Genes and pathways for CO2 fixation in the obligate, chemolithoautotrophic acidophile, Acidithiobacillus ferrooxidans, carbon fixation in A. ferrooxidans.

BACKGROUND: Acidithiobacillus ferrooxidans is chemolithoautotrophic γ-proteobacterium that thrives at extremely low pH (pH 1-2). Although a substantial amount of information is available regarding CO2 uptake and fixation in a variety of facultative autotrophs, less is known about the processes in obligate autotrophs, especially those living in extremely acidic conditions, prompting the present study.
RESULTS: Four gene clusters (termed cbb1-4) in the A. ferrooxidans genome are predicted to encode enzymes and structural proteins involved in carbon assimilation via the Calvin-Benson-Bassham (CBB) cycle including form I of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO, EC 4.1.1.39) and the CO2-concentrating carboxysomes. RT-PCR experiments demonstrated that each gene cluster is a single transcriptional unit and thus is an operon. Operon cbb1 is divergently transcribed from a gene, cbbR, encoding the LysR-type transcriptional regulator CbbR that has been shown in many organisms to regulate the expression of RubisCO genes. Sigma70-like -10 and -35 promoter boxes and potential CbbR-binding sites (T-N11-A/TNA-N7TNA) were predicted in the upstream regions of the four operons. Electrophoretic mobility shift assays (EMSAs) confirmed that purified CbbR is able to bind to the upstream regions of the cbb1, cbb2 and cbb3 operons, demonstrating that the predicted CbbR-binding sites are functional in vitro. However, CbbR failed to bind the upstream region of the cbb4 operon that contains cbbP, encoding phosphoribulokinase (EC 2.7.1.19). Thus, other factors not present in the assay may be required for binding or the region lacks a functional CbbR-binding site. The cbb3 operon contains genes predicted to encode anthranilate synthase components I and II, catalyzing the formation of anthranilate and pyruvate from chorismate. This suggests a novel regulatory connection between CO2 fixation and tryptophan biosynthesis. The presence of a form II RubisCO could promote the ability of A. ferrooxidans to fix CO2 at different concentrations of CO2.
CONCLUSIONS: A. ferrooxidans has features of cbb gene organization for CO2-assimilating functions that are characteristic of obligate chemolithoautotrophs and distinguish this group from facultative autotrophs. The most conspicuous difference is a separate operon for the cbbP gene. It is hypothesized that this organization may provide greater flexibility in the regulation of expression of genes involved in inorganic carbon assimilation.

Background

Acidithiobacillus ferrooxidans is a mesophilic, obligately chemolithoautotrophic, γ-proteobacterium that gains energy and reducing power from the oxidation of ferrous iron and reduced inorganic sulfur compounds (RISCs) [1]. It grows optimally at pH 2, although growth as low as pH 1 has been reported [2]. The microorganism is a key player in the solubilization of copper in industrial bioleaching operations and makes an important contribution to the biogeochemical cycling of nutrients and metals in pristine and manmade acidic environments. In such environments, CO2 would be expected to exist preferentially as a dissolved gas in equilibrium with the atmosphere and not in the bicarbonate form typically found at circum-neutral pHs [3].

A. ferrooxidans has previously been shown [4,5] to have candidate genes (cbbL and cbbS) for the large and small subunits of ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO, EC 4.1.1.39) that catalyses CO2 fixation by the Calvin-Benson-Bassham (CBB) cycle in many organisms [6]. cbbL and cbbS are linked to genes predicted to encode carboxysome shell proteins [7] and a divergently transcribed gene encoding the LysR-type transcription regulator CbbR [4]. The intergenic region between cbbR and cbbL is predicted to harbor binding sites for CbbR [4]. In addition, microarray transcript profiling experiments have detected differential expression of several genes in A. ferrooxidans potentially involved in the CBB cycle depending on the growth substrate used [8].

These observations taken together, suggest that, in A. ferrooxidans, CbbR can regulate the expression of RubisCO and the carboxysome genes and therefore is likely to be involved in the regulation of carbon fixation as has been observed in other autotrophic bacteria including: Xanthobacter flavus [9], Ralstonia eutropha H16 [10], Chromatium vinosum [11], Nitrobacter vulgaris [12], Halothiobacillus neapolitanus [13], Thiobacillus denitrificans [14], Rhodobacter sphaeroides [15], Rhodobacter capsulatus [16], Rhodospirillum rubrum [17], Hydrogenovibrio marinus [18], Nitrosomonas europaea [19] and Thiomicrospira crunogena XCL-2 [20]. However, no coherent model has been developed for A. ferrooxidans to explain all the data and little experimental evidence has been provided to support several of the aforementioned observations, prompting the current investigation.

Methods

Bacterial strains and culture conditions

Information regarding bacterial strains and plasmids used in this study is provided in Table 1. A. ferrooxidans was cultured in 9 K medium (adjusted to pH 3.5 with H2SO4) containing 5 g/l elemental sulfur at 30°C under aerobic conditions on a rotary shaker at 150 rpm as described previously [21]. Escherichia coli harboring plasmids was grown at 37°C in LB broth with ampicillin (Amp: 100 μg/ml).

Table 1

List of bacterial strains and plasmids used in this study

Strain or plasmid	Relevant characteristic	Source or reference
Bacterial strains
Acidithiobacillusferrooxidans	Type strain	ATCC 23270
E. coli TOP10	F- mcrA Δ(mrr-hsdRMS-mcrBC) ϕ80lacZΔM15 ΔlacX74 recA1 araD139 Δ(ara-leu) 7697 galU galK rpsL (StrR) endA1 nupG	Invitrogen
Plasmids
pBAD-TOPO®	AmpR promoter araBAD (PBAD) C-terminal: V5 epitope tag-polyhistidine (6 × His)	Invitrogen
pBAD-cbbR	pBAD-TOPO::927-bp fragment containing cbbR from A. ferrooxidans ATCC 23270 expressed from PBAD promoter	This study

Abbreviations used: ATCC, American Type Culture Collection. AmpR, ampicillin resistance; StrR, streptomycin resistance.

General DNA techniques and sequencing of DNA

A. ferrooxidans cultures were centrifuged at 800 × g to remove solid sulfur precipitates prior to cell harvest. Unattached cells were pelleted at 8000 × g for 10 min. The cell pellet was resuspended in 9 K salt solution for washing and washed cells were collected by centrifugation at 8000 × g for 10 min as described previously [21]. Standard procedures [22] were employed to isolate genomic and plasmid DNA from bacteria, to transform plasmid DNA into E. coli, and for general DNA handling. Restriction endonucleases and DNA-modifying enzymes were used as recommended by the manufacturers. Plasmid DNA was prepared by means of the QIAprep Spin Mini Kit (Qiagen). Polymerase chain reaction (PCR) products were amplified with Taq DNA polymerase (Fermentas) and purified from agarose gels using the QiaEx DNA Purification Kit (Qiagen). Each PCR reaction contained in a volume of 25 μl 1 ng of template DNA, 0.5 μM of required primers and 0.2 mM of each deoxyribonucleotide in 1× PCR buffer containing 1.5 mM MgCl2 (Fermentas). PCR conditions were as follows: initial denaturing step at 95°C for 5 min followed by 30 amplification cycles (denaturation at 95°C for 30 s, annealing at the appropriate temperature depending on the specific primer pairs for 20 s, elongation at 72°C) and a final elongation step at 72°C for 10 min. DNA sequencing of pBAD-cbbR was carried out by the Göttingen Genomics Laboratory (Göttingen, Germany).

Isolation of RNA and RT-PCR

Total RNA was isolated from cells of A. ferrooxidans grown to mid-log phase in 9 K medium supplemented with sulfur, as described previously [23]. The RNA preparation was treated with DNase I (Fermentas) before proceeding with the cDNA synthesis step. One microgram of total cellular RNA was used for each reaction. Reverse transcription-PCR (RT-PCR) was performed on purified RNA using the One-Step RT-PCR kit (Qiagen). The sequences of the RT and PCR primers used are provided in Table 2. As controls, reactions were carried out that included RNA but lacked reverse transcriptase to assess genomic DNA contamination and that lacked RNA but contained 1 ng of genomic DNA.

Table 2

Sequences of primers used in co-transcription RT-PCR assays, cloning experiments and EMSA assays.

Primers used in RT-PCR assays
cbb1 operon
Numbera	Gene	Forward primer (5'-3')	Numbera	Gene	Reverse primer (5'-3')
1	cbbR	CAACGCCGTGTTGCTCGAA	2	cbbL1	CTAGACTTTTTTACGGCCATGCTT
3	cbbL1	CTGCCAATCGTGTCGCGC	4	csoS2	CGCACGGGAAAGCGACTT
5	csoS2	CCTATGGTGCCGTGCCAAC	6	csoS3	GTGCATGACGCACGCCC
7	csoS3	GTCAGCGGGTCAAAGCCG	8	csoS1A	GCCGCCTTGGTCATCG
9	csoS1B	GGAGCAGATGCGTGTGAGCG	11	parA	AGTAGAACCCCGCCGAGCCAA
10	bfrA	CGCGCAGAAGAGTTACAAGCCTTG	12	parA	CTGATCGAACCCTGAGGATCGG
13	parA	GTGCTGCGGTTGAAGGGGT	14	hyp2	GTGGAGTTCGATAATGGCGGAG
15	hyp2	CGAGAAGCCTCCGCCATTATC	16	cbbQ1	GCCTGTGGGTCCTTTCAGCAT
18	cbbO1	TGACGCCAGGAAAGCGGTG	17	cbbO1	CAGGGATTTCAGGCTGGTCG
19	cbbO1	GCAGAGGCTGCCAGAAAAGCT	20	cbbA	AAGCACCTACCGCGTATCCGT
			21	bioDa	CAGTGCCACCGCCACCC
cbb2 operon
	Forward primer (5'-3')'		Reverse primer (5'-3')
1	tatCa	ACGACGGCGTCTAGAACCGCC	2	cbbL2	CCGGTAATCCTCTAGACCCGCGTT
3	cbbL2	CATCGAGAAGGAAGGCAAGGC	4	cbbS2	CGCAACCTGTTGACGGATCTG
5	cbbS2	ACCGGAAAACGCCTTCGGC	6	cbbQ2	GGTCAATGGGCCATCCTGCC
7	cbbQ2	AGGGTGTTGAGGCGAAGGCC	8	cbbO2	GTACGATGGGCGTGTGCGC
9	cbbO2	GCCTACAGCGAGGAGGCCATG	10	yfeAa	GCGGAGCCTTGTCCCTCGG
cbb3 operon
		Forward primer (5'-3')'			Reverse primer (5'-3')
1	hyp4a	TACGAAGGCGGCTCCCCG	2	hyp3	CGACGGCAATCGGAGTCTTT
3	hyp3	CGGGTGATCGCGCTGGAT	4	cbbT	CAGAATGCCGTCGTGACCA
5	cbbT	ATCGGCATCGACCACTTT	6	cbbK	TCCATCATACGCAGGACA
7	cbbK	CCTACATCAGTACGGGTG	9	cbbA	CACCTGCTCCAGGTTGTT
8	pykA	TTGATCCTCATCACCATCGG	11	cbbE	GATATGGATATAGTCGGCACCC
10	cbbA	GCAGGCCAGCAAGATCAA	14	trpE	GCCGACAAGGGAGTATCGA
12	cbbE	CTATCGAACTGGAAGTGGATGG	16	trpG	CGATAGCCGCCACGTCG
13	cbbZ	TCGGCGATTCACGTAACG	17	trpCa	AGGGCCACTGCCGCCTGC
15	trpE	GAAACCATGAACAAACGCCG
cbb4 operon
		Forward primer (5'-3')'			Reverse primer (5'-3')
1	ompAa	GGTATTTCCTATTTTTGGGGTGGC	3	sahA	CGGCAATGCGGACTTCCTTAC
2	metK	TTGGGAGCGGACCGACAAG	5	metF	AAGCATACTCGGGACCCAAGG
4	sahA	CTTCGCGGGGGTGCTGA	7	cbbP	GACGGGATGTTTTTTGGACATGG
6	metF	CACCGAGCCTGCATTTTTACACC	9	ynbD	GGCTACAGCCACCACGGGAT
8	cbbP	ATGTTGCCGGGCAGTTTTATGTC	10	fbnAa	GCGAGGTGGACTGGACGGA
Primers used in EMSA assays and cloning experiments
Letter designation		Forward primer (5'-3')			Reverse primer (5'-3')
(a) Pcbb1		CGGCAGCGAAGATCTTGAGTTGGTGC	(b) Pcbb1		CTCCGGCCTCATACTTTTTTACGG
(c) cbbRfw		TCTATCCGTCATGCAACCTTG	(d) cbbRrev		GCGCCATTCCTTTTCACCATG
(e) Pcbb2		ACGACGGCGGCAAGCACCGCC	(f) Pcbb2		CCGGTAATCCTTCACACCCGCGTT
(g) Pcbb3		CATTGAACAGGGTCAGCTCCTGG	(h) Pcbb3		ATCGGAGTCTTTGATCATGCGCC
(i) Pcbb4		TTTGGGGTGGCAGCAAGAAGT	(j) Pcbb4		GGAAACGGATTCAGAGGTGAAAAG

aGenes lie outside the operons and are not shown in Figure 2.

Cloning and expression of cbbR

A DNA fragment corresponding to the coding region of cbbR of A. ferrooxidans was amplified by PCR using primers (Integrated DNA Technologies) cbbRfw and cbbRrev (Table 2). The amplified product was cloned into the expression vector pBAD-TOPO (Invitrogen) according to the manufacturer's instruction. The resulting plasmid pBAD-cbbR was introduced by electroporation into E. coli TOP10 (Invitrogen) competent cells [22]. E. coli was grown at 37°C in 10 ml LB containing 100 μg/ml ampicillin to an OD600 of 0.8. Overproduction of the recombinant His6-tagged CbbR protein was initiated by adding arabinose to a final concentration of 0.1% (w/v) with continued shaking at 200 rpm for 12 h.

Purification of CbbR

Cells from 1.5 l of induced culture were harvested by centrifugation (8,000 × g for 10 min at 4°C) and at -20°C. After thawing the cell pellet was resuspended in 40 ml denaturing buffer containing 6 M guanidine-HCl, 100 mM NaH2PO4 and 10 mM Tris-HCl, pH 8.0, and incubated at room temperature with continuous stirring for about 30 min until inclusion body proteins were solubilized. Any remaining insoluble material was removed by centrifugation at 18,000 × g and 7°C for 20 min. The resulting supernatant was filtered through a 0.45-μm membrane and the recombinant protein subsequently purified by affinity chromatography on a 2.5-ml Ni-nitrilotriacetic acid column under amalgam conditions (denaturing conditions-native conditions). Initially the protein was adsorbed to the matrix under denaturing conditions at room temperature after equilibration with binding denaturing buffer (BDB) containing 8 M urea, 100 mM NaH2PO4 and 10 mM Tris-HCl, pH 8.0. The column was first washed with BDB and then with washing denaturing buffer (WDB) containing 8 M urea, 100 mM NaH2PO4, 10 mM Tris-HCl, pH 6.0. The elution of CbbR was carried out under native conditions at 4°C after equilibrating the column with native buffer (20 mM imidazole, 300 mM NaCl, 50 mM NaH2PO4, pH 8.0). His6-CbbR was eluted at a flow rate of 1 ml/min with eluting native buffer (250 mM imidazole, 300 mM NaCl, 50 mM NaH2PO4, pH 8.0). The eluted fractions were monitored at 280 nm. Fractions with the highest protein content were pooled, dialysed twice against 50 mM HEPES-NaOH, pH 7.8 containing 200 mM KCl, 10 m MgCl2, 1 mM dithiothreitol, 0.05 mM phenylmethylsulfonyl fluoride and 50% (w/v) glycerol. The final protein concentration was 4 mg/ml. Protein preparations were analyzed by SDS-polyacrylamide gel electrophoresis in 12% (w/v) polyacrylamide slab gels under reducing conditions in the presence of 100 mM β-mercaptoethanol. Gels were stained with Coomassie Brilliant Blue R-250. Protein contents were determined using the method of Bradford [24], with bovine serum albumin as a standard. CbbR was stored at -20°C.

Production of antisera to CbbR

Multiple intradermal injections were applied to immunize a female Californian giant rabbit (3.0 kg) as described by [25]. A fresh CbbR preparation (0.5 ml; 1 mg/ml) was emulsified in one volume of complete Freund adjuvant (Commonwealth Serum Laboratories, Melbourne, Australia). The emulsion was prepared under aseptic conditions and 1.0 ml was initially injected into four sites on the back of the animal. Booster injections were given in the same way 75 days after the primary immunization, except that incomplete Freund adjuvant was used. The immune response was monitored by Western Blotting assays with serum separated from test blood samples (1.0 to 2.0 ml) that were obtained from an ear vein every 15 to 20 days after each immunization.

Electrophoretic mobility shift assays (EMSA)

DNA fragments containing the four potential cbb operon promoter regions were amplified by PCR and simultaneously biotinylated using the biotin 5'-labelled primers (Table 2). DNA-binding assays were performed at 30°C in a final volume of 17 μl containing 12 mM HEPES-NaOH, pH 7.9, 4 mM Tris-HCl, pH 7.9, 1 mM EDTA, 60 mM KCl, 1 mM dithiothreitol, 10% (w/v) glycerol, 5 μg/μl of bovine serum albumin and 2 μg/μl of poly(dI-dC). The indicated amount of CbbR protein (~290 μM) was incubated with the biotin end-labeled target DNA (20 pmol) for 15 min. A 50-fold excess of unlabeled DNA probe was used to challenge the labeled probe. In supershift experiments, a 1:500 dilution of CbbR-specific antiserum was added to the reaction after DNA binding of CbbR and incubated for an additional 15 min. After the binding reactions, samples were loaded onto a low-ionic strength nondenaturing polyacrylamide gel (4.8% [w/v], which had been prerun at a constant current of 200 mA for more than 90 min, and electrophoresed at 150 mA for about 60 min in 0.5× TBE buffer (89 mM Tris base, 89 mM boric acid and 2 mM EDTA). The separated CbbR-DNA complexes were electrophoretically transferred from the gel onto a nylon membrane in semi-dry blotting apparatus (Biometra, Göttingen). CbbR-DNA binding was detected using a streptavidin-horseradish peroxidase conjugate and a chemiluminescent substrate (Pierce) followed by autoradiography.

Bioinformatic analyses

Metabolic pathways involved in CO2 assimilation were retrieved from KEGG http://www.genome.ad.jp/kegg/. Protein sequences derived from known genes involved in CO2 assimilation were used as query sequences to search the genome sequence of A. ferrooxidans ATCC 23270, using TBlastN and BlastP, respectively, with default parameters. When a prospective candidate gene was identified, its predicted protein sequence was then used to formulate a BlastP http://www.ncbi.nlm.nih.gov search of the nonredundant database at NCBI. Only bidirectional best hits were accepted as evidence for putative orthologs. Candidate genes and their translated proteins were further characterized employing the following bioinformatic tools: ClustalW [26] for primary structure similarity relations, PSI-PRED [27] for secondary structure predictions, Prosite [28] for motif predictions, ProDom [29] and Pfam [30] for domain predictions. Information regarding the organization of genes in A. ferrooxidans was obtained from [2]. Logos were generated using the web-based application available at http://weblogo.berkeley.edu/logo.cgi. The height of each letter in bits corresponds to its relative abundance at each position. Promoters of the σ70-type and rho-independent transcriptional stops were predicted for operons cbb1-4 using the programs BPROM http://www.softberry.com and Transterm [31], respectively.

The organization of gene clusters in facultative and obligate autotrophs involved in the CBB cycle was derived from information available in IMG-JGI http://www.jgi.doe.gov/ and MicrobesOnline http://www.microbesonline.org/, with additional information added for H. marinus [18] and A. ferrooxidans, Acidithiobacillus caldus and Acidithiobacillus thiooxidans (this study). The phylogenetic cladogram of these bacteria was constructed from 16 S rRNA sequences obtained from KEGG Orthology K01977 http://www.genome.jp/kegg/ko.html and from GenBank http://www.ncbi.nlm.nih.gov/ for A. caldus (GI454888), A. thiooxidans (GI454888) and H. marinus (GI3882094). 16 S rRNA alignments were carried out using ClustalW and the cladogram was constructed by the NJ method using the program MEGA 4.0 [32]. The robustness of the tree was evaluated by bootstrapping using 1000 replicas. The tree was rooted using the 16 S rRNA of the ε-proteobacterium Helicobacter pylori.

Results, Discussion and Conclusions

The genome of A. ferrooxidans ATCC 23270 encodes CbbR, a LysR-type transcription factor

A gene cbbR was predicted in the genome of A. ferrooxidans ATCC 23270 (type strain) that potentially encodes a protein with significant amino acid sequence similarity and domain structure to other well-documented CbbRs of the LysR family of transcription factors (Additional file 1). cbbR is divergently transcribed from cbbL1, a gene predicted to encode the large subunit of form I RubisCO. The genetic linkage between cbbR and cbbL1 is known to be conserved in a number of autotrophic bacteria that fix CO2 via the CBB cycle such as Acidithiobacillus ferrooxidans Fe1 [4], Hydrogenophilus thermoluteolus [33], Nitrosomonas europaea [19], Rhodobacter sphaeroides [34], Rhodobacter capsulatus [35], R. eutropha H16 [36], Rhodospirillum rubrum [17], Thiobacillus denitrificans [14] and Xanthobacter flavus [9]. We here extend this list to include: Alkalilimnicola ehrlichii, Halorhodospira halophila, Methylibium petroleiphilum, Nitrobacter winogradskyi, Nitrosococcus oceani, Nitrosospira multiformis, Thiomicrospira crunogena and Xanthobacter autotrophicus (Additional file 2).

The cbbR-cbbL1 intergenic region of A. ferrooxidans strain Fe1 has been shown to contain divergent σ70-type promoters and to exhibit two CbbR binding sites that partially overlap these promoters ([4], Figure 1A). The binding sites conform to the pseudo-palindromic motif TNA-N7-TNA [13] that is a subset of the consensus LysR-type transcription factor binding site T-N11-A [37]. Logos were derived from a multigenome comparison of the cbbR-cbbL1 intergenic region of a number of bacteria (Additional file 3) and were aligned with the CbbR sites of A. ferrooxidans strain Fe1, allowing the prediction of the CbbR binding sites of A. ferrooxidans ATCC 27230 (Figure 1B and 1C).

Figure 1

The . (A) DNA sequence of cbbR-cbbL1 intergenic region of A. ferrooxidans Fe1 showing two TNA-N7-TNA CbbR-binding regions (boxed sequences) and experimentally verified nucleotides protected by CbbR binding (*) and σ70 promoter regions (-10 and -35 sites) (Modified from [5], with permission of the publisher). (B) Logos derived from multiple sequence alignments of the cbbR-cbbL1 intergenic region of eight bacteria showing conservation of the CbbR-binding sites (more information in additional file 3). (C) Prediction of CbbR-binding sites and σ70 promoter regions in the cbbR-cbbL1 intergenic region of A. ferrooxidans ATCC 23270 by comparison with experimentally verified regions of A. ferrooxidans Fe1 and using the information derived from Logos.

Organization and expression of gene clusters predicted to be involved in CO2 fixation and associated pathways of central carbon metabolism

A cluster of 16 genes, termed cbb1, was predicted to be involved CO2 fixation. RT-PCR experiments showed that cbb1 is transcribed as a single unit and thus can be considered to be an operon (Figure 2A). Operon cbb1 consists of cbbL1 and cbbS1, potentially encoding the large and small subunits of form IAc RubisCO, seven cso genes predicted to be involved in α-carboxysome formation, two genes (cbbQ1 and cbbO1) presumed to be involved in RubisCO activation and cbbA, potentially encoding a fructose-1,6-bisphosphate aldolase. Gene descriptions are provided in Table 3.

Figure 2

Organization and co-transcription of four . (A) cbb1 (B) cbb2 (C) cbb3 and (D) cbb4. The following are represented in each of the panels A-E: (a) nucleotide sequences of the predicted σ70-like promoter region (-10 and -35 sites in italics) and potential CbbR-binding sites in grey boxes with the LysR-type TNA-N7-TNA and T-N11-A consensus binding sites in bold letters, (b) gene organization of the respective operons with predicted rho-independent transcriptional stop sites indicated as stem-loop symbols, (c) locations of PCR primers used for RT-PCR experiments (indicated by numbers) or EMSA assays (indicated by letters) and (d) gel electrophoresis of fragments amplified by RT-PCR using purified cellular RNA as template. A 1-kb scale bar is shown. One of the T-N11-A consensus binding sites in the cbb4 operon is part of a larger pseudo-palindrome indicated by inverted arrows. Predicted gene functions are provided in Table 3.

Table 3

Predicted genes of cbb operons

*Accession	aGenename	bPredicted function	cBest BlastP hit	d% Similarity	eScore	fE-value	gDomains and motifs
Operon cbb1
ACK78724.1	cbbR	LysR family transcriptional regulatory protein CbbR	Nitrococcus mobilis	76	363	7e-99	PD462572, PD756396, Pfam03466, Pfam00126, COG0583
ACK79627.1	cbbL1	Ribulose bisphosphate carboxylase large subunit 1 [4.1.1.39]	Halothiobacillus neapolitanus	94	882	0	PD417314, PD000044, Pfam00016, Pfam02788, COG1850
ACK77836.1	cbbS1	Ribulose bisphosphate carboxylase small subunit 1 [4.1.1.39]	Methylococcus capsulatus	80	161	8e-39	PD000290, Pfam00101, COG4451
ACK78689.1	csoS2	Carboxysome structural peptide	Thiobacillus denitrificans	59	325	9e-87	PD579361, tat signal peptide
ACK80925.1	csoS3	Carboxysome structural peptide	Thiobacillus denitrificans	65	537	5e-151	PD191834, Pfam08936
ACK80352.1	csoS4A	Carboxysome peptide A	Thiobacillus denitrificans	93	139	6e-32	PD012510, Pfam03319, COG4576, tat signal peptide
ACK79436.1	csoS4B	Carboxysome peptide B	Thiobacillus denitrificans	82	119	7e-26	PD012510, Pfam03319, COG4576
ACK78722.1	csoS1C	Microcompartments protein	Nitrosomonas eutropha	97	142	6e-33	PD003442, Pfam00936, COG4577
ACK79154.1	csoS1A	Microcompartments protein	Nitrosomonas eutropha	97	144	1e-33	PD003442, Pfam00936, COG4577
ACK79584.1	csoS1B	Microcompartments protein	Nitrosomonas eutropha	95	146	3e-34	PD003442, Pfam00936, COG4577
ACK79096.1	bfrA	Bacterioferritin	Thiobacillus denitrificans	70	135	6e-31	PDA00179, Pfam00210, COG1633
ACK77923.1	hyp1	Hypothetical protein	Thiobacillus denitrificans	81	68	2e-10	PDA1E0I5
ACK80576.1	parA	Partition protein A	Thiobacillus denitrificans	72	196	6e-49	PD194671, Pfam01656, COG1192
ACK78664.1	hyp2	Hypothetical protein	Acidithiobacillus ferrooxidans	100	156	1e-09
ACK80060.1	cbbQ1	Rubisco activation protein	Nitrosomonas europaea	92	489	5e-137	PD490543, Pfam08406, Pfam07728, COG0714, COG5271
ACK80817.1	cbbO1	Rubisco activation protein	Thiobacillus denitrificans	74	940	0	PD140693, PD679436, Pfam00092, COG4867, COG4548
ACK80290.1	cbbA	Fructose-bisphosphate aldolase [4.1.2.13]	Bradyrhizobium sp.	61	295	3e-78	PD002376, PD030418, Pfam01116, Pfam07876, COG191
Operon cbb2
ACK80366.1	cbbL2	Ribulose bisphosphate carboxylase/oxygenase large subunit 2 [4.1.1.39]	Thiobacillus denitrificans	97	920	0	PD417314, PD000044, Pfam00016, Pfam02788, COG1850
ACK79774.1	cbbS2	Ribulose bisphosphate carboxylase/oxygenase small subunit 2 [4.1.1.39]	Thiobacillus denitrificans	88	203	3e-51	PD000290, Pfam00101, COG4451
ACK80953.1	cbbQ2	Rubisco activation protein	Nitrosomonas europaea	92	483	6e-135	PD490543, PD372819; Pfam08406, Pfam07728, COG0714
ACK78928.1	cbbO2	Rubisco activation protein	Thiobacillus denitrificans	76	965	0	PD140693, PD025507, COG4548
Operon cbb3
ACK80740.1	hyp3	Hypothetical protein	Thiobacillus denitrificans	49	149	8e-9	PD796582
ACK78212.1	suhB	Inositol-phosphate phosphatase [3.1.3.25]	Methylococcus capsulatus	66	646	8e-66	PD001491, PD013702, pfam00459, pfam00316, COG0483, COG1218
ACK80404.1	cbbF	Fructose-1,6-bisphosphatase [3.1.3.11]	Mariprofundus ferrooxydans	71	823	3e-86	PD007014, PD863173, pfam03320, COG1494
ACK79091.1	cbbT	Transketolase [2.2.1.1]	Methylococcus capsulatus	75	2264	0.0	PD308336, pfam00456, pfam02779, COG3959, COG0021
ACK78716.1	cbbG	Glyceraldehyde-3-phosphate dehydrogenase type I [1.2.1.-]	Burkholderia thailandensis	82	1189	1e-128	PD959395, PD859695, pfam02800, pfam00044, COG0057
ACK79414.1	cbbK	Phosphoglycerate kinase [2.7.2.3]	Alcanivorax borkumensis	80	1296	6e-141	PD000619, PDA014E1, pfam00162, COG0126
ACK78522.1	pykA	Pyruvate kinase II [2.7.1.40]	Thiobacillus denitrificans	79	1491	2e-163	PD983049, PD745602, pfam00224, pfam02887, COG0469
ACK79923.1	cbbA	Fructose-bisphosphate aldolase [4.1.2.13]	Nitrosococcus oceani	90	1474	1e-161	PD875785, PD002376, pfam01116, COG0191
ACK80630.1	cbbE	Ribulose-5-phosphate 3-epimerase [5.1.3.1]	Herminiimonas arsenicoxydans	80	753	2e-78	PD003683, PD591639, pfam00834, COG0036
ACK80633.1	cbbZ	Phosphoglycolate phosphatase [3.1.3.18]	Thiobacillus denitrificans	64	484	4e-47	PD946755, PDA11895, pfam00702, COG0546, COG0637
ACK78314.1	trpE	Anthranilate synthase component I [4.1.3.27]	Methylococcus capsulatus	77	1569	2e-172	PD005777, PD105823, pfam00425, pfam04715, COG0147, COG1169
ACK78895.1	trpG	Anthranilate synthase component II [4.1.3.27]	Nitrosomonas europaea	86	770	2e-80	PD806135, PD976090, pfam00117, pfam07722, COG0512, COG0518
Operon cbb4
ACK79981.1	metK	S-adenosylmethionine synthetase [2.5.1.6]	Ralstonia eutropha	86	591	2e-167	PD499406, PD606972, pfam02773, pfam02772, COG0192
ACK78713.1	sahA	S-adenosyl-L-homocysteine hydrolase [3.3.1.1]	Pseudomonas stutzeri	88	748	0	PD730548, PD551162, pfam05221, pfam00670, COG0499
ACK78001.1	metF	5,10-methylenetetrahydrofolate reductase [1.7.99.5]	Methylococcus capsulatus	69	306	1e-81	PD756524, PD763008, pfam02219, COG0685
ACK78673.1	cbbP	Phosphoribulokinase [2.7.1.19]	Nitrosococcus oceani	78	402	2e-110	PD739884, PD015803, pfam00485, COG3954
ACK79243.1	ynbD	Phosphosterase, PA-phosphatase	Polaromonas naphthalenivorans	81	759	1e-81	PD589889, pfam 01569, COG0474, CD03386, CD00127

* The sequence and annotation of the complete A. ferrooxidans strain ATCC 23270 genome is available at the Comprehensive Microbial Resource (CMR) (J. Craig Venter Institute, http://www.jcvi.org) and in GenBank/EMBL/DDBJ accession number CP001219.

a Proposed gene name.

b Proposed enzyme activity with EC number if available

c Organism with the best BlastP hit to the candidate gene.

d Percentage of similarity (% Sim) of candidate gene to that found in the organism listed in row (c).

e Score of BlastP match.

f E value of BlastP match.

g Motif and domains identified in the candidate proteins: CD, Conserved Domains; COG, Clusters of Orthologous Groups of Proteins; Pfam, protein families; PD, Prodom (protein domains); PS, Prosite tat signal peptide

Three additional gene clusters termed cbb2 (four genes), cbb3 (twelve genes) and cbb4 (five genes) were identified that are predicted to encode functions related to CO2 fixation and central carbon metabolism (Table 3). RT-PCR experiments revealed that gene clusters cbb2, cbb3 and cbb4 are transcribed as single units, respectively, and thus constitute operons (Figure 2B-D). cbb2 contains genes (cbbL2 and cbbS2) encoding additional copies of the large and small subunit of form IAq RubisCO and associated RubisCO activation genes (cbbQ2 and cbbO2) (Figure 2B). The deduced amino acid sequences of these genes are similar but not identical to the corresponding proteins encoded in the cbb1 operon; CbbL1 and CbbL2 exhibit 84% amino acid sequence identity, whereas CbbS1 and CbbS2 share 56% identity and CbbQ1 and CbbO1 have 84% and 59% identity with CbbQ2 and CbbO2, respectively.

Genes predicted to be encoded by operons cbb3 and cbb4 are listed in Table 3 and their organization within these operons is shown in Figure 2.

The two enzymes that are unique to the CBB cycle are RubisCO (encoded by operons cbb1 and cbb2) and phosphoribulokinase (encoded by operon cbb4). RuBisCO catalyzes the first step of the cycle, the carboxylation of ribulose-1,5-bisphosphate (RuBP) with CO2. Phosphoribulokinase catalyzes the last step of the cycle which is the regeneration of the CO2 acceptor molecule, RuBP, by phosphorylation of ribulose 5-phosphate with ATP. Other steps of the cycle, encoded in operon cbb3, are catalyzed by enzymes common to glycolytic and gluconeogenic pathways in central carbon metabolism [8,36].

Promoters of the σ70-type and rho-independent transcriptional stops were predicted for operons cbb1-4 (Figure 2). In addition, potential CbbR-binding sites were identified in the four operons based on the detection of conserved TNA-N7-TNA and T-N11-A motifs described above for operon cbb1 (Figure 2).

CbbR binds in vitro to the predicted σ70-like promoter regions of operons cbb1-4

Binding of CbbR to DNA fragments containing the predicted promoters of the four operons cbb1-4 was evaluated in vitro by electrophoretic mobility shift assays (EMSAs). For this purpose the cbbR gene was cloned and expressed in E. coli. Purified CbbR was used to prepare antisera (anti-CbbR antibodies) whose activity was checked by Western blotting against purified CbbR (data not shown). Biotin-labeled promoter DNA for the EMSA assays was prepared by PCR using primers specified in Table 2 and whose locations within the four operons are shown in Figure. 2.

Results show that CbbR was able to retard the promoter regions of the cbb1, cbb2 and cbb3 operons but not the cbb4 operon (Figure 3). When a 50-fold molar excess of unlabelled fragment was included in the binding assay retardation of the labelled fragments was abolished. Furthermore, the addition of anti-CbbR antibodies to the reaction produced a supershift in migration, indicating that the shift was caused specifically by the binding of CbbR.

Figure 3

Binding of CbbR to the promoter regions of the operons . Abbreviations: P*, probe DNA; S, shift; SS, supershift.

Binding of CbbR to the predicted promoter regions of operons cbb1-3 suggests that it is involved in their regulation. The reason for the failure of CbbR to retard the DNA fragment containing the predicted promoter of the cbb4 operon is not known. Perhaps this fragment requires the presence of additional factors for CbbR binding that are not present in the in vitro cocktail used for the EMSA analysis. Alternatively, the predicted CbbR binding site is not functional.

Gene organization of the cbb operons

The cbb3 operon includes not only genes involved in carbon assimilation but also harbors genes with similarity to trpE and trpG that are predicted to encode the components I and II of anthranilate synthase, the first enzyme of the tryptophan biosynthesis pathway. Anthranilate synthase catalyzes the conversion of chorismate to anthranilate with the concomitant release of pyruvate [38,39]. In some cases, this conversion can be accomplished by TrpE alone [40].

In order to determine if the association between trpEG and the cbb genes is restricted to A. ferrooxidans, an examination of gene organization was carried out in all sequenced genomes of facultative and obligate autotrophic proteobacteria. Twenty-six proteobacterial organisms (11 α-, 7 β- and 8 γ-) were analyzed, including 10 obligate autotrophs. Linkage between trpE/G and cbbE and/or cbbZ was found in all sequenced obligate autotrophs, all of which belong to the β- or γ-proteobacteria divisions (Figure 4, Table 4), whereas only 4 out of 14 facultative heterotrophs were detected with this clustering. These four exceptions are found only in the β- or γ-proteobacteria and none in the α-proteobacterial division (Figure 4, Table 4). This suggests a previously unreported linkage between genes encoding CBB cycle associated enzymes and trpEG or trpE that is most conserved in obligate autotrophs of the β- and γ-proteobacteria.

Figure 4

Organization of gene clusters involved in the CBB cycle of facultative and obligate autotrophic α-, β- and γ-proteobacteria presented as a phylogenetic cladogram based on 16 S RNA. Numbers refer to bootstrapping results from 1000 trees. Organism names are provided in the text. The asterisk indicates that the respective organism is an obligate autotroph.

Table 4

Characteristics of cbb gene clusters in facultative and obligate, autotrophic bacteria.

Organism	Autotrophy status	Phyogeneticclassification-proteo-bacteria	No. copiescbbR	Presenceof cso genes?	trpE/Gassociated with cbb?	cbb gene cluster associated with cbbP?	No. cbbgene clusters
Acidithiobacillus ferrooxidans ATCC 23270 and ATCC 53993	obligate	Gamma-	2	Yes	Yes	No	5*
Acidithiobacillus thiooxidans ATCC 19377	obligate	Gamma-	2	Yes	Yes	No	5
Acidithiobacillus caldus ATCC 51756	obligate	Gamma-	2	Yes	Yes	No	5
Nitrosomonas europaea ATCC 19718	obligate	Beta-	1	No	Yes	No	4
Nitrosomonas eutropha C71	obligate	Beta-	1	Yes	Yes	No	4
Nitrosococcus oceani ATCC 19707	obligate	Beta-	1	No	Yes	No	4
Thiomicrospira crunogena XCL-2	obligate	Gamma-	3	Yes	Yes	No	5
5Hydrogenovibrio marinus MH-110	obligate	Gamma-	2	Yes	N/D	N/D	3
Thiobacillus denitrificans ATCC 25259	obligate	Beta-	2	Yes	Yes	No	5
Nitrosospira multiformis ATCC 25196	obligate	Beta-	1	No	Yes	No	4
Methylococcus capsulatus Bath	obligatemethanotroph	Gamma-	1	No	Yes	Yes	3
1Nitrobacter hamburgensis X14	facultative	Alpha-	3	Yes	No	Yes	3
Nitrobacter winogradskyi Nb-255	facultative	Alpha-	3	Yes	No	Yes	3
Halorhodospira halophila SL1	facultative	Gamma-	1	No	Yes3	Yes	2
Alkalilimnicola ehrlichii MLHE-1	facultative	Gamma-	1	No	Yes3	Yes	2
Bradyrhizobium sp. BTAi1	facultative	Alpha-	2	Yes	No	Yes	3
Bradyrhizobium japonicum USDA 110	facultative	Alpha-	1	No	No	Yes	1
Ralstonia eutropha H16	facultative	Beta-	1	No	No	Yes	24
Dechloromonas aromatica RCB	facultative	Alpha-	1	No	No	Yes	2
2Magnetospirillum magneticum AMB-1	facultative	Alpha-	?	No	No	Yes	2
Paracoccus denitrificans PD1222	facultative	Alpha-	1	No	No	Yes	1
Rhodobacter sphaeroides 2.4.1	facultative	Alpha-	1	No	No	Yes	2
Rhodoferax ferrireducens T118	facultative	Beta-	1	No	No	Yes	1
Rhodopseudomonas palustris CGA009	facultative	Alpha-	2	No	No	Yes	3
Rhodospirillum rubrum ATCC 11170	facultative	Alpha-	1	No	No	Yes	1
Sinorhizobium meliloti 1021	facultative	Alpha-	1	No	No	Yes	1

*in addition to the four cbb operons described in this paper, a fifth gene cluster containing cbb genes (including a form II RubisCO gene) has recently been detected in A. ferrooxidans (43). 1Two copies of cbbR and two cbb gene clusters are present on two plasmids; 2two highly similar operons present in the genome; 3in these organisms, trpE gene is neighbor to cbbP but not cbbE. 4 R. eutropha H16 posesses a duplicated cbb operon, with similar copies in the chromosome and in a megaplasmid. Data derived from cloned sequences (18). N/D = no data.

We hypothesize that in A. ferrooxidans production of pyruvate via anthranilate synthase activity provides a novel network connection between the CBB cycle on the one hand and general central carbon metabolism including the incomplete ("horseshoe"-like) TCA [2] on the other hand. Consistent with this idea is the presence of a predicted pykA upstream of trpEG in the cbb3 operon. PykA is predicted to encode pyruvate kinase that catalyzes the conversion of phosphoenol pyruvate (PEP) to pyruvate. In addition to supplying pyruvate, PykA could also reduce the level of intracellular PEP. PEP has been shown to be a ligand of CbbR in Ralstonia eutropha H16, promoting its binding to target DNA sites and consequently effecting the regulation of cbb genes [40]. If PEP carries out a similar function in A. ferrooxidans, the depletion of PEP via PykA activity could provide a means for feedback control of operons that are regulated by CbbR, including the auto-regulation of operon cbb3.

The organization of cbb genes in A. ferrooxidans exhibits similarities with obligate autotrophs that distinguish this group from facultative autotrophs. For example, A. ferrooxidans, contains three or more gene clusters dedicated to carbon assimilation. This is similar to other obligate autotrophic γ-proteobacteria including A. caldus, A. thiooxidans, Hydrogenovibrio marinus, Nitrosococcus oceani and Thiomicrospira crunogena, and obligate autotrophic β-proteobacteria such as Nitrosomonas europaea, Nitrosomonas eutropha, and Nitrosospira multiformis and Thiobacillus denitrificans. This contrasts with facultative autotrophs that contain only one or two cbb clusters (Figure 4, Table 4), with some exceptions, e.g. the α-proteobacteria Bradyrhizobium sp., N. hamburgensis, N. winogradski. R. sphaeroides and R. palustris and the β-proteobacterium R. eutropha, which contain unique, but duplicated, cbb clusters). Multiple cbb clusters could provide obligate autotrophs with a greater flexibility in regulating CO2 fixation compared to facultative autotrophs. For example, this flexibility may be necessary to adjust carbon assimilation in response to changing environmental concentrations of CO2 [18], whereas facultative autotrophs might be able to circumvent this need by exploiting organic carbon sources in times of low CO2 concentrations.

Another characteristic of cbb gene organization in A. ferrooxidans is the lack of linkage of the phosphoribulokinsae gene, cbbP, with other cbb genes (Figure 4, Table 4) as has previously been reported for the deep-sea vent obligate chemolithoautotroph T. crunogena XCL-2 and for several other obligate autotrophs [20,41]; we now extend this list to include A. ferrooxidans ATCC 23270 and ATCC 53993, A. caldus, A. thiooxidans H. marinus, N. europaea and Thiomicrospira crunogena (Figure 4, Table 4). In contrast, in all sequenced facultative autotrophs cbbP is associated with other cbb genes (Figure 4, Table 4).

In obligate autotrophs, the contextual disconnection of cbbP from cbbLS could provide greater flexibility for CO2 fixation by allowing RubisCO to be differentially expressed according to environmental and/or metabolic requirements without simultaneously expressing the remaining CBB cycle genes, many of which carry out functions in addition to carbon fixation. This is in sharp contrast to the organization found in most facultative autotrophs, where cbbP is usually juxtaposed to cbbLS and other genes of the CBB cycle facilitating their coordinate repression during heterotrophic growth [13,20,34,36,41].

Model for predicted enzymes and pathways involved in CO2 fixation

A model is proposed for Ci fixation in A. ferrooxidans based on the predicted roles of the genes encoded in the cbb operons (Figure 5). In contrast to most facultative autotrophs, the main focus of regulation of the CBB cycle in A. ferrooxidans may be the CO2 fixation reaction itself catalyzed by RubisCO, rather than at the level of the other CBB cycle enzymes. This hypothesis is supported by the observation that the genes encoding RubisCO and RubisCo accessory proteins, are clustered in operons that do not contain cbbP nor cbb that encode the main CBB enzymes. cbbP is also separated from the rest of the cbb genes in the cbb4 operon, with an apparent absence of CbbR binding to its promoter. We suggest that the promoters for the cbb1, cbb2 and cbb3 operons have different affinities for CbbR and may thus exhibit different regulation patterns, possibly associated with the environmental availability of CO2. The cbb1 operon, containing cbbLS-cso, is predicted to serve at low CO2 concentrations because carboxysomes have been shown to improve RubisCO catalytic efficiency by concentrating CO2 [6,13]. In contrast, the cbb2 operon, containing cbbLSQO, is predicted to be used when higher concentrations of CO2 are available since carboxysome synthesis is energetically and materially expensive [18].

Figure 5

Proposed roles of the (A) predicted enzymes and pathways involved in CO. Genes are color-coded to match the predicted function of their products. RPI, ribose phosphate isomerase; G-3-P, glyceraldehyde-3-phosphate; DHAP, dihydroxyacetone phosphate; 3-PG, 3-phosphoglycerate; PEP, phosphoenolpyruvate.

The cbb3 operon, containing genes for most CBB cycle enzymes and pyruvate kinase, is proposed to be responsible for connecting CO2 fixation with the rest of central carbon metabolism. Except for cbbG and cbbK encoding glyceraldehyde-3-phosphate dehydrogenase, type I and phosphoglycerate kinase respectively, genes of the cbb3 operon have duplicated copies in the genome (data not shown), potentially allowing regulation of the CBB cycle independently of the remaining pathways of central carbon metabolism. For example, some CBB cycle intermediates also form part of gluconeogenesis and glycolysis resulting in the production of pyruvate that is channeled, via the pyruvate dehydrogenase complex, into the incomplete TCA "horseshoe" where the flux of intermediates serves for amino acid biosynthesis (e.g. glutamate). The pyruvate dehydrogenase also provides acetyl-CoA used in fatty acid biosynthesis. In addition, the presence of cbbZ in the cbb3 operon is associated with phosphoglycolate phosphatase activity, responsible for removal of phosphoglycolate, an undesirable product of the oxygenase activity of RubisCO, that must be detoxified preferentially by rechanneling to 3-phosphoglycerate [13,36].

The co-transcriptional connection between the cbb, pykA and trpEG genes in the cbb3 operon may reflect the substrate requirement of anthranilate phosphoribosyltransferase for an activated pentose (5-phosphoribosyl 1-pyrophosphate) in order to proceed to the next step of tryptophan biosynthesis [42]. The production of the activated pentose would be stimulated by the activity of the operon. An alternate hypothesis is that the co-transcriptional connection represents a means for pyruvate regeneration since both pykA and trpE/G produce pyruvate.

In addition to the four cbb operons described herein, a fifth gene cluster has recently been detected in A. ferrooxidans that includes genes cbbM, cbbQ3 and cbbO3 predicted to encode form II of RubisCO and its associated chaperons, respectively [43]. The cluster also contains another putative cbbR divergently transcribed from cbbMQO. Future work will evaluate the role of this cluster in CO2 fixation.

Authors' contributions

DH, EJ and ME conceived the study. ME carried out the experiments. BB and J-PC contributed significantly to the analysis and interpretation of results. DH drafted the manuscript. All authors contributed to the draft and approved the manuscript.

Additional file 1

Prediction of secondary structure elements in CbbR of . Above: secondary structure predictions of alpha-helix, beta-sheet, HTH DNA binding domain, oligomerization domain and LysR-substrate like domain. Below: alignment of amino acid sequences from the HTH domain from several bacteria (abbreviations used can be found in Additional File 2) with the pfam domain00126.

Click here for file

Additional file 2

Alignment and conservation of DNA sequences in the intergenic regions between . The DNA sequences contain the cbb control elements including the operator, the operon promoter (pcbbL) and the promoter cbbR (pcbbR). The CbbR regulator bind to region R (recognition site) and the region A (activation site) of the cbb operator. The nucleotides conserved (TNA-N7/8-TNA, T-N11-A) for to bind CbbR are located in intergenic regions RI-1, RI-2 and RI-3. The prediction of the promoter and the sites for to bind σ70 are in the columns (sequences -35 and -10). The names of bacterias are: Acidithiobacillus ferrooxidans (Af), Hydrogenophilus thermoluteolus (Ht), Xanthobacter flavus (Xf), Nitrosomonas europea (Ne), Rhodobacter capsulatus (Rc), Rhodobacter sphaeroides (Rs), Ralstonia eutropha H16 (Ral), Ralstonia metallidurans CH34 (Rm), Rhodospirillum rubrum (Rr), Nitrococcus oceani (No), Nitrobacter winogradskyi (Nw), Halorhodospira halophila (Hh), Xanthobacter autotrophicus (Xa), Thiomicrospira crunogena (Tc), Methylibium petroleiphilum (Mp), Thiobacillus denitrificans (Td), Nitrosospira multiformes (Nm), Alkalilimnicola ehrlichii (Ae). I and II indicated cbbI and cbbII operons. Af23270 type strain from A. ferrooxidans. Af Fe1 strain from Kusano and Sugawara (1993)[4].

Click here for file

Additional file 3

Sequences used to generate LOGOS of the intergenic region between .

Click here for file