton G Kutikhin; Arseniy E Yuzhalin
Journal:  Cancer Manag Res       Date:  2012-02-24       Impact factor: 3.989

9.  Polymorphic allele of human MRC1 confer protection against tuberculosis in a Chinese population.

Authors:  Xing Zhang; Feng Jiang; Liliang Wei; Fujian Li; Jiyan Liu; Chong Wang; Menyuan Zhao; Tingting Jiang; Dandan Xu; Dapeng Fan; Xiaojun Sun; Ji-Cheng Li
Journal:  Int J Biol Sci       Date:  2012-02-23       Impact factor: 6.580

10.  Association of MRC-1 and IL-28B with the treatment outcome of hepatitis C: a case control study.

Authors:  Cheng-Yuan Peng; Ter-Hsin Chen; Yun-Ping Lim; Fuu-Jen Tsai; Wei-Yong Lin; Wen-Ling Liao; Lei Wan
Journal:  BMC Gastroenterol       Date:  2014-06-26       Impact factor: 3.067

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.