Literature DB >> 20883686

Wnt/β-catenin signaling in the dental mesenchyme regulates incisor development by regulating Bmp4.

Sayumi Fujimori1, Hermann Novak, Martina Weissenböck, Maria Jussila, Alexandre Gonçalves, Rolf Zeller, Jenna Galloway, Irma Thesleff, Christine Hartmann.   

Abstract

Loss- and gain-of function approaches modulating canonical Wnt/β-catenin activity have established a role for the Wnt/β-catenin pathway during tooth development. Here we show that Wnt/β-catenin signaling is required in the dental mesenchyme for normal incisor development, as locally restricted genetic inactivation of β-catenin results in a splitting of the incisor placode, giving rise to two incisors. Molecularly this is first associated with down-regulation of Bmp4 and subsequent splitting of the Shh domain at a subsequent stage. The latter phenotype can be mimicked by ectopic application of the BMP antagonist Noggin. Conditional genetic inactivation of Bmp4 in the mesenchyme reveals that mesenchymal BMP4 activity is required for maintenance of Shh expression in the dental ectoderm. Taken together our results indicate that β-catenin together with Lef1 and Tcf1 are required to activate Bmp4 expression in order to maintain Shh expression in the dental ectoderm. This provides a mechanism whereby the number of incisors arising from one placode can be varied through local alterations of a mesenchymal signaling circuit involving β-catenin, Lef1, Tcf1 and Bmp4.
Copyright © 2010 Elsevier Inc. All rights reserved.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20883686      PMCID: PMC2997430          DOI: 10.1016/j.ydbio.2010.09.009

Source DB:  PubMed          Journal:  Dev Biol        ISSN: 0012-1606            Impact factor:   3.582


Introduction

The dentition of mice is highly reduced, with only one incisor separated by a diastema region from three molars in each quadrant. The first sign of mammalian tooth development for both type of teeth, molars and incisors, is a thickening of the oral epithelium in the tooth area around embryonic day (E) 11. Molar and incisor developments are in principle similar, but differ slightly in developmental timing and with respect to gene expression. Tooth development requires sequential and reciprocal interactions between the dental epithelium and dental mesenchyme mediated by different signaling pathways (Caton and Tucker, 2009). The thickened dental epithelium expresses growth factors such as the Fibroblast growth factor 8 (Fgf8) and Sonic hedgehog (Shh). Concurrent with its thickening the proliferating epithelium invaginates into the underlying mesenchyme. The mesenchyme condenses around the invaginated epithelium, resulting in the formation of a dental bud stage around E12.5 (bud stage) in the incisor region. Subsequently, the invaginating epithelium extends farther into the mesenchyme and in response to mesenchymal signals, such as bone morphogenetic protein-4 (BMP4), the enamel knot, a non-proliferating transient epithelial structure, appears at the cap stage (around E13.5 for the incisor). Mesenchymal Bmp4 expression is regulated by transcription factors such as Msx1 and Pax9 (Chen et al., 1996; Ogawa et al., 2006). Amongst other molecules the enamel knot expresses Shh and Fgf4 and serves as a signaling center that regulates dental papilla formation in the adjacent mesenchyme and proliferation of the remaining dental epithelium (Thesleff and Jernvall, 1997). The epithelium extends further by differential proliferation and forms a bell shaped structure enclosing the mesenchyme (bell stage; ≥ E16 for the incisor). During the bell stage, epithelial cells adjacent to the mesenchyme differentiate further into enamel-producing ameloblasts and the mesenchymal cells into dentin-producing odontoblasts. Previous studies provided evidence for a key role for the Wnt/β-catenin pathway in the dental epithelium during tooth morphogenesis. The pathway is activated by binding of a Wnt-ligand to a receptor complex composed out of a frizzled family member and LDL receptor related protein (Lrp5/6), which leads to the inhibition of a cytoplasmic destruction complex containing the Adenomatosis polyposis coli (APC), Axin and GSK3 kinase proteins. Thus cytosolic β-catenin accumulates and translocates to the nucleus where it assembles into a transcriptional activating complex with members of the Tcf/Lef transcription factor family (Logan and Nusse, 2004). Loss of Lef1, which is expressed in the dental mesenchyme and epithelium causes arrest of tooth development at the bud stage (van Genderen et al., 1994) and tissue recombination experiments showed that Lef1 activity is required in the dental epithelium to regulate Fgf4 expression and cell survival (Kratochwil et al., 2002; Sasaki et al., 2005). Constitutive activation of the Wnt/β-catenin pathway in the oral epithelium results in the formation of ectopic invaginations, giving rise to ectopic teeth (Jarvinen et al., 2006; Kuraguchi et al., 2006; Liu et al., 2008; Wang et al., 2009). A similar but less severe phenotype is observed when Lef1 is overexpressed in the oral epithelium (Zhou et al., 1995). Inhibition of the Wnt/β-catenin pathway by overexpression of the secreted inhibitor Dickkopf 1 (Dkk1) in the oral epithelium results in an early arrest of tooth development (Andl et al., 2002; Liu et al., 2008). Genetic deletion of β-catenin in the oral epithelium results in a similar albeit less severe phenotype (Liu et al., 2008). Until recently, most of the published experimental approaches, with the exception of inhibiting the pathway by Dkk1 overexpression, which may also affect the dental mesenchyme, demonstrated a role for Wnt/β-catenin in the dental epithelium and not in the mesenchyme during tooth development. Direct evidence for a role of the canonical Wnt-pathway in the mesenchyme, was for the first time provided through conditional inactivation of β-catenin in the dental mesenchyme, which lead to an arrest of molar development at the cap stage (Chen et al., 2009). Here we investigated the requirement for Wnt/β-catenin signaling in the incisor mesenchyme using a conditional approach and showed that locally restricted loss of β-catenin from the mandibular incisor region results in the formation of double incisors. Molecular analysis revealed that β-catenin is required in the mesenchyme to positively regulate Bmp4 expression. This occurs independent of Msx1 and is directly mediated by the activity of Tcf/Lef transcription factors. Furthermore, we provide in vitro and genetic in vivo evidence that mesenchymal BMP4 activity is required to maintain Shh expression in the overlying dental epithelium. Thus our results show that mesenchymal activity of β-catenin is required for incisor development and indicate that incisor numbers can be altered through local modulation of β-catenin activity.

Materials and methods

Animals and preparation of embryonic tissues

The transgenic mouse lines for β-catenin, β-cat (conditional allele) and β-cat (null allele), Bmp4, Bmp4 (null allele), Bmp4 (hypomorphic conditional allele) and Bmp4 (conditional allele), Lef1− (null allele), Tcf1− (null allele) and Prx1-Cre used in this study have been described earlier and genotyping was performed accordingly (Benazet et al., 2009; Chang et al., 2008; Galceran et al., 1999; Huelsken et al., 2000, 2001; Logan et al., 2002). Intercrosses to generate the mutants were done as described previously (Benazet et al., 2009; Galceran et al., 1999; Hill et al., 2005). Bmp4 mutants were generated taking advantage of the germ line activity of Prx1-Cre females through intercrosses of Prx1-Cre females with Bmp4 males. From the offspring Bmp4;Prx1Cre males were crossed with Bmp4 females to generate the desired mutants. Embryos were staged according to morphological criteria; plug date was considered to be E0.5. Whole heads or lower jaws were dissected in PBS, fixed in 4% paraformaldehyde, dehydrated with methanol and ethanol for whole mount and paraffin section in situ hybridizations, respectively. All mouse experiments were performed in accordance with local and institutional regulations and licenses.

Cre recombinase and Wnt activity detection

For the detection of Cre recombinase Prx1-Cre mice were crossed with Z/AP mice (Lobe et al., 1999) and stained for alkaline phosphatase (Hill et al., 2005). For the detection of Wnt activity in E11.5–E13.5 mandibles, heads from BAT-gal (Maretto et al., 2003), TOP-gal (DasGupta and Fuchs, 1999) and Axin2-lacZ (Lustig et al., 2002) mice were dissected and fixed in 2% paraformaldehyde/0.2% glutaraldehyde in PBS and stained in X-gal solution for 20 h to detect β-galactosidase activity as previously described (Jarvinen et al., 2006).

Skeletal preparations, in situ hybridizations and immunohistochemistry

Heads of newborns (P0) embryos were skinned, fixed in 95% ethanol and stained with alizarin red and Alcian blue (McLeod, 1980). Whole mount (on dissected mandibles) and section (5 μm paraffin-sections) in situ hybridizations were performed as described (Murtaugh et al., 1999; Riddle et al., 1993). Double-color and double fluorescence in situ hybridization on serial paraffin sections were performed using Digoxigenin (DIG) and Fluorescein (Flu) and Biotin and DIG labeled probes, respectively, as described previously (Brent et al., 2003; Tylzanowski et al., 2003). All probes used are available upon request. Immunohistochemistry was performed on paraffin sections using anti-β-catenin mAb (BD Transduction Laboratories, 1:200) as described (Spater et al., 2006). Ki67 (Novocastra, 1:1000) and Caspase-3 (Cell signaling, 1:100) immunohistochemistry was performed using the automated Discovery XT system (Ventana Medical Systems).

Tissue recombination experiments and kidney capsule transplantation

Incisor anlagen from E12.5 mandible of WT and β-cat mice were dissected in Dulbecco's PBS (pH 7.4) under a stereomicroscope. Dental epithelium and mesenchyme were separated after incubation in a 2.25% Trypsin (Sigma)/0.25% Pancreatin (Sigma)/Tyrode's solution (pH 7.4) for 2 min at room temperature, followed by incubation in DMEM/10% FCS (Autogen Bioclear) to stop Protease digestion. Given that it has been shown that excessive removal of dental mesenchyme can affect incisor number (Munne et al., 2009), we took care not to remove any dental mesenchyme. Separated β-cat mesenchyme was inoculated with 1 × 1010 pfu/ml Adeno-GFP or Adeno-Cre each (Gene transfer vector core, University of Iowa) in DMEM/10% FCS for 1 h at 37 °C in 5% CO2. β-cat adenovirus-infected mesenchyme recombined with uninfected wild-type epithelium in the right orientation on Nuclepore filters, and cultured on metal grids at 37 °C in 5% CO2. After 1 day in culture, the recombined samples were transplanted under the kidney capsule of anesthetized immuno-compromised mice. The cut was sutured and after 3 weeks the mouse was killed, and the kidneys were carefully removed.

Bead implantations

Implantation of NOGGIN and BSA coated beads were performed by following published protocol (Vainio et al., 1993). Affi-Gel blue agarose beads (Bio Rad) were incubated in 100 ng/μl recombinant mouse Noggin (R&D) for 45 min at 37 °C. Heparin acrylic beads (Sigma) incubated for 45 min at 37 °C in PBS containing 0.1% BSA were used as controls. Control beads were implanted near the presumptive incisor regions in the left quadrant and NOGGIN beads in the right quadrant of dissected mandibular explants from WT E11.5 embryos. Explants were then placed on Nuclepore filters and cultured supported by metal grids in DMEM / 10% FCS. After 48 h the explants were fixed in 100% methanol for 5 min followed by an overnight fixation in 4% paraformaldehyde, and processed for whole-mount in situ hybridization.

Real-time PCR

For real-time PCR analysis, DNase I-treated total RNA (1 μg) was reverse transcribed using oligo (dT) to produce first-strand cDNA. Real-time PCR was performed using SYBR greenI nucleic acid gel stain (Roche) and TAKARA rTaq. Values were calculated using the relative standard method and normalized to mouse Hprt1 expression. Primers sets were tested by dilution series and products were analyzed by gel electrophoresis and melting curves. cDNA were amplified using the following primer pairs: Bmp4: sense, CGTTACCTCAAGGGAGTGGA and anti-sense ATGCTTGGGACTACGTTTGG; Bmp7: sense, TACGTCAGCTTCCGAGACCT and anti-sense, GGTGGCGTTCATGTAGGAGT; Hprt1: sense, AGCTACTGTAATGATCAGTCAACG, and anti-sense, AGAGGTCCTTTTCACCAGCA.

Luciferase promoter studies

The mouse Bmp4 reporter plasmids were constructed by cloning the −3000/+120 fragment (3 kb) and the −4820/+120 fragment (4.8 kb) of the mouse Bmp4 genomic region into the pGL3-Basic luciferase vector (Promega). HEK293T cells (8 × 105 cells/well) were co-transfected with each reporter plasmid (0.5 μg) and a total of 2 μg DNA containing the respective concentrations of expression plasmids (kindly provided by H. Clevers) and pcDNA3.1 (Invitrogen) together with 0.05 μg of Renilla luciferase reporter plasmid pRL-CMV (Promega) using calcium phosphatase co-precipitation procedure. 24 h after transfection, firefly and Renilla luciferase activities were measured using the Dual-Glo luciferase assay system (Promega) following the manufacturer's protocol on a Synergy 2 Multi-Detection Microplate Reader (BioTek Instruments). Firefly activity was standardized against the Renilla luciferase control activity.

Results

Inactivation of β-catenin in the dental mesenchyme affects incisor number

Previous data have established important roles for Wnt/β-catenin signaling for tooth development in the dental epithelium and recently in the mesenchyme. In various Wnt-reporter mice such as Top-GAL, BAT-GAL and Axin2-lacZ mice reporter activity in the dental mesenchyme can first be detected in the incisor regions from E11.5 onwards (Supplementary Fig. 1A–C and data not shown), suggesting a potential role for Wnt/β-catenin signaling in the dental mesenchyme for incisor development. In order to delete β-catenin activity in the dental mesenchyme we used the Prx1-Cre line (Logan et al., 2002). Using the Z/AP reporter mouse we could show that Prx1-Cre has mosaic activity in the mesenchyme of the mandibular incisor region from E11.5 onwards, while we could not detect any activity in the molar region (Supplementary Fig. 1D–H). Skeletal preparations of P0 β-catenin conditional mutant heads derived from intercrosses of Prx1-Cre;β-cat males with homozygous β-cat females revealed in 5/12 β-cat mutants the presence of two incisors on one side of the mandible only, while 2/12 mutants had two incisors on both sides. In contrast, wild-type embryos have only one incisor per mandibular half (Fig. 1A, and data not shown). H&E staining of sagittal and frontal sections of E18.5 β-cat heads showed that the two incisors developed on top of each other (Fig. 1B, C). In addition, we noticed that the incisors in the mutants were shorter and showed altered ameloblast distribution (Fig. 1B and Supplementary Fig. 2). The observed shortening of the incisors is probably a secondary event and due to the presence of ectopic cartilage (asterisks in Fig. 1B, C). Formation of ectopic cartilage primarily occurred within the bone region and is probably due to a differentiation of chondrocytes instead of osteoblasts as previously reported in the limbs and skulls of conditional β-catenin mutants (Day et al., 2005; Hill et al., 2005). The first clear morphological differences with regard to incisor development were observed as early as E13.5 (n = 3/6, Fig. 1D), while at E12.5 and E11.5 the incisors in mutants resembled those of wild-types (n = 3, Fig. 1E, and data not shown).
Fig. 1

Deletion of β-catenin in the dental mesenchyme increases the number of incisors. (A) Skeletal preparation of WT and β-cat newborn (P0) showing one half of a mandibular jaw. Note the double incisors at the distal tip (indicated by arrows) in the β-cat mutant compared to the one incisor in the wild-type jaw. (B–D) H&E stained sagittal (B) and frontal (C) sections of E18.5 heads, and frontal sections of E13.5 heads (D), showing the presence of double incisors and the early invagination of a second incisor anlage in β-cat mandibles. (E) Frontal sections of E12.5 heads, showing a similar appearance for the incisor anlage in β-cat and wild-type mandibles. Asterisk in B and C indicates formation of ectopic cartilage in β-cat mutants. White lines in (D, E) mark the boundaries between epithelium and mesenchyme.

To further support the in vivo observations by an independent experimental approach we performed the following in vitro experiments. Single incisor anlagen were dissected from E12.5 β-catfl/fl mandibles and the dental mesenchyme was infected with adenovirally expressed Cre-recombinase to inactivate the β-catenin gene. Subsequently, the partially infected, partly mutant mesenchyme was recombined with wild type E12.5 dental epithelium, cultured for 24 h, and then implanted into the kidney capsule and grown there for 3 weeks. The frequency in recovering incisors and not only bone in those in vitro experiments was very low, with incisors present in only 8/35 adeno-Cre treated and 5/34 adeno-GFP treated control recombinant explants. In 1/8 adeno-Cre treated cases two incisors instead of one developed from a single incisor anlage (Supplementary Fig. 2M). This was not observed in the control tissue recombination experiments (infected with adeno-GFP; n = 5). Thus, the preliminary result from the in vitro recombination experiment supports the in vivo genetic analysis (Fig. 1A–D), suggesting that local inactivation of β-catenin in the mesenchyme of the incisor anlage can lead to incisor duplication.

The loss of β-catenin alters Shh and Bmp4 expression

In order to identify the underlying molecular alterations we examined the expression of genes critical for tooth development such as Shh, Msx1, Msx2, Pax9, Axin2, Fgf3, Fgf8, Fgf9, Fgf10, and Bmp2, Bmp4, and Bmp7 in the incisor region. At E11.5, the distribution and levels of Fgf8 (n = 6), Shh (n = 5), Fgf9 (n = 5) and Fgf10 (n = 6) were not altered in the dental epithelium (Fig. 2A, B, and data not shown). The expression of mesenchymal genes such as Msx1 (n = 5), Msx2 (n = 6) and Pax9 (n = 6) expression domain were not noticeably altered (Fig. 2C, D, and data not shown). This was confirmed for Msx1 by section in situ analysis (data not shown). In contrast, Bmp4 expression appeared patchy in the mutant mesenchyme in comparison to the homogenous expression in wild-types (n = 5/5, Fig. 2E). A similar patchy down-regulation was observed for the bona fide Wnt target gene Axin2 (n = 3/4; Fig. 2F) and confirmed on sections by in situ hybridization (Supplementary Fig. 3B). The expression of other BMP family members, such as Bmp2 and Bmp7, which were expressed in the mandible at E11.5 in the epithelium or in the epithelium and mesenchyme, respectively, were not altered in β-catenin mutants (Supplementary Fig. 3C–E). Quantification of total transcript levels in the mandibular region by real-time PCR showed a significant reduction of Bmp4, but not Bmp7 expression (Supplementary Fig. 3F). From E12.5 onwards, the Shh expression domain appeared to be split into two small dots either bi- (n = 4/11) or unilaterally (n = 7/11) (Fig. 2G). The split in the Shh expression domain was confirmed by section in situ hybridization using frontal sections (n = 3/4, Fig. 3A, C). Hybridization of alternating sections to Bmp4 or using two-color in situ detection showed that Bmp4 is highly expressed in the mesenchyme directly underneath the Shh expression domain in wild-type controls (Fig. 3B, C, E). In mutants with a split Shh expression domain, two high level Bmp4 expression domains are apparent in conjunction with a slight reduction of the overall Bmp4 levels in the mandibular mesenchyme (Fig. 3B, C). Consistent with the whole mount in situ observations Msx1 was still expressed throughout the dental mandibular mesenchyme, including the region where Bmp4 was down-regulated (n = 2, Fig. 3D). We used double fluorescent section in situ hybridization to establish that Bmp4 expression was specifically lost from regions deficient in β-catenin (Fig. 3E–G). In contrast to what we had observed in the Z/AP reporter staining, recombination for the β-catenin locus was more restricted at E12.5, resulting in a patchy, mosaic loss of β-catenin expression (Fig. 3F). The epithelial and mesenchymal cells surrounding the split Shh expression domains were proliferating normally and no increase in cellular apoptosis was observed (Supplementary Fig. 4). Expression of Fgf10 was not altered at E13.5, while Fgf3 expression was reduced (data not shown). Thus the first change that we are able to detect in mutants lacking β-catenin in a mosaic manner in their mesenchyme was a mosaic down-regulation in expressions of Bmp4 and the bona fide Wnt/β-catenin target gene Axin2 in the dental mesenchyme.
Fig. 2

Alterations in gene expression in β-cat mutant mandibles at early stages of tooth development. (A–F) In situ hybridization showing the expression of Fgf8, Shh, Msx1, Pax9 and Bmp4 at E11.5 and (G) Shh at E12.5 in wild-type and β-cat mutant mandibles. No significant changes in the expression of Fgf8 (A), Shh (B), Msx1 (C), and Pax9 (D) were observed in β-cat mutant mandibles at E11.5. (E) Patchy expression of Bmp4 in β-cat mutant mandibles at E11.5. See also magnified region of the white-boxed area in the right corner. (F) Patchy expression of Axin2 in β-cat mutant mandibles at E11.5. See also magnified region of the white-boxed area in the right corner. (G) Split Shh expression domain in the incisor region of β-cat mandibles; in this case on both sides (indicated by arrowheads).

Fig. 3

Correlation between alterations in mesenchymal Bmp4 and epithelial Shh expression upon inactivation of mesenchymal β-catenin. (A–G) Frontal section showing incisor tooth buds at E12.5. (A, B) Alternating sections showing a split Shh expression domain on one side of the incisor region in the β-cat mutant mandibles (A) and a similar split in epithelial Bmp4 expression and overall reduction of its mesenchymal expression (B). (C) Two-color in situ hybridization for Shh (red) and Bmp4 (blue) in mandibular incisor buds at E12.5; note the high level mesenchymal Bmp4 expression domain directly abutting the epithelial Shh expression domain (red) in wild-types, which is split in two domains associated with a split Shh expression in the epithelium in the β-cat mutant incisor bud region. (D) Adjacent section showing that Msx1 expression in not down-regulated in the region lacking Bmp4. (E-G) Double fluorescent in situ hybridization for Bmp4 (red) and β-catenin (green) in the incisor bud of wild-type and β-cat at E12.5. Note that the loss-of Bmp4 expression in the area underneath the invaginating epithelium (red arrows in E) corresponds to the regions in which β-catenin expression has been inactivated in the dental mesenchyme (green arrows in F). (G) Merged images of (E, F). Right panel: higher magnification images, showing the areas where Bmp4 transcripts (red) are down-regulated (surrounded by the thin line; labeled 1, 2, 3 in the merged image) corresponding to areas showing deletion of β-catenin (green). Red lines in A and B, and white lines in E–G mark the boundary between epithelium and mesenchyme. Asterisks in the higher magnifications shown in the right panel mark holes in the tissue.

Alteration of BMP4 activity and expression affect Shh expression in the incisor

As down-regulation of Bmp4 expression in the dental mesenchyme of β-cat embryos seems to precede the alterations in Shh expression, we asked whether there is a causal connection. Therefore, BMP activity was inhibited in in vitro explant-cultures using the BMP antagonist NOGGIN. NOGGIN-soaked beads were implanted near the incisor region of wild-type E11.5 mandibles, which were then cultured for 48 h. In about 50% of all NOGGIN treated cultures, the Shh expression domain was split (8/15), associated with a down-regulation of Shh in 4/8 cases showing the split expression (Fig. 4A, and data not shown). Next we asked whether genetic inactivation of Bmp4 in dental mesenchyme would alter Shh expression. This was achieved by crossing females homozygous for the hypomorphic Bmp4 allele with males double-heterozygous for the Bmp4 null allele and the Prx1Cre transgene (Benazet et al., 2009). At E12.5 (n = 2) Shh was completely absent from the incisor and molar regions of mandibles of Bmp4 deficient (Bmp4) embryos, while its expression was unaffected in littermate controls (Fig. 4B). In contrast, Shh expression was only reduced and the two domains fused at the midline in the Bmp4 (Bmp4) deficient embryonic mandibles at E11.5 (n = 2; Fig. 4C). When we examined the efficiency of the Bmp4 deletion in Bmp4 mandibles at E11.5 using a Bmp4 probe detecting the deleted exon 4, it became apparent that Bmp4 expression was in general severely reduced but not completely lost (n = 2; Fig. 4D). Interestingly, when we looked at the expression of Msx1 in the Bmp4 mutants at E11.5, we did not observe a decrease in the expression levels (n = 2/2; Fig. 4E). As expected, Bmp4 expression was also reduced in the mandibles of Bmp4∆lacZ/hf embryos (n = 2/3), but Shh expression was not lost at E12.5 (n = 1; data not shown). At E14.5, either no (n = 1/3) or only weak Shh expression in one or two tiny spots was detected at the tip of Bmp4 mandibles (n = 2/3) (Fig. 4E). In contrast to the local reduction of Bmp4 expression in β-cat mandibles (Fig. 3C) the almost complete loss in Bmp4 embryos provides a feasible explanation for why Shh expression is lost in Bmp4 rather than being split. In addition, we examined Shh expression in Bmp4 mutants, in which a none-hypomorphic conditional allele of Bmp4 (Chang et al., 2008) had been deleted using the Prx1-Cre in the presence of a germ-line deleted Bmp4 allele. However, using this Bmp4 loss-of-function allele, only minimal changes in Bmp4 expression (n = 3/4) and no significant changes in Shh expression (n = 3) were observed in the mandibles (Supplementary Fig. 5). In contrast to the mandibles, mesenchymal Bmp4 expression is completely lost in the limb, but again we did not observe a loss of Msx1 expression (n = 2; Supplementary Fig. 5C, D). Taken together, this genetic analysis indicates that BMP4 activity is likely to be required for maintenance but not initiation of epithelial Shh expression. Furthermore, our genetic data suggest that Msx1 is not a Bmp4-dependent gene.
Fig. 4

Alterations in BMP4 activity affect Shh expression in the dental epithelium. (A) In situ detection of Shh expression in E11.5 mouse mandibular explants cultured for 48 h with BSA- (white) or NOGGIN- (blue) soaked beads. Note the split in the Shh expression domain on the side where the NOGGIN-soaked bead was implanted. The right panel shows a higher magnification of the incisor area (white box in the left panel). (B–E) Shh and Bmp4 expression in mandibles of Bmp4 mice. (B) Loss of Shh in molar and incisor regions in Bmp4 deficient mandibles at E12.5. (C) Down-regulation of Shh in the presumptive incisor and molar regions in Bmp4 mandible at E11.5. Note that the expression domains are fused at the mid-line. (D) Bmp4 expression, using an exon4 specific in situ hybridization probe, is almost completely lost in Bmp4 mutant mandibles at E11.5. (E) Msx1 expression pattern in E11.5 wild-type and Bmp4 mutant mandibles. Note Msx1 expression is not down-regulated in the Bmp4 mutant mandibles. (F) Presence of tiny Shh expression domains in the incisor and molar regions of Bmp4 mutant mandibles at E14.5.

Bmp4 is a direct target of a β-catenin–Tcf1–Lef1 complex

Since Msx1, which has been shown previously to be required for Bmp4 expression in the dental mesenchyme (Chen et al., 1996), was not affected by the loss of β-catenin activity, we determined whether Bmp4 is a transcriptional target of Wnt/β-catenin signaling in the dental mesenchyme. In silico analysis using the transfac database revealed that a 4.8 kb upstream region of the Bmp4 locus encodes approximately 33 putative TCF/LEF binding sites (Fig. 5A). Some of those binding sites are conserved between rat and mouse or rat, mouse and human based on a CLUSTALW analysis (indicated by one or two asterisks respectively, see Fig. 5A). Bmp4-reporter constructs encoding either the 4.8 kb up stream region or a shorter 3 kb region (containing approximately 21 potential TCF/LEF binding sites) were transactivated in luciferase assays upon co-transfection of expression plasmids for both Lef1 and β-catenin, Tcf1 and β-catenin or an expression plasmid encoding a TCF1-β-catenin fusion protein (Fig. 5B, and data not shown). Next, we determined whether Bmp4 expression is altered in the dental mesenchyme of Tcf1 and/or Lef1 mutant mandibles at E11.5. However, no significant difference in Bmp4 expression was observed in the incisor regions of Lef1−/− or Tcf1− embryos in comparison to controls at E11.5 (n = 3; Fig. 5C). In compound Tcf1;Lef1 mutant embryos (Tcf1−;Lef1 n = 5/6 and Tcf1;Lef1− n = 4/4) the overall expression of Bmp4 was slightly reduced (Fig. 5D), while Bmp4 expression was completely lost in Tcf1−:Lef1− mutant embryos at E11.5 (n = 2/2; Fig. 5D). Given the severity of the embryonic defects and the developmental retardation of the Tcf1/Lef1 double mutant embryos at E11.5 it is possible that the loss of Bmp4 is due to secondary effects. However, when we analyzed E9.5 double mutant embryos, which are fairly similar to wild-type and single mutant embryos, we could already at this stage observe a reduction in the Bmp4 expression in the mandibles of Tcf1−:Lef1− compared to littermate Tcf1−;Lef1 mutant embryos (Fig. 5E). At this stage a rudimentary forelimb was still present, which also showed reduced Bmp4 expression (data not shown).
Fig. 5

In vitro and in vivo regulation of Bmp4 expression by β-catenin in combination with Tcf/Lef family members. (A) Schematic overview over the −4.8 kb mouse Bmp4 promoter region indicates the location of putative Tcf/Lef binding sites (light blue). Sites conserved between human, rat and mouse are indicated by two red asterisks, those conserved between rat and mouse by one red asterisk. (B) Luciferase assay using the -3.0 kb Bmp4 promoter region in response to control, increasing levels of Lef1 and β-catenin, Tcf1 and β-catenin or a TCF1-β-catenin fusion expression constructs. Error bars represent the standard deviation (s.d.). (C) Bmp4 expression in mandibles of wild-type, Tcf1 and Lef1 single mutant embryos at E11.5. No obvious difference in Bmp4 expression was observed in Tcf1− and Lef1− single mutants. (D) Bmp4 expression in mandibles of Tcf1;Lef1 compound and double mutant embryos at E11.5. Bmp4 expression was reduced in the compound mutants and completely lost in embryos lacking both Tcf1 and Lef1. Higher magnifications of the boxed areas are shown in the upper right corners. (E) Bmp4 expression in the mandibles (Md) of Tcf1−;Lef1+/+ and Tcf1−;Lef1− mutant embryos (frontal view, upper row; lateral view, lower row) at E9.5. Arrowheads point at the Bmp4 expression domain.

Although all four Tcf/Lef family members are expressed in the dental mesenchyme at E11.5 (Supplementary Fig. 6), the almost complete absence of Bmp4 expression in Tcf1/Lef1 double mutants would suggest that Tcf1 and Lef1 are the primary transcriptional co-factors, which in a complex with β-catenin, regulate Bmp4 expression in the dental and possibly also in the limb mesenchyme.

Discussion

Mesenchymal β-catenin activity regulating Bmp4 is required for incisor development

Various ectodermal appendages including teeth depend on canonical Wnt/β-catenin signaling (Mikkola and Millar, 2006). Until recently it was thought that this pathway is primarily required in the dental epithelium during tooth development. This notion was supported by the finding that TCF/LEF reporters seem not to be active in the molar mesenchyme (Liu et al., 2008). However, here we show that there is activity of various Wnt-reporter mice in the early incisor mesenchyme of the lower jaw. Recently, the analysis of a conditional β-catenin mutant by Chen and colleagues established that β-catenin is required in the dental mesenchyme during tooth development (Chen et al., 2009). Their study showed that following β-catenin inactivation, molar and incisor formation arrests at bud stage but the underlying molecular alterations resulting in this arrest remained unknown. In contrast we show that sporadic deletion of β-catenin in the incisor mesenchyme of the lower jaw using the Prx1-Cre recombinase transgene resulted in a double-incisor phenotype in about 50% of all mutant embryos. Our molecular analysis revealed that in parallel to the onset of Prx1-Cre activity, gene expressions were altered starting around E11.5. In particular, mesenchymal Bmp4 and Axin2 expressions were down-regulated in a patchy manner as a likely first molecular alteration in the mosaic β-catenin deficient mesenchyme. The changes in Bmp4 expression appear to occur in an Msx1-independent manner and cell-autonomously, coinciding with the local loss of β-catenin. These cell-autonomous changes together with the Bmp4 promoter analysis suggest that Bmp4 might be a direct target of β-catenin/TCF/LEF mediated transcription in the dental mesenchyme. β-catenin has been shown to regulate Bmp4 in other tissues such as cancer cells, lung, limb and eye (Hill et al., 2006; Kim et al., 2002; Shu et al., 2005; Zhou et al., 2008). Consistent with our in vitro data, it has been shown previously that β-catenin can activate and bind to a 2.4-kb Bmp4 promoter region in vitro (Shu et al., 2005; Song et al., 2009). Based on the results from transgenic promoter studies this region is, however, not sufficient to drive expression in the primordial tooth anlage (Feng et al., 2002). Thus the more upstream located Tcf/Lef binding sites might be the ones, which regulate Bmp4 expression in the early tooth anlage. This needs to be demonstrated in the future by in vivo ChIP experiments and transgenic promoter studies. Nevertheless given that Bmp4 expression was reduced in mandibles of compound Tcf1/Lef1 mutants and lost in mandibles of double mutants supports our model that β-catenin, together with Tcf1 and Lef1, which are both expressed in the dental mesenchyme at E11.5, directly regulates Bmp4 expression in the dental mesenchyme (Fig. 6). So similar to what has been reported in the limb, Tcf1 and Lef1 seem to act redundantly in the mandibular mesenchyme (Galceran et al., 1999). Furthermore, our data establish that Tcf1 plays a functional, albeit redundant role in tooth development. Interestingly, Bmp4 has been shown to regulate Lef1 expression in the dental mesenchyme (Chen et al., 1996), thus establishing a positive feed-back loop (see model Fig. 6). In addition to the Bmp4 down-regulation, Shh expression in the overlying dental epithelium was altered in the conditional β-catenin mutant mandibles. Bmp4 has been previously implicated in regulating Shh and Bmp2 expression in the dental epithelium of the molars based on the analysis of Msx1 deficient mouse embryos and in vitro explant studies (Zhang et al., 2000). Alteration of BMP activity in mandibular explants by NOGGIN-bead implantation affects Shh expression in a manner similar to loss of mesenchymal β-catenin activity, which supports the notion that BMP activity is required to maintain Shh expression in the incisor region. In addition, it has been recently shown that treatment of incisor explants with NOGGIN resulted in splitting of the Shh expression domain and the development of to up to three incisors, dependent on the NOGGIN concentration (Munne et al., 2010). This further supports the idea that alteration of BMP-signaling influences Shh expression and incisor number. Importantly, genetic inactivation of Bmp4 in the dental mesenchyme establishes that it is the mesenchymal activity of BMP4, which is indeed required for the maintenance of Shh in the dental epithelium of molars and incisors, but not for its induction. Therefore, we hypothesize that the Shh expression domain splits only in those cases where the regions lacking Bmp4 expression in the mesenchyme were substantial and directly abutting the overlying epithelium (Fig. 6). The study by Zhang et al. (2000) reported that Bmp4 might also inhibit Shh expression at least at high concentrations in vitro. Thus, BMP4 in combination with other factors might regulate Shh expression differentially over time in a concentration-dependent manner, which might explain why residual Shh expression was detected in 2 out of 3 Bmp4 deficient embryos at E14.5. Alterations in the Shh expression domain might ultimately affect the invagination of dental epithelium, as loss of Shh at the early bud stage and inhibition of Shh activity at the epithelial thickening stage is known to alter growth and morphogenesis of teeth (Cobourne et al., 2001; Dassule et al., 2000). Furthermore, ectopic application of SHH protein to oral epithelium induces invagination of non-dental epithelium (Hardcastle et al., 1998). Thus the generation of a second Shh expressing center within the dental epithelium might be one of the key steps triggering the second invagination that causes the formation of a second incisor in β-cat mutant embryos.
Fig. 6

Model of the β-catenin/BMP4 circuit maintaining Shh expression in wild-type and β-catenin mutant incisor regions. (A) β-catenin in a transcriptional complex with Tcf1 and Lef1 activates the expression of Bmp4 (indicated by the light and dark orange domains) independently of Msx1 in the dental mesenchyme at stage E11.5. Mesenchymal BMP4 activity maintains continuous expression of Shh (indicated by the red domain) in the overlying dental epithelium and regulates Lef1 expression in the dental mesenchyme. (B) Local loss of β-catenin in the region of high Bmp4 expression (indicated in dark orange) results in a BMP4 deficient region, which fails to maintain Shh expression in the overlying dental epithelium, generating a gap within the Shh expressing placode. The split Shh expression domains will invaginate independently giving rise to two incisors in the adult.

These phenotypic and molecular alterations were not observed in the previous genetic analysis by Chen et al. (2009). This might be due to differences in the onset of Cre-recombinase activity in the mandibular region as at least for the Osr2-IresCre no recombinase activity was reported prior to E14.5 in incisor regions (Lan et al., 2007). On the other hand the deletion efficiency might vary between the different Cre-lines. In particular, we have observed that deletion of β-catenin in different β-cat mutant embryos was patchy and variable. This observation probably also explains why the penetrance of the double-incisor phenotype was not 100%. Similarly, only incomplete and patchy inactivation of β-catenin activity was achieved in the adenovirally infected mesenchymal explants, explaining probably why a double-incisor was only observed in one case.

Local alterations in the β-catenin/BMP4 circuits affect incisor number

Although adult mice have only one upper and lower incisor, mouse embryos still show a more ancestral pattern with about six vestigial incisor placodes in the upper and three in the lower half of the developing jaw (Peterkova et al., 2006). The entire epithelial area, comprising all placodes, folds normally into the mesenchyme, but is thought to form only one incisor through an incorporation process potentially due to the failure to form inhibitory zones (Peterkova et al., 2006). These inhibitory zones might be regulated by reaction–diffusion interactions of growth inhibitors and activators similar to Turing-type mechanisms, but may have been lost or became suppressed during rodent evolution (Peterkova et al., 2002; Turing, 1952). Recently it has been shown that the mesenchyme surrounding the incisor tooth germ has the capability to restrict tooth induction (Munne et al., 2009). This repressive potential of the mesenchyme is in part mediated by ectodin, which is encoded by the Sostdc1 gene (Munne et al., 2009). Ectodin, is related to Sclerostin and is known to modulate the Wnt-pathway and to potentially inhibit BMP-signaling (Itasaki et al., 2003; Laurikkala et al., 2003; Lintern et al., 2009). However, the timing and mode of supernumerary incisor formation in Sostdc1 mutants is distinct from the duplications observed following β-catenin inactivation (Munne et al., 2009; Murashima-Suginami et al., 2007). Thus, we propose that in addition to the inhibitory potential of the dental mesenchyme there is also an activatory potential, which β-catenin and BMP4 are part of. This mesenchymal activatory pathway maintains the expression of critical factors in the dental epithelium, such as Shh and the Bmp4 dependent cell cycle inhibitor p21 (Jernvall et al., 1998). A recent finding showed that treatment of mandibular explants with defined concentrations of the BMP antagonist Noggin leads to a destabilization of the large placode and the formation of two to three incisors (Munne et al., 2010). In agreement with these findings, our data suggest that local or non-uniform reduction of mesenchymal BMP activity due to the loss of β-catenin contributes to the formation of supernumerary incisors by splitting the signaling center, which results in the formation of two invaginations. Thus, a potential mechanism to alter incisor number would be to locally modulate β-catenin activity in the dental mesenchymal, thereby altering Bmp4 expression and subsequently epithelial Shh expression. An alternative explanation, for the observed phenotype might be that reduced Wnt/BMP4 signaling somehow affects survival/revitalization of the posterior incisor placode, which normally regresses around E13.5. This explanation is in agreement with earlier findings by Zhang and colleagues, which showed that high levels of BMP4 inhibit Shh expression in the molar and incisor region (Zhang et al., 2000). However, based on this alternative model one would have expected increased Shh expression upon reduction of BMP4 activity in the mesenchyme, which we did not observe.
  55 in total

1.  WNT signals are required for the initiation of hair follicle development.

Authors:  Thomas Andl; Seshamma T Reddy; Trivikram Gaddapara; Sarah E Millar
Journal:  Dev Cell       Date:  2002-05       Impact factor: 12.270

2.  Negative feedback loop of Wnt signaling through upregulation of conductin/axin2 in colorectal and liver tumors.

Authors:  Barbara Lustig; Boris Jerchow; Martin Sachs; Sigrid Weiler; Torsten Pietsch; Uwe Karsten; Marc van de Wetering; Hans Clevers; Peter M Schlag; Walter Birchmeier; Jürgen Behrens
Journal:  Mol Cell Biol       Date:  2002-02       Impact factor: 4.272

3.  Sonic hedgehog regulates epithelial proliferation and cell survival in the developing tooth germ.

Authors:  M T Cobourne; Z Hardcastle; P T Sharpe
Journal:  J Dent Res       Date:  2001-11       Impact factor: 6.116

4.  Identification of cis-DNA regions controlling Bmp4 expression during tooth morphogenesis in vivo.

Authors:  J Q Feng; J Zhang; X Tan; Y Lu; D Guo; S E Harris
Journal:  J Dent Res       Date:  2002-01       Impact factor: 6.116

5.  beta-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin.

Authors:  J Huelsken; R Vogel; B Erdmann; G Cotsarelis; W Birchmeier
Journal:  Cell       Date:  2001-05-18       Impact factor: 41.582

6.  Oncogenic beta-catenin is required for bone morphogenetic protein 4 expression in human cancer cells.

Authors:  Jung-Sik Kim; Heather Crooks; Tatiana Dracheva; Tagvor G Nishanian; Baljit Singh; Jin Jen; Todd Waldman
Journal:  Cancer Res       Date:  2002-05-15       Impact factor: 12.701

7.  LEF1 is a critical epithelial survival factor during tooth morphogenesis.

Authors:  Tomoyo Sasaki; Yoshihiro Ito; Xun Xu; Jun Han; Pablo Bringas; Takeyasu Maeda; Harold C Slavkin; Rudolf Grosschedl; Yang Chai
Journal:  Dev Biol       Date:  2005-02-01       Impact factor: 3.582

8.  Expression of Cre Recombinase in the developing mouse limb bud driven by a Prxl enhancer.

Authors:  Malcolm Logan; James F Martin; Andras Nagy; Corrinne Lobe; Eric N Olson; Clifford J Tabin
Journal:  Genesis       Date:  2002-06       Impact factor: 2.487

9.  Requirement for beta-catenin in anterior-posterior axis formation in mice.

Authors:  J Huelsken; R Vogel; V Brinkmann; B Erdmann; C Birchmeier; W Birchmeier
Journal:  J Cell Biol       Date:  2000-02-07       Impact factor: 10.539

10.  Sonic hedgehog regulates growth and morphogenesis of the tooth.

Authors:  H R Dassule; P Lewis; M Bei; R Maas; A P McMahon
Journal:  Development       Date:  2000-11       Impact factor: 6.868

View more
  38 in total

Review 1.  An inductive signalling network regulates mammalian tooth morphogenesis with implications for tooth regeneration.

Authors:  Z Li; M Yu; W Tian
Journal:  Cell Prolif       Date:  2013-08-17       Impact factor: 6.831

2.  Fibroblast growth factor signaling is essential for self-renewal of dental epithelial stem cells.

Authors:  Julia Yu Fong Chang; Cong Wang; Junchen Liu; Yanqing Huang; Chengliu Jin; Chaofeng Yang; Bo Hai; Fei Liu; Rena N D'Souza; Wallace L McKeehan; Fen Wang
Journal:  J Biol Chem       Date:  2013-08-26       Impact factor: 5.157

3.  FGF signaling sustains the odontogenic fate of dental mesenchyme by suppressing β-catenin signaling.

Authors:  Chao Liu; Shuping Gu; Cheng Sun; Wenduo Ye; Zhongchen Song; Yanding Zhang; YiPing Chen
Journal:  Development       Date:  2013-09-25       Impact factor: 6.868

4.  Persistent Wnt/β-catenin signaling in mouse epithelium induces the ectopic Dspp expression in cheek mesenchyme.

Authors:  Nan Zhou; Nan Li; Jing Liu; Yu Wang; Jun Gao; Yingzhang Wu; Xiaoyan Chen; Chao Liu; Jing Xiao
Journal:  Organogenesis       Date:  2018-12-20       Impact factor: 2.500

Review 5.  Epithelial - Mesenchymal Interactions in Tooth Development and the Significant Role of Growth Factors and Genes with Emphasis on Mesenchyme - A Review.

Authors:  Jaya Sekharan Vannadil Puthiyaveetil; Kasim Kota; Roopesh Chakkarayan; Jithesh Chakkarayan; Abdul Kabeer Padinhare Thodiyil
Journal:  J Clin Diagn Res       Date:  2016-09-01

6.  Inactivation of Fam20B in the dental epithelium of mice leads to supernumerary incisors.

Authors:  Ye Tian; Pan Ma; Chao Liu; Xiudong Yang; Derrick M Crawford; Wenjuan Yan; Ding Bai; Chunlin Qin; Xiaofang Wang
Journal:  Eur J Oral Sci       Date:  2015-10-14       Impact factor: 2.612

7.  Regulation of tooth number by fine-tuning levels of receptor-tyrosine kinase signaling.

Authors:  Cyril Charles; Maria Hovorakova; Youngwook Ahn; David B Lyons; Pauline Marangoni; Svatava Churava; Brian Biehs; Andrew Jheon; Hervé Lesot; Guive Balooch; Robb Krumlauf; Laurent Viriot; Renata Peterkova; Ophir D Klein
Journal:  Development       Date:  2011-09       Impact factor: 6.868

Review 8.  Advances of Wnt signalling pathway in dental development and potential clinical application.

Authors:  Xi Lu; Jun Yang; Shouliang Zhao; Shangfeng Liu
Journal:  Organogenesis       Date:  2019-09-04       Impact factor: 2.500

9.  Post-natal effect of overexpressed DKK1 on mandibular molar formation.

Authors:  X L Han; M Liu; A Voisey; Y S Ren; P Kurimoto; T Gao; L Tefera; P Dechow; H Z Ke; J Q Feng
Journal:  J Dent Res       Date:  2011-09-13       Impact factor: 6.116

10.  Intra-epithelial requirement of canonical Wnt signaling for tooth morphogenesis.

Authors:  XiaoJing Zhu; Pan Zhao; YuDong Liu; XiaoYun Zhang; Jiang Fu; H-M Ivy Yu; Mengsheng Qiu; YiPing Chen; Wei Hsu; Zunyi Zhang
Journal:  J Biol Chem       Date:  2013-03-24       Impact factor: 5.157

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.