BACKGROUND AND PURPOSE: Adenophostin A (AdA) is a potent agonist of inositol 1,4,5-trisphosphate receptors (IP(3) R). AdA shares with IP(3) the essential features of all IP(3) R agonists, namely structures equivalent to the 4,5-bisphosphate and 6-hydroxyl of IP(3) , but the basis of its increased affinity is unclear. Hitherto, the 2'-phosphate of AdA has been thought to provide a supra-optimal mimic of the 1-phosphate of IP(3) . EXPERIMENTAL APPROACH: We examined the structural determinants of AdA binding to type 1 IP(3) R (IP(3) R1). Chemical synthesis and mutational analysis of IP(3) R1 were combined with (3) H-IP(3) binding to full-length IP(3) R1 and its N-terminal fragments, and Ca(2+) release assays from recombinant IP(3) R1 expressed in DT40 cells. KEY RESULTS: Adenophostin A is at least 12-fold more potent than IP(3) in functional assays, and the IP(3) -binding core (IBC, residues 224-604 of IP(3) R1) is sufficient for this high-affinity binding of AdA. Removal of the 2'-phosphate from AdA (to give 2'-dephospho-AdA) had significantly lesser effects on its affinity for the IBC than did removal of the 1-phosphate from IP(3) (to give inositol 4,5-bisphosphate). Mutation of the only residue (R568) that interacts directly with the 1-phosphate of IP(3) decreased similarly (by ~30-fold) the affinity for IP(3) and AdA, but mutating R504, which has been proposed to form a cation-π interaction with the adenine of AdA, more profoundly reduced the affinity of IP(3) R for AdA (353-fold) than for IP(3) (13-fold). CONCLUSIONS AND IMPLICATIONS: The 2'-phosphate of AdA is not a major determinant of its high affinity. R504 in the receptor, most likely via a cation-π interaction, contributes specifically to AdA binding.
BACKGROUND AND PURPOSE:Adenophostin A (AdA) is a potent agonist of inositol 1,4,5-trisphosphate receptors (IP(3) R). AdA shares with IP(3) the essential features of all IP(3) R agonists, namely structures equivalent to the 4,5-bisphosphate and 6-hydroxyl of IP(3) , but the basis of its increased affinity is unclear. Hitherto, the 2'-phosphate of AdA has been thought to provide a supra-optimal mimic of the 1-phosphate of IP(3) . EXPERIMENTAL APPROACH: We examined the structural determinants of AdA binding to type 1 IP(3) R (IP(3) R1). Chemical synthesis and mutational analysis of IP(3) R1 were combined with (3) H-IP(3) binding to full-length IP(3) R1 and its N-terminal fragments, and Ca(2+) release assays from recombinant IP(3) R1 expressed in DT40 cells. KEY RESULTS:Adenophostin A is at least 12-fold more potent than IP(3) in functional assays, and the IP(3) -binding core (IBC, residues 224-604 of IP(3) R1) is sufficient for this high-affinity binding of AdA. Removal of the 2'-phosphate from AdA (to give 2'-dephospho-AdA) had significantly lesser effects on its affinity for the IBC than did removal of the 1-phosphate from IP(3) (to give inositol 4,5-bisphosphate). Mutation of the only residue (R568) that interacts directly with the 1-phosphate of IP(3) decreased similarly (by ~30-fold) the affinity for IP(3) and AdA, but mutating R504, which has been proposed to form a cation-π interaction with the adenine of AdA, more profoundly reduced the affinity of IP(3) R for AdA (353-fold) than for IP(3) (13-fold). CONCLUSIONS AND IMPLICATIONS: The 2'-phosphate of AdA is not a major determinant of its high affinity. R504 in the receptor, most likely via a cation-π interaction, contributes specifically to AdA binding.
Receptors for inositol 1,4,5-trisphosphate (IP3R, nomenclature follows Alexander ) are intracellular Ca2+ channels. They are expressed in the membranes of the endoplasmic reticulum of most animal cells (Foskett ) and they both initiate and propagate the Ca2+ signals evoked by receptors that stimulate IP3 formation (Berridge ). In vertebrates, three genes encode closely related subtypes of the IP3R, which assemble into both homo- and hetero-tetrameric channels (Taylor ). The different subtypes share many features (Foskett ). Each subunit has a single IP3-binding site towards the N-terminal, a large cytosolic regulatory domain, and six transmembrane domains, the last pair of which from each subunit, together with the intervening luminal loop, form the pore (Ramos-Franco ; Taylor ). For all IP3R, IP3 binding initiates the conformational changes that lead to opening of the channel. The IP3-binding core [IBC, residues 224–604 of type 1 IP3R (IP3R1)] is entirely responsible for this initial recognition. The two domains (α and β) of the IBC form a clam-like structure lined with the basic residues that coordinate the phosphate groups of IP3 (Bosanac ) (Figure 1A). The 4,5-bisphosphate and 6-hydroxyl groups of IP3 are important for binding to IP3R (Potter and Lampe, 1995), and each forms extensive interactions with the IBC. The 4-phosphate forms hydrogen bonds with several residues in the β-domain, the 5-phosphate is hydrogen-bonded to residues predominantly within the α-domain and the 6-hydroxyl interacts indirectly via water with the backbone of K569 (Figure 1A). The 1-phosphate of IP3 is not essential for binding to IP3R, but it substantially increases the affinity of IP3 (Nerou ); it interacts directly only with R568 and indirectly via a water molecule with the backbone of K569 (Bosanac ) (Figure 1A).
Figure 1
Structures of the IBC and the ligands used. Structure of the IBC (PDB 1N4K) with the enlarged panel highlighting the residues (R504, R568 and K569) mutated in this study and their interactions with the phosphate groups of IP3. The red spheres represent water (A). Structures of the ligands used highlighting the 1-phosphate of IP3 and 2′-phosphate of AdA (B). AdA, adenophostin A; IBC, IP3-binding core; IP3, inositol 1,4,5-trisphosphate.
Structures of the IBC and the ligands used. Structure of the IBC (PDB 1N4K) with the enlarged panel highlighting the residues (R504, R568 and K569) mutated in this study and their interactions with the phosphate groups of IP3. The red spheres represent water (A). Structures of the ligands used highlighting the 1-phosphate of IP3 and 2′-phosphate of AdA (B). AdA, adenophostin A; IBC, IP3-binding core; IP3, inositol 1,4,5-trisphosphate.Adenophostins (Figure 1B) were originally isolated from Penicillium brevicompactum (Takahashi ,b,c;). They are potent agonists of IP3R (Takahashi ,c; Hirota ; Marchant ; Shuto ; Correa ); they are not metabolized by the enzymes that degrade IP3 and their structures are based on a glucose, rather than a myo-inositol, ring (Figure 1B). Adenophostin A (AdA) has proven a useful tool with which to explore the properties of IP3R (Hirota ; Dellis ; Marchant and Parker, 1998; Yoshida ; Parekh ), and it has generated considerable interest in the synthesis of novel AdA analogues (Shuto ; Correa ; Borissow ; Mochizuki ).Inositol 1,4,5-trisphosphate and AdA are each full agonists of the IP3R (Rossi ). Both IP3 and AdA bind to the IBC, and despite their structural differences, the 3",4"-bisphosphate and 2"-hydroxyl groups of AdA evidently mimic the essential 4,5-bisphosphate and 6-hydroxyl of IP3 (Figure 1B) (Takahashi ; Hotoda ; Correa ; Rosenberg ). These features probably account for the binding of AdA to the IBC (Rosenberg ), but they do not explain the ability of AdA to bind to IP3R with greater affinity than IP3. Hitherto, a favoured suggestion is that the 2′-phosphate of AdA, which is thought to mimic the 1-phosphate of IP3 (Figure 1B), is ‘supra-optimally’ positioned and thereby interacts more strongly with R568 and K569 than does the 1-phosphate of IP3 (Takahashi ; Wilcox ; Hotoda ). Alternatively, the adenine of AdA may interact directly with the IP3R (Hotoda ; Glouchankova ; Rosenberg ). Such an interaction would need to be rather tolerant of changes to the adenine group because even substantial modifications to it cause only modest decreases in affinity (Correa ; Sureshan ). Defining the mechanisms responsible for high-affinity binding of AdA would both provide an important step towards rational development of ligands of the IP3R with increased affinity, and contribute to resolving the mechanisms whereby IP3 and AdA can have different effects on Ca2+ signalling (Rossi ). Here, we have used synthetic analogues of IP3 and AdA and systematic mutagenesis of the IBC to address the structural basis of the high-affinity binding of AdA to IP3R.
Methods
Stable expression of mutant IP3R1 in DT40 cells
Cloning of ratIP3R1 (without the S1 splice site) into the pENTR1A vector has been reported previously (Rossi ). The QuikChange II XL site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA) was used to introduce point mutations into ratIP3R1 using the primers (5′-3′) forward: TCACAGCAAGACTACCAGAAGAACCAGGAGTAC, and reverse: GTACTCCTGGTTCTTCTGGTAGTCTTGCTGTGA for R568Q, and forward: TTCTCTAAGCCCAACCAAGAGCGGCAGAAGCTG, and reverse: CAGCTTCTGCCGCTCTTGGTTGGGCTTAGAGAA for R504Q. The sequences of all mutant constructs were confirmed by sequencing of the full-length IP3R. Mutated IP3R were subcloned into the expression vector, pcDNA3.2/V5-DEST, by recombination (Invitrogen, Paisley, UK). DT40 cells stably expressing IP3R1 and its mutants were generated by transfection of cells lacking endogenous IP3R (Sugawara ). DT40 cells were cultured in RPMI 1640 medium supplemented with fetal bovine serum (10%), heat-inactivated chicken serum (1%), 2-mercaptoethanol (50 µM) and glutamine (2 mM). Cells were grown in suspension at 37°C in an atmosphere of 95% air and 5% CO2, and passaged or used for Ca2+ experiments when they reached a density of ∼2 × 106 cells·mL−1 (Tovey ). IP3R expression was quantified by immunoblotting using an antiserum (Ab1.5) to a peptide corresponding to residues 2733–2749 of ratIP3R1.
Mutagenesis of N-terminal fragments of IP3R1
N-terminal fragments of IP3R1 (IBC, residues 224–604; NT, residues 1–604) were amplified by PCR from the ratIP3R1 clone lacking the S1 splice site and ligated into pTrcHisA vectors for expression of N-terminally tagged His6 fusion proteins as previously described (Rossi ). The IBC included the S1 splice site, but the NT lacked it. The presence of the S1 splice site does not affect the equilibrium dissociation constant (Kd) of the IBC for IP3 (data not shown). All fragments are numbered by reference to the full-length (S1+) ratIP3R1 (GenBank accession number: GQ233032.1). The QuikChange II XL site-directed mutagenesis kit was used to introduce point mutations into the IBC and NT constructs in pTrcHisA vectors using the primers listed in the preceding section. The sequences of all constructs were confirmed.
Expression of fragments of IP3R1
His6-tagged IBC and NT fragments were expressed as described previously (Rossi ). Briefly, constructs were transformed into E. coli strain BL21(DE3). Cells were grown in Luria-Bertani medium containing ampicillin (100 µg·mL−1) at 22°C until the OD600 reached 1.0–1.5. The culture was then induced by addition of isopropyl β-d-thiogalactoside (0.5 mM), and after 20 h at 15°C, cells were harvested and lysates were prepared in Tris/EDTA medium (TEM: 50 mM Tris, 1 mM EDTA, pH 8.3) as described (Rossi ). Expression was detected by immunoblotting using an anti-His6 antibody (Sigma, Poole, Dorset, UK). Proteins were cleaved from the His6 tags by incubating bacterial lysate (6 h, 4°C) with thrombin (43 units·mg−1 bacterial protein) in phosphate-buffered saline. Cleavage was monitored by immunoblotting (Rossi ) using anti-His6 antibody and antisera raised to peptides corresponding to residues 62–75 (Ab1) (Cardy ) or 326–343 (the SI splice site, Ab1.1) of IP3R1 (Rossi ) for the NT and IBC respectively.
Purification of IP3R from rat cerebellum
All animal care and experimental procedures complied with UK Home Office policy and with local animal regulations. Adult male Wistar rats were humanely killed by cervical dislocation and cerebella were removed, rapidly frozen in liquid nitrogen and stored at −80°C. IP3R1 was purified from cerebella using heparin-affinity chromatography following a published protocol (Jiang ) with some modifications (Rossi ). Briefly, cerebella (2 g) were homogenized in homogenization medium [30 mL, HM: 1 M NaCl, 1 mM EDTA, 50 mM Tris, 1 mM benzamidine, Roche protease inhibitor cocktail (1 tablet per 25 mL), pH 8.3], and then centrifuged (100 000× g, 30 min). The pellet was solubilized in 20 mL of HM without NaCl, but supplemented with CHAPS (1.2%). After centrifugation (100 000× g, 1 h), the NaCl concentration of the supernatant was increased to 250 mM, and the supernatant was loaded onto heparin-agarose beads (5 mL). After 30 min, the beads were washed twice in glycerol-containing medium [250 mM NaCl, 50 mM Tris, 10% glycerol, 1 mM 2-mercaptoethanol, 1 mM benzamidine, 1 mM EGTA, 1% CHAPS, Roche protease inhibitor cocktail (1 tablet per 50 mL), pH 8.0]. IP3R were eluted with elution medium (500 mM NaCl, 50 mM Tris, 10% glycerol, 1 mM 2-mercaptoethanol, 1 mM benzamidine, 1 mM EGTA, 50 mM Tris, 1% CHAPS, pH 8.0). Samples (∼100 µg protein per mL) were frozen in liquid nitrogen and stored at −80°C.
3H-IP3 binding
Equilibrium-competition binding assays were performed as described (Rossi ). Briefly, incubations (500 µL) at 4°C were in either TEM or cytosol-like medium [CLM: 20 mM NaCl, 140 mM KCl, 1 mM EGTA, 20 mM PIPES, 2 mM MgCl2, 375 µM CaCl2 (free [Ca2+]= 220 nM), pH 7.0] containing 3H-IP3 (0.75–3 nM), bacterial lysate (∼1–10 µg protein) or purified IP3R1 (∼2.5 µg), and competing ligands. For assays using full-length purified IP3R, all media also included CHAPS (1%). Reactions were terminated after 5 min by addition of poly(ethylene glycol) 8000 (500 µL, 30%, w/v) and γ-globulin (30 µL, 25 mg·mL−1), followed by centrifugation (20 000× g, 5 min). Radioactivity was determined by liquid scintillation counting. Non-specific binding, determined by addition of 10 µM IP3, or by extrapolation of competition curves to infinite IP3 concentration, was <10% of total binding.
Ca2+ release by IP3R
A low-affinity Ca2+ indicator (Mag-fluo-4) was used to monitor the free [Ca2+] within the intracellular Ca2+ stores of DT40 cells (Laude ; Tovey ). DT40 cells stably expressing IP3R1 or its mutants were centrifuged (650× g, 2 min) and suspended in medium containing 135 mM NaCl, 5.9 mM KCl, 11.6 mM HEPES, 1.5 mM CaCl2, 11.5 mM glucose, 1.2 mM MgCl2, pH 7.3, 1 mg·mL−1 BSA, 0.4 mg·mL−1 Pluronic F127 and 20 µM Mag-fluo-4 AM. After 1 h at 20°C, cells were suspended in Ca2+-free CLM supplemented with saponin (10 µg·mL−1) to allow selective permeabilization of the plasma membrane. Permeabilized cells were centrifuged (650× g, 2 min), re-suspended in CLM without Mg2+, but supplemented with 10 µM carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP) to inhibit mitochondria, and 375 µM CaCl2 to give a final free [Ca2+] of ∼220 nM after addition of 1.5 mM MgATP. Cells (∼5 × 105 cells per well) were attached to poly-L-lysine-coated, 96-well, black-walled plates (Greiner, Stonehouse, UK). Fluorescence was recorded at 20°C using a FlexStation III plate reader (MDS Analytical Technologies, Woking, Berks, UK) with excitation and emission wavelengths of 485 nm and 520 nm respectively. MgATP (1.5 mM) was added to initiate Ca2+ uptake, and when the endoplasmic reticulum had loaded to steady state with Ca2+, IP3, AdA or their analogues were added. Ca2+ release is expressed as a fraction of the ATP-dependent uptake (Tovey ).
Data analysis
Equilibrium binding results and concentration–effect relationships were fitted to Hill equations (GraphPad Prism, version 5) from which the Hill coefficients (nHill), –logIC50 (pIC50) and –logEC50 (pEC50) values were obtained. For equilibrium-competition binding assays, pKd values were calculated using the Cheng and Prusoff equation (Cheng and Prusoff, 1973). Because pEC50 and pKd values are normally distributed, these results are presented as means ± SEM from n independent experiments. For comparisons of the ratios between mean values (EC50 or Kd), statistical analyses compared the differences between their log values (ΔpEC50 or ΔpKd) (Colquhoun, 1971) with the SEM calculated as follows, assuming that the population variances are the same (confirmed using an F-test) (Ott and Longnecker, 2010):where, sp. is the estimate of the population variance:where, s1 and s2 are the sample standard deviations, and n1 and n2 are the sample sizes.Although all analyses were performed using log values, for greater clarity we present some ratios as the antilogs of the means ± SEM.Statistical analysis used anova followed by Bonferroni test for selected pairs, or unpaired Student's t-tests (GraphPad Prism, version 5). P < 0.05 was considered significant.
Materials
Protease inhibitor cocktail was from Roche (Burgess Hill, Sussex, UK). Heparin-agarose beads and sera were from Sigma (Poole, Dorset, UK). Thrombin was from GE Healthcare (Little Chalfont, Bucks, UK). CHAPS (3-[3-(cholamidopropyl)dimethylammonio]-1-propane-sulphonate) was from Helford Laboratories (Suffolk, UK). RPMI 1640 medium, Pluronic F127 and Mag-fluo-4 AM were from Invitrogen (Paisley, Scotland). 3H-IP3 (681 GBq·mmol-1) was from PerkinElmer (Bucks, UK). IP3 was from Alexis Biochemicals (Nottingham, UK). AdA (Borissow ), 2′-dephospho-AdA (Sureshan ), furanophostin (Marwood ) and ribophostin (Jenkins ) were synthesized as previously described. Inositol 4,5-bisphosphate (IP2) was synthesized by hydrogenolytic deprotection of 1d-2,3,6-tri-O-benzyl-4,5-bis(dibenzyloxyphosphoryl) myo-inositol (Desai ). All ligands were purified by ion-exchange chromatography, fully characterized by the usual spectroscopic methods and accurately quantified by total phosphate assay. The structures of the ligands used are shown in Figure 1B. Sources of other reagents either are specified elsewhere in the methods or were previously reported (Rossi ).
Results
Stimulation of IP3R1 by AdA
We used full-length IP3R1 purified from rat cerebellum for binding assays, and DT40 cells expressing only recombinant IP3R1 to measure Ca2+ release from intracellular stores. Most published analyses of 3H-IP3 binding use media similar to TEM because its high pH and/or low ionic strength reduce the Kd of IP3R for IP3, thereby increasing the specific binding determined with low concentrations of 3H-IP3. At the densities that recombinant full-length IP3R are expressed, it is impracticable to measure 3H-IP3 binding in CLM, although it is feasible with the bacterially expressed fragments of IP3R. To allow comparison with published work (Hirota ; Hotoda ; Glouchankova ; Rossi ) and to provide a direct comparison with our analyses of binding to IP3R fragments, we first examined IP3 and AdA binding to IP3R1 in TEM.In both binding (in TEM) and functional analyses (in CLM), AdA was ∼12- to 19-fold more potent than IP3 (ΔpKd= 1.27 ± 0.09 and ΔpEC50 1.09 ± 0.05) (Figure 2A and B, Table 1, Table S1). These results are consistent with many previous studies (Hirota ; Shuto ; Correa ; Morris ). We note, however, that in one series of studies (Takahashi ,b,c;), the Kd values for IP3 and AdA were incorrectly calculated from the IC50. The correct Kd for IP3 and AdA calculated from the data provided are 13 nM and 0.73 nM, respectively, suggesting that in these studies too, AdA bound with about 18-fold greater affinity than IP3, rather than the stated 100-fold difference.
Figure 2
Interactions of AdA, IP3, and their dephospho analogues with IP3R and its N-terminal (NT) fragments. Equilibrium-competition binding to purified IP3R1 using 3H-IP3 (1.5 nM) and the indicated ligands in TEM (A). Ca2+ release from permeabilized DT40-IP3R1 cells evoked by the indicated ligands (B). Equilibrium-competition binding to the NT using 3H-IP3 (1.5 nM) and the indicated ligands in TEM (C). Equilibrium-competition binding to the IBC using 3H-IP3 (0.75 nM) and the indicated ligands in CLM (D). Equilibrium-competition binding to the NT using 3H-IP3 (1.5 nM) and the indicated ligands in CLM (E). The key to the symbols shown in panel A applies to all five panels (A–E). For each analysis (A–E) the Kd (from binding) or EC50 (from functional assays) is shown as a ratio for IP3 versus AdA (F). For each analysis (A–E), the Kd or EC50 is shown as a ratio for the dephospho analogue relative to IP3 or AdA (G). Results are means ± SEM, n≥ 4. DT40-IP3R1 cells, DT40 cells stably expressing rat type 1 IP3R. AdA, adenophostin A; CLM, cytosol-like medium; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; Kd, equilibrium dissociation constant; TEM, Tris/EDTA medium.
Table 1
Responses of IP3R1 to IP3, AdA and their analogues
Ca2+ release EC50 (nM) (pEC50 ± SEM) nHill± SEM
Release (%)
Binding Kd (nM) (pKd± SEM) nHill± SEM
IP3
38.0
79 ± 3
8.5
(7.42 ± 0.02)
(8.07 ± 0.03)
1.1 ± 0.2
1.0 ± 0.1
IP2
5012
73 ± 7
2394
(5.30 ± 0.08)
(5.62 ± 0.08)
1.4 ± 0.2
0.8 ± 0.1
AdA
3.1
78 ± 3
0.46
(8.51 ± 0.05)
(9.34 ± 0.07)
1.4 ± 0.1
1.5 ± 0.1
2′-dephospho-AdA
160
72 ± 3
18.5
(6.80 ± 0.02)
(7.73 ± 0.09)
1.3 ± 0.2
0.7 ± 0.1
From experiments similar to those shown in Figure 2A and B, the effects of each analogue on Ca2+ release from the intracellular stores of permeabilized DT40-IP3R1 cells and on 3H-IP3 binding to full-length IP3R1 (in TEM) are summarized. Mean EC50 and Kd values are shown together with means ± SEM for pEC50, pKd, Hill coefficients (nHill) and the percentage Ca2+ release. Results are from at least four independent experiments, with each Ca2+ release assay performed with three determinations.
AdA, adenophostin A; DT40-IP3R1 cells, DT40 cells stably expressing rat type 1 IP3R; IP2, inositol 4,5-bisphosphate; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; Kd, equilibrium dissociation constant; nHill, Hill coefficient; TEM, Tris/EDTA medium.
Responses of IP3R1 to IP3, AdA and their analoguesFrom experiments similar to those shown in Figure 2A and B, the effects of each analogue on Ca2+ release from the intracellular stores of permeabilized DT40-IP3R1 cells and on 3H-IP3 binding to full-length IP3R1 (in TEM) are summarized. Mean EC50 and Kd values are shown together with means ± SEM for pEC50, pKd, Hill coefficients (nHill) and the percentage Ca2+ release. Results are from at least four independent experiments, with each Ca2+ release assay performed with three determinations.AdA, adenophostin A; DT40-IP3R1 cells, DT40 cells stably expressing rat type 1 IP3R; IP2, inositol 4,5-bisphosphate; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; Kd, equilibrium dissociation constant; nHill, Hill coefficient; TEM, Tris/EDTA medium.Interactions of AdA, IP3, and their dephospho analogues with IP3R and its N-terminal (NT) fragments. Equilibrium-competition binding to purified IP3R1 using 3H-IP3 (1.5 nM) and the indicated ligands in TEM (A). Ca2+ release from permeabilized DT40-IP3R1 cells evoked by the indicated ligands (B). Equilibrium-competition binding to the NT using 3H-IP3 (1.5 nM) and the indicated ligands in TEM (C). Equilibrium-competition binding to the IBC using 3H-IP3 (0.75 nM) and the indicated ligands in CLM (D). Equilibrium-competition binding to the NT using 3H-IP3 (1.5 nM) and the indicated ligands in CLM (E). The key to the symbols shown in panel A applies to all five panels (A–E). For each analysis (A–E) the Kd (from binding) or EC50 (from functional assays) is shown as a ratio for IP3 versus AdA (F). For each analysis (A–E), the Kd or EC50 is shown as a ratio for the dephospho analogue relative to IP3 or AdA (G). Results are means ± SEM, n≥ 4. DT40-IP3R1 cells, DT40 cells stably expressing rat type 1 IP3R. AdA, adenophostin A; CLM, cytosol-like medium; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; Kd, equilibrium dissociation constant; TEM, Tris/EDTA medium.Inositol 1,4,5-trisphosphate binding is entirely mediated by residues in the IBC (Bosanac ) (Figure 1A). We therefore compared IP3 and AdA binding to the isolated NT, initially in TEM. The results, consistent with a previous analysis of a slightly shorter NT fragment of IP3R1 (residues 1–580) (Glouchankova ), establish that the NT alone binds AdA with about 15-fold greater affinity (ΔpKd= 1.18 ± 0.12) than IP3 (Figure 2C, Table 2 and Table S1). To allow more direct comparisons with functional assays, we compared IP3 and AdA binding to the isolated IBC and NT in CLM. These results confirm the expected substantial decrease in affinity for IP3 in CLM (∼20-fold relative to TEM). More importantly, they establish that in CLM the relative affinities for AdA and IP3 are not significantly different for the IBC and NT (ΔpKd= 1.37 ± 0.07 for the IBC, and 1.14 ± 0.21 for the NT) (Figure 2D and E, Table 3 and Table S1). Indeed in all our assays, the relative affinities of IP3 and AdA for binding to the full-length receptor and its fragments, and their relative potencies in functional assays are not significantly different (Figure 2F, Table S1). It is noteworthy that the nHill for the interactions of AdA with IP3R consistently tend to be greater than unity (see Tables 1–4), even when the interactions are with monomeric IBC or NT (Tables 2 and 3). We and others have reported similar observations previously (reviewed in Rossi ), although the underlying mechanism is unresolved.
Table 2
Binding of IP3, AdA and their analogues to the NT fragment of IP3R1 and its mutants assayed in TEM
Kd (nM) (pKd± SEM) nHill± SEM NT
NTR568Q
NTR504Q
IP3
2.14
41.7
35.6
(8.67 ± 0.13)
(7.38 ± 0.07)
(7.45 ± 0.05)
0.9 ± 0.1
0.7 ± 0.1
0.8 ± 0.1
IP2
641
974
1250
(6.19 ± 0.09)
(6.01 ± 0.12)
(5.90 ± 0.11)
0.8 ± 0.1
0.8 ± 0.1
0.9 ± 0.2
AdA
0.14
2.81
16.5
(9.85 ± 0.04)
(8.55 ± 0.06)
(7.78 ± 0.06)
1.0 ± 0.1
1.3 ± 0.2
0.9 ± 0.1
2′-dephospho-AdA
10.5
13.7
345
(7.98 ± 0.07)
(7.86 ± 0.04)
(6.46 ± 0.08)
1.0 ± 0.1
0.7 ± 0.1
0.8 ± 0.1
Ribophostin
1.92
ND
40.5
(8.72 ± 0.18)
(7.39 ± 0.02)
0.9 ± 0.2
0.9 ± 0.1
Furanophostin
1.19
ND
52.5
(8.92 ± 0.08)
(7.29 ± 0.03)
1.0 ± 0.1
1.0 ± 0.1
From equilibrium-competition binding assays, the Kd, pKd and Hill coefficients (nHill) values for each ligand are shown for the NT and NT mutants of IP3R1 measured in TEM. Parallel experiments with mutant NT fragments in CLM were not practicable because of the low affinity of the interactions. Results are means (Kd) or means ± SEM (pKd and nHill) from 4–14 independent experiments.
AdA, adenophostin A; CLM, cytosol-like medium; IP2, inositol 4,5-bisphosphate; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; Kd, equilibrium dissociation constant; ND, not determined; nHill, Hill coefficient; NT, N-terminal; TEM, Tris/EDTA medium.
Table 3
Binding of IP3, AdA and their dephospho analogues to the NT, IBC and IBC mutants assayed in CLM
Kd (nM) (pKd± SEM) nHill± SEM NT
IBC
IBCR568Q
IBCR504Q
IP3
47.0
7.23
271
96.8
(7.33 ± 0.16)
(8.14 ± 0.05)
(6.57 ± 0.04)
(7.01 ± 0.02)
0.8 ± 0.2
1.0 ± 0.1
1.6 ± 0.3
1.3 ± 0.2
IP2
3433
432
1077
624
(5.46 ± 0.09)
(6.37 ± 0.04)
(5.97 ± 0.09)
(6.21 ± 0.06)
0.8 ± 0.1
0.8 ± 0.1
1.1 ± 0.3
1.2 ± 0.4
AdA
3.44
0.31
9.48
149
(8.46 ± 0.11)
(9.51 ± 0.03)
(8.02 ± 0.09)
(6.83 ± 0.04)
1.3 ± 0.2
1.3 ± 0.3
1.3 ± 0.6
1.5 ± 0.2
2′-dephospho-AdA
77.2
8.82
26.4
308
(7.11 ± 0.08)
(8.05 ± 0.12)
(7.58 ± 0.06)
(6.51 ± 0.08)
0.9 ± 0.4
0.8 ± 0.1
1.1 ± 0.3
1.8 ± 0.7
From equilibrium-competition binding assays, the Kd, pKd and Hill coefficient (nHill) for each ligand are shown for the NT, IBC, IBCR568Q and IBCR504Q fragments of IP3R1 in CLM. Results are means (Kd) or means ± SEM (pKd and nHill) from 3–6 independent experiments.
From experiments similar to those shown in Figures 2B, 3E and 4F, Ca2+ release was measured in DT40 cells expressing only the indicated mutant IP3R. Results show the pEC50, EC50, nHill and the maximal Ca2+ release evoked by each agonist. Results are presented as means (EC50) or means ± SEM (pEC50,nHill and percentage Ca2+ release) from 4–6 independent experiments, each with three determinations.
Binding of IP3, AdA and their analogues to the NT fragment of IP3R1 and its mutants assayed in TEMFrom equilibrium-competition binding assays, the Kd, pKd and Hill coefficients (nHill) values for each ligand are shown for the NT and NT mutants of IP3R1 measured in TEM. Parallel experiments with mutant NT fragments in CLM were not practicable because of the low affinity of the interactions. Results are means (Kd) or means ± SEM (pKd and nHill) from 4–14 independent experiments.AdA, adenophostin A; CLM, cytosol-like medium; IP2, inositol 4,5-bisphosphate; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; Kd, equilibrium dissociation constant; ND, not determined; nHill, Hill coefficient; NT, N-terminal; TEM, Tris/EDTA medium.Binding of IP3, AdA and their dephospho analogues to the NT, IBC and IBC mutants assayed in CLMFrom equilibrium-competition binding assays, the Kd, pKd and Hill coefficient (nHill) for each ligand are shown for the NT, IBC, IBCR568Q and IBCR504Q fragments of IP3R1 in CLM. Results are means (Kd) or means ± SEM (pKd and nHill) from 3–6 independent experiments.AdA, adenophostin A; CLM, cytosol-like medium; IBC, IP3-binding core; IP2, inositol 4,5-bisphosphate; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; Kd, equilibrium dissociation constant; nHill, Hill coefficient; NT, N-terminal.These results, which establish that the IBC includes the structural determinants for high-affinity binding of AdA, provide our justification for using the IBC in subsequent experiments to explore the structural determinants of AdA binding. With the exception of Gly-268, the residues within the IBC that coordinate IP3 are conserved between all three IP3R subtypes (Bosanac ), and the IBC from each subtype binds IP3 with the same affinity (Iwai ). This, together with evidence that AdA is more potent than IP3 in cells that predominantly express each IP3 receptor subtype (Rossi ), suggests that the results obtained from our subsequent analysis of IP3R1 and the IBC from IP3R1 are probably applicable also to IP3R2 and IP3R3.
The 2′-phosphate is not responsible for high-affinity binding of AdA
The suggestion that the 2′-phosphate of AdA provides a supra-optimal mimic of the 1-phosphate of IP3 (Takahashi ; Wilcox ; Hotoda ) predicts that removal of each phosphate moiety should more profoundly reduce the affinity of AdA for IP3R relative to IP3. We tested this prediction using synthetic IP2 and 2′-dephospho-AdA (Figure 1B). In equilibrium-competition binding analyses with full-length IP3R1 (in TEM), IP2 bound with 282-fold lower affinity than IP3 (ΔpKd= 2.45 ± 0.10), whereas loss of the 2′-phosphate from AdA caused only a 41-fold decrease in affinity (ΔpKd= 1.61 ± 0.11) (Figure 2A, Table 1 and Table S1). For the IBC in CLM, removal of the critical phosphate also more substantially reduced the affinity for IP3 relative to AdA: IP3 bound with 60-fold higher affinity than IP2 (ΔpKd= 1.78 ± 0.08), whereas the affinities of 2′-dephospho-AdA and AdA differed by only 29-fold (ΔpKd= 1.46 ± 0.12) (Figure 2D, Table 3 and Table S1). Similar results were obtained with the NT in TEM and CLM (Figure 2C and E, Tables 2 and 3 and Table S1). In Ca2+ release assays, and consistent with the binding analyses, removal of the 1-phosphate from IP3 more substantially reduced its potency than did removal of the 2′-phosphate from AdA (Figure 2B, Table 1 and Table S1). A previous study suggested that loss of the 2′-phosphate of AdA more profoundly affected the Kd (Takahashi ). However, as stated above, the authors miscalculated the Kd from the IC50, and it is impossible from the data presented to estimate the correct Kd for 2′-dephospho-AdA. We note, although it is unclear whether it contributes to their reported low affinity of 2′-dephospho-AdA for IP3R, that these authors used 2′-dephospho-AdA produced enzymatically rather than by synthesis (Takahashi ).It is noteworthy that the disparity between the affinities of IP3 and AdA and their dephospho analogues was exaggerated in TEM (Figure 2G). We have not further explored the more pronounced effect of TEM on binding of AdA and IP3 relative to 2′-dephospho-AdA and IP2 (Table 2). The high pH of TEM favours substantial deprotonation of the phosphate groups in all the ligands (Felemez ), perhaps thereby enhancing their binding to the IBC. The larger effect of TEM on binding of the trisphosphate ligands (IP3 and AdA) may reflect a greater effect of the different media (pH, ionic strength, counter-ions) on the ionization states of these ligands relative to the bisphosphate ligands. The results do, however, highlight the necessity to examine ligand binding to IP3R in medium resembling that used for functional analyses (e.g. CLM) if the functional and binding analyses are to be compared reliably.Our demonstration that removal of the 1-phosphate from IP3 reduces both affinity and potency significantly more than does removal of the 2′-phosphate from AdA (Figure 2G) is inconsistent with the notion that the high affinity of AdA results from its 2′-phosphate providing a supra-optimal mimic of the 1-phosphate of IP3 (Takahashi ).
Contributions of R568 to AdA and IP3 binding
R568 within the α-domain of the IBC is the only residue to interact directly with the 1-phosphate of IP3, and it does so via two H-bonds with its side chain (Figure 1A) (Bosanac ). We mutated R568 to Q and examined IP3 and AdA binding to the mutant IBC, and Ca2+ release via the mutant full-length IP3R.The affinities of IP3 and AdA for the IBC were similarly reduced (by 37-fold and 31-fold respectively) by the R568Q mutation (ΔpKd= 1.57 ± 0.07 for IP3, and 1.49 ± 0.11 for AdA), whereas the affinities of IP2 and 2′-dephospho-AdA were minimally affected (ΔpKd= 0.40 ± 0.14 and 0.48 ± 0.12 for IP2 and 2′-dephospho-AdA respectively) (Figure 3A and B, Table 3, Table S2). Similar results were obtained with NTR568Q in TEM (Figure 3C, Table 2). These results suggest that R568 recognizes the 1-phosphate of IP3 and the 2′-phosphate of AdA similarly, and so lends further support to the view that the latter at least partially mimics the 1-phosphate of IP3 (Figure 1B). But why, if IP3 and AdA interact similarly with R568, should removal of the 1-phosphate from IP3 increase its Kd more than does removal of the 2′-phosphate from AdA (Tables 1 and 2)? A likely explanation is that the indirect interaction of the 1-phosphate of IP3 with the backbone of K569 (Figure 1A) (Bosanac ) is stronger than the equivalent interaction with the 2′-phosphate of AdA. Unfortunately, mutagenesis using naturally occurring amino acids cannot be used to dissect the role of this backbone interaction. Introduction of a non-natural amino acid, for example replacing K569 with an α-hydroxyl acid residue to replace the backbone NH with O, might address the question (Yang ). But the nonsense suppression techniques required to insert the non-natural residue are not presently available to us.
Figure 3
R568 does not selectively enhance AdA binding. Equilibrium-competition binding to IBCR568Q using 3H-IP3 (1.5 nM) and the indicated ligands in CLM (A). Relative affinities (Kd) of ligands for the IBCR568Q and IBC (B). Equilibrium-competition binding to the NTR568Q using 3H-IP3 (1.5 nM) and the indicated ligands in TEM (C). Representative immunoblot (with anti-IP3R1 antibody, Ab1.5, top panel; and β-adaptin, bottom panel) for DT40-KO cells (KO) and DT40 cells expressing IP3R1 or the indicated mutants (105 cells per lane). Molecular weight markers (kDa) are shown. The blot is typical of six similar blots. IP3R expression (corrected for β-adaptin loading) is shown for each mutant relative to DT40-IP3R1 cells (%, means ± SEM) (D). Ca2+ release from permeabilized DT40-IP3R1R568Q cells evoked by the indicated ligands (E). Comparison of Ca2+ release for each ligand in normal and mutant IP3R1R568Q (F). Results are means ± SEM, n≥ 4. AdA, adenophostin A; CLM, cytosol-like medium; IBC, IP3-binding core; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; Kd, equilibrium dissociation constant; NT, N-terminal; TEM, Tris/EDTA medium.
R568 does not selectively enhance AdA binding. Equilibrium-competition binding to IBCR568Q using 3H-IP3 (1.5 nM) and the indicated ligands in CLM (A). Relative affinities (Kd) of ligands for the IBCR568Q and IBC (B). Equilibrium-competition binding to the NTR568Q using 3H-IP3 (1.5 nM) and the indicated ligands in TEM (C). Representative immunoblot (with anti-IP3R1 antibody, Ab1.5, top panel; and β-adaptin, bottom panel) for DT40-KO cells (KO) and DT40 cells expressing IP3R1 or the indicated mutants (105 cells per lane). Molecular weight markers (kDa) are shown. The blot is typical of six similar blots. IP3R expression (corrected for β-adaptin loading) is shown for each mutant relative to DT40-IP3R1 cells (%, means ± SEM) (D). Ca2+ release from permeabilized DT40-IP3R1R568Q cells evoked by the indicated ligands (E). Comparison of Ca2+ release for each ligand in normal and mutant IP3R1R568Q (F). Results are means ± SEM, n≥ 4. AdA, adenophostin A; CLM, cytosol-like medium; IBC, IP3-binding core; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; Kd, equilibrium dissociation constant; NT, N-terminal; TEM, Tris/EDTA medium.Functional assays of DT40 cells expressing mutant IP3R do not allow absolute sensitivities to agonists or the size of the agonist-sensitive Ca2+ pool to be precisely compared between cell lines because it is impossible to establish stable cell lines with identical levels of IP3R expression (Figure 3D). The problem is less severe than might have been anticipated because even a substantial increase in IP3R expression in DT40 cells (>20-fold) caused the sensitivity to IP3 to increase by less than twofold (Dellis ). The mutations we have studied caused much larger changes in IP3 sensitivity (∼30-fold, Table 4). Furthermore, levels of IP3R expression in the stable DT40 cell lines expressing mutant IP3R differed by no more than 3.5-fold from the line expressing wild-type IP3R1 (Figure 3D).Functional responses of mutant IP3R1From experiments similar to those shown in Figures 2B, 3E and 4F, Ca2+ release was measured in DT40 cells expressing only the indicated mutant IP3R. Results show the pEC50, EC50, nHill and the maximal Ca2+ release evoked by each agonist. Results are presented as means (EC50) or means ± SEM (pEC50,nHill and percentage Ca2+ release) from 4–6 independent experiments, each with three determinations.
Figure 4
Selective interaction of AdA with R504. Model of AdA binding to the IBC highlighting a possible cation-π interaction between the adenine ring of AdA and R504 of the IBC (Rosenberg ) (A). Equilibrium-competition binding to IBCR504Q using 3H-IP3 (3 nM) and the indicated ligands in CLM (B). Comparison of the binding of each ligand to normal and mutant IBC (C). Equilibrium-competition binding to NTR504Q using 3H-IP3 (1.5 nM) and the indicated ligands in TEM (D). Structure of the IBC (PDB 1N4K) highlighting the likely interactions of R504 with the phosphate groups of IP3 (see text for further details). The red spheres represent water (E). Ca2+ release from permeabilized IP3R1R504Q cells evoked by the indicated ligands (F). Comparison of Ca2+ release for each ligand via normal and mutant IP3R (G). Results (B–D and F–G) are means ± SEM, n≥ 4. AdA, adenophostin A; CLM, cytosol-like medium; IBC, IP3-binding core; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; NT, N-terminal; TEM, Tris/EDTA medium.
AdA, adenophostin A; IP2, inositol 4,5-bisphosphate; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; nHill, Hill coefficient.In functional assays, using DT40 cells expressing only IP3R1R568Q, IP3 and AdA were less potent than in cells expressing wild-type IP3R1: the potencies of IP3 and AdA were reduced by 31-fold (ΔpEC50= 1.50 ± 0.06) and sixfold (ΔpEC50= 0.81 ± 0.07) respectively. By contrast, the potencies of IP2 and 2′-dephospho-AdA were only very modestly reduced (1.6-fold, ΔpEC50= 0.21 ± 0.11 for both ligands) (Figure 3E and F, Table 4 and Table S3). The lesser Ca2+ release with maximally effective concentrations of all four agonists in DT40-IP3RR568Q cells (compare Figures 2B and 3E) is probably attributable to the reduced level of expression of IP3R in the mutant cell line (Figure 3D). The selective effect of the R568Q mutation on AdA and IP3, but not the dephospho analogues, is consistent with our analyses of ligand binding (Table 3). But the significantly lesser effect of the mutation on the functional responses to AdA was unexpected because hitherto the interactions between R568 have appeared similar for the 1-phosphate of IP3 and the 2′-phosphate of AdA. These results suggest that disruption of the interaction between R568 and the critical phosphates may selectively reduce the efficacy of IP3. That conclusion would be consistent with evidence that inositol 2,4,5-trisphosphate is a partial agonist of IP3R (Marchant ).
Selective interaction of AdA with R504
Our previous attempts to predict the binding mode of AdA to the IBC using molecular docking suggested that, in addition to possible interactions with R568, the 2′-phosphate might also interact with the amide NH of K569 and the side chain of R504 (Rosenberg ). But our present results (Figure 2) suggest that for AdA, the 2′-phosphate is not a major determinant of its high affinity. One of the possible binding modes also suggested a cation-π interaction between the adenine of AdA and the guanidinium side chain of R504 (Rosenberg ) (Figure 4A). Many analyses of synthetic AdA analogues lacking the adenine moiety suggest that the adenine or another aromatic moiety is an important determinant of the high-affinity binding of AdA. The AdA analogues lacking adenine, which retain a phosphate group equivalent to the 2′-phosphate of AdA, typically have Kd values similar to that for IP3 (Table 2) (Jenkins ; Tatani ; Hotoda ; Marwood ; Correa ). R504 is one of several residues to form a hydrogen bond with the 5-phosphate of IP3, via a bridging water molecule (Bosanac ), and probably also with the equivalent 3"-phosphate of AdA (Rosenberg ) (Figure 1B). Mutation of R504 inhibits IP3 binding (Yoshikawa ) and is likewise expected to disrupt interaction of the 3"-phosphate of AdA. But if the proposed cation-π interaction is important for AdA binding, mutation of R504 might additionally reduce AdA binding by disrupting interactions with its adenine ring. The subsequent experiments were designed to test this hypothesis.Selective interaction of AdA with R504. Model of AdA binding to the IBC highlighting a possible cation-π interaction between the adenine ring of AdA and R504 of the IBC (Rosenberg ) (A). Equilibrium-competition binding to IBCR504Q using 3H-IP3 (3 nM) and the indicated ligands in CLM (B). Comparison of the binding of each ligand to normal and mutant IBC (C). Equilibrium-competition binding to NTR504Q using 3H-IP3 (1.5 nM) and the indicated ligands in TEM (D). Structure of the IBC (PDB 1N4K) highlighting the likely interactions of R504 with the phosphate groups of IP3 (see text for further details). The red spheres represent water (E). Ca2+ release from permeabilized IP3R1R504Q cells evoked by the indicated ligands (F). Comparison of Ca2+ release for each ligand via normal and mutant IP3R (G). Results (B–D and F–G) are means ± SEM, n≥ 4. AdA, adenophostin A; CLM, cytosol-like medium; IBC, IP3-binding core; IP3, inositol 1,4,5-trisphosphate; IP3R, IP3 receptor; NT, N-terminal; TEM, Tris/EDTA medium.As expected, because each ligand has a phosphate equivalent to the 5-phosphate of IP3, mutation of R504 to Q significantly reduced the affinity of both IP3 and AdA for the IBC (Figure 4B and C, Table 3 and Table S3). However, whereas the affinity of IP3 was reduced by 13-fold (ΔpKd= 1.13 ± 0.06), the affinity of AdA was reduced by 353-fold (ΔpKd= 2.55 ± 0.05) (Figure 4B and C, Table 3 and Table S2). Binding of the dephospho analogues was less affected by the R504Q mutation: the decrease in affinity was 1.4-fold (pΔ= 0.16 ± 0.07) for IP2 and 35-fold (ΔpKd= 1.54 ± 0.14) for 2′-dephospho-AdA. Similar results were obtained with NTR504Q in TEM (Figure 4D, Table 2).A further prediction arising from our suggestion that a cation-π interaction involving R504 and the adenine moiety contributes to high-affinity binding of AdA is that adenophostin analogues lacking the adenine moiety should be less affected by mutation of R504. The results shown in Table 2 confirm this prediction for two such analogues, furanophostin and ribophostin (Figure 1B). Mutation of R504 to Q reduced the affinity of the NT for furanophostin by 44-fold (ΔpKd= 1.63 ± 0.10) and for ribophostin by 21-fold (ΔpKd= 1.33 ± 0.24).Comparison of the effects of the R504Q mutation on each pair of ligands (i.e. IP3 vs. AdA, and IP2 vs. dephospho-AdA) indicates that for each there was a 25-fold greater decrease in the affinity for the AdA analogues (Figure 4C, Table 3 and Table S2). But the lesser effects of the mutation on both dephospho analogues is intriguing because R504 has not been reported to interact with the 1-phosphate of IP3 (Bosanac ). However, close inspection of the crystal structure of the IP3-bound IBC also reveals a possible indirect interaction, via water, of R504 with the 1-phosphate (Figure 4E), although this was not discussed in the original report (Bosanac ). It is not clear whether a similar interaction could also exist for AdA, but the possibility that both IP3 and AdA interact with R504 via their 1- and 2′-phosphates, respectively, is appealing because it would explain the lesser effects of the R504Q mutation on the dephospho analogues (Figure 4C).Functional analyses with DT40 cells expressing IP3R1R504Q confirmed the results with binding. The sensitivity of the mutant IP3R1R504Q was significantly decreased for all ligands, although again the effect on the dephospho analogues was more modest than that on IP3 and AdA (Figure 4F and G, Table 4 and Table S3). Most importantly, whereas the EC50 for IP3 was reduced by 23-fold (ΔpEC50= 1.35 ± 0.17), that for AdA was reduced by 196-fold (ΔpEC50= 2.29 ± 0.06). These ΔpEC50 values for IP3 and AdA are significantly different. Together, the binding and functional analyses establish that R504 is more important for binding of AdA than for IP3. The selective effect of R504 on AdA binding does not result from interaction with the 2′-phosphate of AdA, but is instead likely to reflect the contribution of a cation-π interaction between the adenine of AdA and the guanidinium side chain of R504 (Figure 4A).
Discussion
Inositol 1,4,5-trisphosphate and AdA are full agonists of IP3R (Rossi ), but the latter binds with substantially greater affinity than does IP3 (Takahashi ; Correa ) (Figure 2F). We have established that the IBC, to which IP3 binds to initiate activation of the IP3R, is alone capable of binding AdA with ∼20-fold greater affinity than IP3 (Table 3). Presently available evidence suggests that once AdA or IP3 has bound to the IBC, each causes indistinguishable activation of the IP3R (Rossi ). The increased potency of AdA, relative to IP3, in evoking Ca2+ release via IP3R is therefore likely to be entirely attributable to the stronger interactions between AdA and the IBC. This conclusion provided the impetus for resolving the interactions between AdA and the IBC that mediate its high-affinity binding.The 4"- and 3"-phosphates of AdA mimic the essential 4,5-bisphosphate moiety of IP3 (Figure 1B) and the 2′-phosphate of AdA has been thought to at least partially mimic the 1-phosphate of IP3 (Takahashi ). None of our present results challenges this interpretation. Hitherto, an appealing explanation for the high affinity of AdA has been the suggestion that its 2′-phosphate is better placed than the 1-phosphate of IP3 to interact with residues in the IBC (Takahashi ; Wilcox ). Our results establish that this is not the basis of the high-affinity binding of AdA. First, removal of the 2′-phosphate from AdA has significantly less effect on its activity than does removal of the 1-phosphate from IP3 (Figure 2G, Tables 1–3 and Table S1). Second, mutation of R568, one of the key residues with which the 1-phosphate of IP3 interacts (Bosanac ), similarly reduces the affinity of the IP3R for IP3 and AdA, while minimally affecting binding of IP2 or 2′-dephospho-AdA (Figure 3A and B, Table 3 and Table S1). These results establish that the 2′-phosphate of AdA partially mimics the 1-phosphate of IP3, but the latter probably interacts more strongly with the backbone of K569. We conclude that the high affinity of AdA for IP3R does not result from its 2′-phosphate behaving as a supra-optimally positioned mimic of the 1-phosphate of IP3 (Figure 5).
Figure 5
Differential interactions of IP3 and AdA with the IBC. Interactions of the phosphate groups of IP3 with the residues mutated in this study are highlighted (Bosanac ). Predicted interactions of the phosphate groups of AdA with the same residues, and the proposed cation-π interaction between the adenine moiety and R504 are shown. AdA, adenophostin A; IBC, IP3-binding core; IP3, inositol 1,4,5-trisphosphate.
Differential interactions of IP3 and AdA with the IBC. Interactions of the phosphate groups of IP3 with the residues mutated in this study are highlighted (Bosanac ). Predicted interactions of the phosphate groups of AdA with the same residues, and the proposed cation-π interaction between the adenine moiety and R504 are shown. AdA, adenophostin A; IBC, IP3-binding core; IP3, inositol 1,4,5-trisphosphate.Considerable evidence suggests that the adenine group of AdA contributes significantly to its high-affinity binding (Tatani ; Hotoda ; Marwood ; Correa ; Rosenberg ) and our molecular modelling has suggested that this might result from a cation-π interaction between the adenine and the guanidinium side chain of R504 (Rosenberg ) (Figure 4A). Our present results are consistent with this suggestion. Because R504 interacts with the 5-phosphate of IP3 (Figure 1A) and, almost certainly, in similar fashion with the equivalent 3"-phosphate of AdA (Figures 1B and 5), mutation of this residue (R504Q) significantly decreased the affinity of the IP3R for both ligands. But more importantly, the effects, in both functional and binding assays, were significantly greater for AdA than for IP3 (Figure 4D and G, Tables 2–4, Tables S2 and S3). These results establish the greater importance of R504 for AdA binding, which would be consistent with AdA, but not IP3, forming a cation-π interaction with this residue (Figure 5). We conclude that the high affinity of AdA for IP3R is not due to its 2′-phosphate, and that AdA interacts more strongly than IP3 with R504, most likely reflecting a cation-π interaction between the adenine group and R504. This interaction may provide opportunities for synthesis of less polar ligands of IP3R (Sureshan ).
Authors: Kana M Sureshan; Melanie Trusselle; Stephen C Tovey; Colin W Taylor; Barry V L Potter Journal: J Org Chem Date: 2008-02-02 Impact factor: 4.354
Authors: Kana M Sureshan; Andrew M Riley; Mark P Thomas; Stephen C Tovey; Colin W Taylor; Barry V L Potter Journal: J Med Chem Date: 2012-02-08 Impact factor: 7.446
Authors: Amol M Vibhute; Poornenth Pushpanandan; Maria Varghese; Vera Koniecnzy; Colin W Taylor; Kana M Sureshan Journal: RSC Adv Date: 2016-09-05 Impact factor: 3.361
Authors: Guizhen Fan; Mariah R Baker; Zhao Wang; Alexander B Seryshev; Steven J Ludtke; Matthew L Baker; Irina I Serysheva Journal: Cell Res Date: 2018-11-23 Impact factor: 25.617
Authors: Huma Saleem; Stephen C Tovey; Taufiq Rahman; Andrew M Riley; Barry V L Potter; Colin W Taylor Journal: PLoS One Date: 2013-01-25 Impact factor: 3.240