The molecular genetic mechanisms of sex determination are not known for most vertebrates, including zebrafish. We identified a mutation in the zebrafish fancl gene that causes homozygous mutants to develop as fertile males due to female-to-male sex reversal. Fancl is a member of the Fanconi Anemia/BRCA DNA repair pathway. Experiments showed that zebrafish fancl was expressed in developing germ cells in bipotential gonads at the critical time of sexual fate determination. Caspase-3 immunoassays revealed increased germ cell apoptosis in fancl mutants that compromised oocyte survival. In the absence of oocytes surviving through meiosis, somatic cells of mutant gonads did not maintain expression of the ovary gene cyp19a1a and did not down-regulate expression of the early testis gene amh; consequently, gonads masculinized and became testes. Remarkably, results showed that the introduction of a tp53 (p53) mutation into fancl mutants rescued the sex-reversal phenotype by reducing germ cell apoptosis and, thus, allowed fancl mutants to become fertile females. Our results show that Fancl function is not essential for spermatogonia and oogonia to become sperm or mature oocytes, but instead suggest that Fancl function is involved in the survival of developing oocytes through meiosis. This work reveals that Tp53-mediated germ cell apoptosis induces sex reversal after the mutation of a DNA-repair pathway gene by compromising the survival of oocytes and suggests the existence of an oocyte-derived signal that biases gonad fate towards the female developmental pathway and thereby controls zebrafish sex determination.
The molecular genetic mechanisms of sex determination are not known for most vertebrates, including zebrafish. We identified a mutation in the zebrafishfancl gene that causes homozygous mutants to develop as fertile males due to female-to-male sex reversal. Fancl is a member of the Fanconi Anemia/BRCA DNA repair pathway. Experiments showed that zebrafishfancl was expressed in developing germ cells in bipotential gonads at the critical time of sexual fate determination. Caspase-3 immunoassays revealed increased germ cell apoptosis in fancl mutants that compromised oocyte survival. In the absence of oocytes surviving through meiosis, somatic cells of mutant gonads did not maintain expression of the ovary gene cyp19a1a and did not down-regulate expression of the early testis gene amh; consequently, gonads masculinized and became testes. Remarkably, results showed that the introduction of a tp53 (p53) mutation into fancl mutants rescued the sex-reversal phenotype by reducing germ cell apoptosis and, thus, allowed fancl mutants to become fertile females. Our results show that Fancl function is not essential for spermatogonia and oogonia to become sperm or mature oocytes, but instead suggest that Fancl function is involved in the survival of developing oocytes through meiosis. This work reveals that Tp53-mediated germ cell apoptosis induces sex reversal after the mutation of a DNA-repair pathway gene by compromising the survival of oocytes and suggests the existence of an oocyte-derived signal that biases gonad fate towards the female developmental pathway and thereby controls zebrafish sex determination.
The existence of two differentiated sexes is common among animals and yet the mechanisms that determine sex are amazingly diverse. Among vertebrates, for instance, some species use primarily genetic factors and others rely on environmental factors to cause embryonic gonads to become testes or ovaries. Genetic sex determination (GSD) includes monogenic as well as polygenic systems, and in monogenic systems the sex-determining gene is usually found on sex chromosomes that evolved from a pair of autosomes after acquiring a novel sex-determining allele (reviewed in [1]). Mammals have an XX/XY sex chromosome system with males as the heterogametic sex, but birds and many reptiles have a ZZ/ZW sex chromosome system with females as the heterogametic sex. Among fish, both sex chromosome systems have been described [2]–[7]. In environmental sex determination (ESD), factors in the environment, such as temperature, control sexual fate [2]. GSD and ESD have long been thought of as distinct mechanisms, but recent data show regulation by both genetic and environmental factors within a single species [8]. In such species, the integration of genetic and environmental factors ultimately tips the bipotential gonads towards the male or the female fate (reviewed in [9]). For example, in medaka, a teleost fish with an XX/XY sex determination system, high temperatures can sex reverse XX females [10].Despite the vast diversity of primary sex-determining mechanisms, genes downstream in the sex determination pathway appear to be broadly conserved among vertebrates. It has been suggested that during evolution, different species recruited different downstream genes to be the major sex-determining gene, sometimes relatively recently, and that changes at the top of the sex-determining pathway appear to be better tolerated than changes at the bottom of the pathway because they are less likely to have deleterious effects [11]. In mammals, the Y chromosome gene SRY (Sex determining region Y) is at the top of the sex determination cascade [12]–[16] and acts as a genetic switch that triggers the bipotential gonad to initiate the male pathway (reviewed in [17]). SRY however, does not appear to exist beyond therian mammals [18]. In several groups, including mammals, Dmrt1 (doublesex and mab-3 related transcription factor 1) is a downstream gene in the male sex-determination pathway, but in medaka (Oryzias latipes), a duplicated copy of dmrt1 (called DMY or dmrt1by) is the major sex-determining gene [19], [20] and recent work has shown that dmrt1 is required for testis development in chickens [21]. Interestingly, dmrt1by is absent in most Oryzias species [22], showing that the upstream regulators of sex determination can change rapidly.Teleost fish show a broad diversity of sex determining mechanisms that range from genetic to environmental, from monogenic to polygenic, and from hermaphroditism to gonochorism (two distinct sexes) [2]. Zebrafish, like many other teleosts, have no obvious heteromorphic sex chromosomes [23]–[25]. Adult zebrafish have two differentiated sexes, but have been described to develop initially as juvenile hermaphrodites because all juveniles develop gonads with immature oocytes regardless of their definitive sex [26]–[28]. Zebrafish juvenile gonads contain immature oocytes that progress through oogenesis in about half of the individuals, which become females, but that degenerate in the other half of the individuals, which become males [26]–[28]. Oocytes begin to degenerate in a window of time (20–30 days post-fertilization (dpf)) that lasts several days and varies among individuals and among rearing conditions [26]–[31]. Because the sex of the zebrafish gonad drives secondary sex characters, gonadal sex determines the definitive sex of the fish. Zebrafish depleted of germ cells develop as infertile males [31]–[34] and it has been shown that the presence of germ cells is essential to maintain female fate in zebrafish [31]. We do not yet know, however, the primary genetic mechanisms that cause some zebrafish to become females and others to become males.To broaden our knowledge of the genetic mechanisms involved in zebrafish sex determination, we studied a fanclzebrafish mutant that develops exclusively as male. Fanconi Anemia complementation group L (Fancl, OMIM 608111), along with 12 other Fanconi Anemia proteins, facilitates cellular responses to a variety of stresses, including signals of DNA damage and apoptosis [35], [36] and belongs to the Fanconi Anemia/BRCA DNA repair pathway. In humans, mutations in any of these Fanconi genes can cause Fanconi Anemia (OMIM 227650), a recessive disease characterized by bone marrow failure, high risk of acute myeloid leukemia, development of squamous cell carcinomas of the head and neck, and developmental abnormalities in many organs including gonads, which causes hypogonadism, impaired gametogenesis, defective meiosis and sterility [37], [38]. Fancl is a member of the Fanconi Anemia core complex with a Plant Homeo Domain (PHD) that mono-ubiquitinates Fancd2 and Fanci [39], [40], which co-localize with BRCA1 and BRCA2 proteins in nuclear foci to stimulate DNA repair. A severe allele of humanFANCL causes a clinical phenotype that includes hematopoietic and skeletal abnormalities that are similar to, or more severe than, those typically observed in patients suffering from a defect upstream in the Fanconi Anemia pathway (H. Joenje, personal communication). We previously identified the zebrafish ortholog of the humanFANCL gene [41]. Here we show that fancl homozygous mutants develop solely as males and that the absence of fancl mutant females is not due to female-specific lethality but to female-to-male sex reversal. Results demonstrated that the sex reversal of fancl mutants is not due to the absence of germ cells, but to an abnormal increase of germ cell apoptosis that compromises survival of developing oocytes and masculinizes the gonads. We found that reducing germ cell apoptosis by introducing a Tp53 (p53 or tumor protein p53) mutation rescues the fancl sex reversal phenotype, and that many double mutants develop ovaries and become females. These results suggest the model that oocytes normally must progress through meiosis to signal the gonadal soma to maintain female development, and point to Tp53-mediated apoptosis of germ cells as a factor that could be targeted by environmental or genetic signals to modify zebrafish sex determination.
Results
A Tol2 Insertion Disrupts fancl Structure and Transcription
A zebrafishfancl mutant (allele HG10A, accession number AB353980) was generated by insertional mutagenesis in a Tol2 transposon-mediated enhancer trap screen [42]. Cloning and sequencing of genomic DNA surrounding the insertion revealed that the Tol2 construct was inserted into exon 12 of fancl, thereby disrupting the coding region of the PHD finger domain (Figure 1A and 1B), which is essential for Fancl function [39].
Figure 1
The Tol2 insertion HG10A disrupts fancl transcripts.
(A) Zebrafish fancl gene structure showing the Tol2 insertion in exon 12 and the position of primer pairs used for RT-PCR experiments (arrows, F1-R1; F2-R2). Numbered boxes represent exons and dashed boxes indicate untranslated regions. (B) Schematic representation from exon 11 to 13 of the wild-type fancl transcript (1.WT) and fancl mutant transcripts (2.fanclTol2 and 3.fanclDTol2). The PHD finger domain is highlighted in grey. The Tol2 insertion is shown in black and an arrowhead points to its insertion site in the amino acid sequence in B.2. Predicted protein sequences are shown; the highly conserved Cys and His residues are underlined and the critical Trp is double underlined. Asterisks represent premature stop codons. (C) RT-PCR using as template cDNA of adult testes shows that the 232 bp band containing the intact PHD domain in wild types (amplified by F2-R2 primers) is absent from fancl mutants. The smaller band (174 bp) amplified in fancl mutants corresponds to the fanclDTol2 transcript in B.3. Abbreviations: M, DNA-Marker.
The Tol2 insertion HG10A disrupts fancl transcripts.
(A) Zebrafishfancl gene structure showing the Tol2 insertion in exon 12 and the position of primer pairs used for RT-PCR experiments (arrows, F1-R1; F2-R2). Numbered boxes represent exons and dashed boxes indicate untranslated regions. (B) Schematic representation from exon 11 to 13 of the wild-type fancl transcript (1.WT) and fancl mutant transcripts (2.fanclTol2 and 3.fanclDTol2). The PHD finger domain is highlighted in grey. The Tol2 insertion is shown in black and an arrowhead points to its insertion site in the amino acid sequence in B.2. Predicted protein sequences are shown; the highly conserved Cys and His residues are underlined and the critical Trp is double underlined. Asterisks represent premature stop codons. (C) RT-PCR using as template cDNA of adult testes shows that the 232 bp band containing the intact PHD domain in wild types (amplified by F2-R2 primers) is absent from fancl mutants. The smaller band (174 bp) amplified in fancl mutants corresponds to the fanclDTol2 transcript in B.3. Abbreviations: M, DNA-Marker.To determine whether the HG10A Tol2 insertion disrupts fancl transcription, we performed reverse transcriptase-PCR experiments on cDNA isolated from testes of a homozygous fancl mutant adult. To learn if the Tol2 insert formed part of the fancl transcript, we designed a forward primer in exon1 and a reverse primer in the insertion (F1 and R1 in Figure 1A). The sequence of the PCR product revealed a fancl transcript that contained the Tol2 construct inserted after codon Q318 in exon 12 (arrowhead in Figure 1B line 2). This insertion is predicted to insert seven novel amino acid residues and to introduce a premature stop codon (asterisk in Figure 1B line 2), resulting in the loss of 41 of the 57 residues of the PHD finger domain. This loss eliminates the crucial tryptophan-337 (W, double underlined in the wild type (WT) in Figure 1B line 1) that is conserved in all PHD finger-type E3 ligases, as well as histidine-330 and five of the seven cysteines (H and C, underlined in Figure 1B line 1) that are highly conserved in PHD finger domains [39], [43], [44].To test if fancl mutants could produce fancl transcripts with an intact PHD domain due to elimination of the Tol2 insertion, we amplified the region encoding the PHD domain using primers flanking the Tol2 insertion (primers F2 in exon-11 and R2 in exon-13, Figure 1A). RT-PCR experiments revealed that fancl mutants lacked the expected 232 base pair (bp) PCR-product corresponding to the intact PHD domain found in wild-type siblings (WT in Figure 1C), but instead possessed a PCR-product of smaller size (174 bp) (fancl in Figure 1C). Cloning and sequencing of the F2-R2 products revealed that the small band from fancl mutants was a variant transcript that lacked both the first half of exon 12 and the Tol2 insertion (fanclΔTol2 in Figure 1B line 3). This fanclΔTol2 variant resulted from the joining of exon-11 to the second half of exon-12 due to a splice acceptor site that is newly created at the junction of the Tol2 insertion (Figure 1B line 3). The absence of the first half of exon-12 in the fanclΔTol2 transcript introduced a frameshift that generated an early stop codon (asterisk in Figure 1B line 3) leading to a predicted truncated protein lacking the entire PHD domain. These results show that homozygous fancl mutants have two variant transcripts, both of which encode products lacking an intact PHD finger domain shown to be essential for the ubiquitination function of Fancl [39].
The Lack of Homozygous fancl Mutant Females Is Due to Female-to-Male Sex Reversal
To characterize the fancl phenotype, we crossed fancl heterozygotes (called fancl
+/− below), and after genotyping the progeny by PCR, observed that all fancl homozygous mutants (called fancl
−/− below) developed exclusively as males, even though their wild-type and heterozygous siblings developed about as many females as males. Two alternative hypotheses could explain the lack of homozygous fancl mutant females: female-specific lethality or female-to-male sex reversal. To distinguish between these two hypotheses, we crossed female fancl
+/− heterozygotes to male fancl
−/− homozygotes. We raised 211 progeny to adulthood, determined their phenotypic sex according to sexually dimorphic characters including the color of the anal fin and body shape, and finally scored their fancl genotypes by PCR. Under normal conditions, this cross should give 50% heterozygotes (about half of which should be female), and 50% homozygous mutants (about half of which should be female), expecting a 1∶1∶1∶1 ratio of heterozygous females to heterozygous males to homozygous mutant females to homozygous mutant males. The fancl female death hypothesis predicts a 1∶1∶0∶1 ratio, or 66% heterozygotes and 33% homozygous mutants, but the sex reversal hypothesis, predicts a 1∶1∶0∶2 ratio, or equal proportions (50%∶50%) of homozygous mutants (all male) and heterozygotes (males plus females). Resulting genotypes revealed 46 fancl
+/− females: 62 fancl
+/− males: 0 fancl
−/− females: 103 fancl
−/− males, which showed that about half of the progeny were fancl homozygous mutants (103/211, 49%) and the other half were heterozygous for the fancl mutation (108/211, 51%) (Figure 2). These results had strong statistical support (chi-square likelihood ratio = 0.794, p-value >0.1), thus ruling out the hypothesis that homozygous fancl mutant females died. Results, however, were consistent with the hypothesis that animals that otherwise would have become females developed as males due to female-to-male sex reversal. Sex distributions within each genotype confirmed our previous observations that all fancl homozygous mutants developed as males (n = 103, 100%), and while approximately half of fancl heterozygous siblings developed as males (n = 62, 57%), the other half developed as females (n = 46, 43%) (Figure 2). These scores showed strong statistical support for the hypothesis that fancl mutants experienced female-to-male sex reversal (chi-square likelihood ratio = 73.946, p-value<0.0001). To exclude the possibility that some of the fancl mutants could have ovaries despite their external male phenotypic characters, we dissected the gonads of adult fancl homozygous mutants (n = 45), heterozygous females (n = 11) and heterozygous males (n = 29). In all cases, we found a perfect match between external sexual characters and gonadal sex. These results ruled out the possibility that fancl mutants masqueraded as males externally while having female gonads. We conclude that the HG10A Tol2 insertion into fancl induced a female-to-male sex reversal phenotype in zebrafish.
Figure 2
The absence of females in fancl homozygous mutants is due to sex reversal.
The bar graph represents percentages of expected (ex, grey bars) and observed (ob, black bars) females and males among 211 progeny from a cross of fancl heterozygous females (fancl
+/−) to fancl homozygous mutant males (fancl
−/−). Total numbers (n) and percentages (%) of animals in each category are indicated on the graph. The expected ratio of female heterozygotes to male heterozygotes to female homozygous mutants to male homozygous mutants is 1∶1∶1∶1, but we observed a ratio of about 1∶1∶0∶2 (46 fancl
+/− females: 62 fancl
+/− males: 0 fancl
−/− females: 103 fancl
−/− males). This result rules out the hypothesis that homozygous mutant females die, but is predicted by the hypothesis that homozygous mutants that otherwise would have become females develop instead as males.
The absence of females in fancl homozygous mutants is due to sex reversal.
The bar graph represents percentages of expected (ex, grey bars) and observed (ob, black bars) females and males among 211 progeny from a cross of fancl heterozygous females (fancl
+/−) to fancl homozygous mutant males (fancl
−/−). Total numbers (n) and percentages (%) of animals in each category are indicated on the graph. The expected ratio of female heterozygotes to male heterozygotes to female homozygous mutants to male homozygous mutants is 1∶1∶1∶1, but we observed a ratio of about 1∶1∶0∶2 (46 fancl
+/− females: 62 fancl
+/− males: 0 fancl
−/− females: 103 fancl
−/− males). This result rules out the hypothesis that homozygous mutant females die, but is predicted by the hypothesis that homozygous mutants that otherwise would have become females develop instead as males.
fancl Is Expressed in Germ Cells of Developing Gonads
Because germ cells play a fundamental role in controlling female sex determination in zebrafish [31], [32], we wondered if fancl could play a role in zebrafish germ cell development. To address this question, we first tested whether fancl is expressed in germ cells of wild-type zebrafish. We analyzed the expression pattern of fancl by in situ hybridization on sections of gonads at seven developmental time points encompassing representative stages of gonad development (Figure 3), including sexually undifferentiated and presumptively still bipotential gonads (e.g. 10, 17 and 23 days post-fertilization (dpf)); transitioning gonads (e.g. 26 dpf), sexually determined but still immature gonads (33 and 37 dpf), and mature adult gonads (6 months post-fertilization). Results showed no detectable fancl expression in undifferentiated wild-type gonads at 10 dpf (data not shown), but weak expression signal appeared in immature gonads at 17 dpf and 23 dpf (arrows in Figure 3A and 3B). In transitioning gonads at 26 dpf, fancl expression increased in developing germ cells (arrows in Figure 3C and 3D), and signal was clearly detected in the ooplasm of oocytes in the ovary-like gonad (arrow in Figure 3C). At 33 dpf and 37 dpf, immature gonads showed a clear morphology of ovaries or testes, and fancl expression signal was maintained in developing oocytes and spermatocytes (arrows in Figure 3E–3H).
Figure 3
Zebrafish germ cells express fancl during gonad development.
In situ hybridizations with fancl probe were performed on cryo-sections of wild-type animals at different stages of gonad development. Weak fancl expression signal (arrows) was detected in undifferentiated gonads at 17 days post-fertilization (dpf) (A) and 23 dpf (B). Signal became stronger in germ cells (arrows) of transitioning and immature ovaries (ooplasm of oocytes, arrows in C,E,G) and transitioning and immature testes (D,F,H) at 26, 33, and 37 dpf. In adults, fancl expression was restricted to germ cells, but signal intensity depended on the stage of germ cell differentiation. In adult ovaries (I), early stage IB oocytes (eIB) already showed low fancl expression and late stage IB oocytes (lIB) showed strong fancl signal in the ooplasm, suggesting that fancl expression initiated in early stage IB oocytes. As oogenesis progressed, ooplasm volume increased, cortical alveoli appeared (stage II), yolk accumulated (stage III), and fancl expression signal became diluted. In adult testes (J), fancl expression signal was detected in a subset of cells with large nuclei and morphology consistent with primary spermatocytes (sc), but signal was not detected in cells with small nuclei in an advanced stage of spermatogenesis (i.e. spermatids and sperm (sp)). Oocyte staging is according to [49] and [29]. Scale bar: 0.1 mm.
Zebrafish germ cells express fancl during gonad development.
In situ hybridizations with fancl probe were performed on cryo-sections of wild-type animals at different stages of gonad development. Weak fancl expression signal (arrows) was detected in undifferentiated gonads at 17 days post-fertilization (dpf) (A) and 23 dpf (B). Signal became stronger in germ cells (arrows) of transitioning and immature ovaries (ooplasm of oocytes, arrows in C,E,G) and transitioning and immature testes (D,F,H) at 26, 33, and 37 dpf. In adults, fancl expression was restricted to germ cells, but signal intensity depended on the stage of germ cell differentiation. In adult ovaries (I), early stage IB oocytes (eIB) already showed low fancl expression and late stage IB oocytes (lIB) showed strong fancl signal in the ooplasm, suggesting that fancl expression initiated in early stage IB oocytes. As oogenesis progressed, ooplasm volume increased, cortical alveoli appeared (stage II), yolk accumulated (stage III), and fancl expression signal became diluted. In adult testes (J), fancl expression signal was detected in a subset of cells with large nuclei and morphology consistent with primary spermatocytes (sc), but signal was not detected in cells with small nuclei in an advanced stage of spermatogenesis (i.e. spermatids and sperm (sp)). Oocyte staging is according to [49] and [29]. Scale bar: 0.1 mm.In adult gonads, fancl expression remained restricted to germ cells, but remarkably, the intensity of the detected signal differed depending on the stage of germ cell differentiation (Figure 3I and 3J). In ovaries, the weak fancl signal detected in early stage IB oocytes (eIB in Figure 3I) contrasted with the obvious strong signal in the ooplasm of late stage IB oocytes (lIB in Figure 3I). This result suggests that oocytes up-regulate fancl transcription before they transition into stage II. At later stages of oogenesis, fancl signal became less intense as oocytes progressed through oogenesis (Figure 3I). This reduction in staining intensity may be due to the dilution of transcript as oocytes increase in volume when cortical alveoli (also known as cortical granules in non-fish species) appeared in the ooplasm (stage II) and yolk began to accumulate (stage III) (Figure 3I). We detected low levels of fancl transcript at late stages of oocyte maturation (stage IV), suggesting that fancl is part of the maternal load of messenger RNA transcripts stored in the egg and passed along to embryos. This result agrees with our detection of fancl transcripts by RT-PCR and in situ hybridization experiments even at early developmental stages before the embryonic transcription machinery becomes active [41]. In testes, fancl expression appeared in spermatocytes (sc in Figure 3J), but not in more advanced stages of spermatogenesis, including spermatids and sperm (sp in Figure 3J). This result revealed the stage-specific expression of fancl during spermatogenesis.The finding that fancl was expressed in zebrafish germ cells during the time-window critical for gonad differentiation and sex determination (17 to 33 dpf) and was up-regulated in early stages of gametogenesis is consistent with the hypothesis that Fancl plays a specific role in germ cell development and suggests that its disruption might lead to the female-to-male sex reversal phenotype displayed by fancl mutants.
Gonads of fancl Mutants Have Germ Cells
Because zebrafish depleted of germ cells by dead end (dnd) morpholino (MO) knockdown [45], [46] develop exclusively as males [31], [32], and even though adult fancl mutants are fertile, we wondered if the female-to-male sex reversal of fancl mutants could be related to extremely low numbers of germ cells during stages of sex determination in juvenile mutants, or at least in those that otherwise would have developed as females and had been reversed to males. To answer this question, we performed gene expression analyses comparing gonads of fancl homozygous mutants (fancl), wild-type sibling controls (WT) and dnd-MO knockdown animals (dnd) at key stages in sex determination: 19 dpf (Figure 4A–4I), 26 dpf (Figure 4J–4X) and 33 dpf (Figure 4Y–4M'). Expression of the germ cell specific marker vasa
[47] revealed the presence of germ cells in gonads of all fancl mutants sectioned (n = 15) (Figure 4D, 4P, 4S, 4E', and 4H') and sibling controls (n = 13) (Figure 4A, 4J, 4M, 4Y, and 4B'), while all germ-cell depleted animals injected with dnd-MO (n = 16) lacked vasa signal (Figure 4G, 4V, and 4K'). The presence of substantial numbers of germ cells in all fancl mutants tested even at early stages of gonad development rules out the possibility that the near absence of germ cells is the cause of the female-to-male sex reversal in fancl mutants.
Figure 4
Gonads of fancl mutants have germ cells but fail to maintain a female gene expression profile.
Comparative expression analysis of the germ cell marker vasa, the early female somatic cell marker cyp19a1a, and the early male somatic cell marker amh in developing gonads of fancl homozygous mutants (fancl) and their wild-type sibling controls (WT), and in wild-type animals depleted of germ cells by dead end morpholino knockdown (dnd). To monitor the expression of vasa, cyp19a1a and amh, in situ hybridization (ISH) experiments were performed on adjacent cryo-sections of each animal at different stages of gonad development: undifferentiated gonads at 19 dpf (A–I), transitional juvenile gonads at 26 dpf (J–X) and post-transitional juvenile gonads at 33 dpf (Y-M'). Arrows point to examples of regions showing gene expression. ISH with vasa probe labeled germ cells in wild types (A,J,M,Y,B') and fancl mutants (D,P,S,E',H'), and confirmed the depletion of germ cells in dnd animals (G,V,K'). In undifferentiated gonads at 19 dpf, female and male markers were expressed in all genotypes: WT (B,C), fancl (E,F) and dnd knockdown animals (H,I), showing that the onset of cyp19a1a and amh expression does not depend on germ cells or on fancl function. At 26 dpf, controls had started to enter either the male pathway by down-regulating cyp19a1a and up-regulating amh (K,L) or conversely into the female pathway by up-regulating cyp19a1a and down-regulating amh (N,O), correlated with the presence of few or many oocytes, respectively. In contrast, most 26 dpf fancl mutants already showed a male expression profile by the absence of cyp19a1a and the up-regulation of amh (Q,R) and only one fancl mutant showed a low number of cyp19a1a-expressing cells while nevertheless maintaining high amh expression (T,U). Except for vasa, expression profiles of 26 dpf dnd knockdown gonads were similar to fancl mutants (W,X). At 33 dpf, wild-type controls showed either a male expression profile (no cyp19a1a and high amh expression, Z,A') or a female expression profile (high cyp19a1a and no amh expression, C',D'). Most 33 dpf fancl mutants showed a male expression profile (F',G'), even if gonads maintained an ovary-like morphology (I',J'). All 33 dpf dnd animals showed a male expression profile (L',M'). Scale bar: 0.1 mm (A).
Gonads of fancl mutants have germ cells but fail to maintain a female gene expression profile.
Comparative expression analysis of the germ cell marker vasa, the early female somatic cell marker cyp19a1a, and the early male somatic cell marker amh in developing gonads of fancl homozygous mutants (fancl) and their wild-type sibling controls (WT), and in wild-type animals depleted of germ cells by dead end morpholino knockdown (dnd). To monitor the expression of vasa, cyp19a1a and amh, in situ hybridization (ISH) experiments were performed on adjacent cryo-sections of each animal at different stages of gonad development: undifferentiated gonads at 19 dpf (A–I), transitional juvenile gonads at 26 dpf (J–X) and post-transitional juvenile gonads at 33 dpf (Y-M'). Arrows point to examples of regions showing gene expression. ISH with vasa probe labeled germ cells in wild types (A,J,M,Y,B') and fancl mutants (D,P,S,E',H'), and confirmed the depletion of germ cells in dnd animals (G,V,K'). In undifferentiated gonads at 19 dpf, female and male markers were expressed in all genotypes: WT (B,C), fancl (E,F) and dnd knockdown animals (H,I), showing that the onset of cyp19a1a and amh expression does not depend on germ cells or on fancl function. At 26 dpf, controls had started to enter either the male pathway by down-regulating cyp19a1a and up-regulating amh (K,L) or conversely into the female pathway by up-regulating cyp19a1a and down-regulating amh (N,O), correlated with the presence of few or many oocytes, respectively. In contrast, most 26 dpffancl mutants already showed a male expression profile by the absence of cyp19a1a and the up-regulation of amh (Q,R) and only one fancl mutant showed a low number of cyp19a1a-expressing cells while nevertheless maintaining high amh expression (T,U). Except for vasa, expression profiles of 26 dpf dnd knockdown gonads were similar to fancl mutants (W,X). At 33 dpf, wild-type controls showed either a male expression profile (no cyp19a1a and high amh expression, Z,A') or a female expression profile (high cyp19a1a and no amh expression, C',D'). Most 33 dpffancl mutants showed a male expression profile (F',G'), even if gonads maintained an ovary-like morphology (I',J'). All 33 dpf dnd animals showed a male expression profile (L',M'). Scale bar: 0.1 mm (A).
fancl Mutants Fail to Maintain cyp19a1a Expression and Fail to Down-Regulate amh Expression
Because all fancl mutants developed as males, we wondered if fancl mutants embark upon the male pathway from the beginning of gonad development, or whether they follow a normal bipotential pathway of development that later derails exclusively to the male pathway. To address these alternatives, we used the expression of cyp19a1a (cytochrome P450 family 19 subfamily A polypeptide 1a) and amh (anti-Mullerian hormone), which are the earliest sex-specific somatic gonadal cell markers known for ovary and testis, respectively, to monitor development before gonads were sexually differentiated at the morphological level [29], [31], [48].In 19 dpf undifferentiated gonads, somatic cells of fancl mutants, as well as those of wild-type controls and dnd-MO animals, expressed both the female marker cyp19a1a and the male marker amh (Figure 4B, 4C, 4E, 4F, 4H, and 4I). This result showed no indication that fancl mutant gonads were developing abnormally, which suggests that fancl mutant gonads initially embark upon the normal bipotential pathway of development, and later derail into the male pathway. The fact that individual gonads in both fancl mutants and WT siblings expressed both cyp19a1a and amh, as did animals lacking germ cells, suggests that the onset of expression of these somatic cell markers is independent of germ cell derived signals. These results extend to a much earlier age than previously noted (19 dpf versus 35 dpf [31]) the time at which gonads depleted of germ cells express amh.At 26 dpf, different individual WT juveniles showed different degrees of sexual differentiation, suggesting that this age is within the transitional period of sex determination. Some WT animals had gonads with few oocytes, low expression of cyp19a1a and up-regulation of amh (Figure 4K and 4L), while others had gonads with many developing oocytes, up-regulation of cyp19a1a and absence of amh signal (Figure 4N and 4O). In contrast to WT sibling controls, at 26 dpf, all fancl mutants had gonads with no ooctyes or just a few small oocytes, and most of them (4 out of 5) lacked expression of cyp19a1a and showed up-regulation of amh (Figure 4Q and 4R). Most juvenile fancl mutants at 26 dpf, therefore, had completed the transitional period of sex determination, and had embarked on the male pathway. Only one of the five fancl mutants analyzed retained a remnant of a few cyp19a1a-expressing cells despite the presence of a considerable number of amh-expressing cells (Figure 4T and 4U); this animal was probably still transitioning towards the male pathway. In 26 dpf dnd-MO animals, all gonads were depleted of germ cells, and like fancl mutants, showed no cells or few cells expressing cyp19a1a and many cells up-regulated for the male marker amh (Figure 4W and 4X). Therefore, most fancl mutants and dnd-MO animals tipped the fate of the bipotential gonad towards the male pathway earlier than WT controls.At 33 dpf, WT juveniles had already passed the transitional period of sex determination. Males had immature testes with no oocytes, no cyp19a1a-expressing cells and many cells with high levels of amh expression (Figure 4Z and 4A'), and females had immature ovaries, with cyp19a1a-positive somatic cells surrounding oocytes but no amh-expressing cells (Figure 4C' and 4D'). In contrast to WT sibling controls, at 33 dpf, most fancl mutant gonads (6 of 8) showed clear testes morphology, including the absence of cyp19a1a expression and up-regulation of amh expression (Figure 4F' and 4G'). Interestingly, we found two fancl mutants that still had some oocytes; in contrast to WT controls, however, these individuals showed low cyp19a1a expression and high amh signal (Figure 4I' and 4J'), which would be expected if these two fancl mutants were putative females that were in the process of sex-reversing to males. At 33 dpf, all fancl (Figure 4G' and 4J') and dnd-MO animals (Figure 4M') showed the typical male-specific up-regulation of amh. In contrast to 33 dpf dnd-MO animals, all of which lacked cyp19a1a expression (Figure 4L'), fancl mutants that still retained some oocytes showed low levels of cyp19a1a expression (Figure 4I'). These results would be expected if the presence of oocytes is essential to maintain cyp19a1a expression, and suggested the hypothesis that the female-to-male sex reversal of fancl mutants is due to abnormal development of oocytes that leads to a failure of somatic cells of the gonad to maintain cyp19a1a expression and to down-regulate amh expression.
Oocytes Fail to Progress through Meiosis in fancl Mutants
Because the Fanconi Anemia/BRCA system is involved in the repair of damaged DNA, such as that originating in meiotic recombination, we hypothesized that oocyte development is altered in fancl mutants. To test this hypothesis, we performed a histological analysis of fancl and wild-type gonad sections stained with hematoxylin and eosin at different stages of development to follow the progression of germ cells through meiosis (Figure 5).
Figure 5
Juvenile gonads of fancl mutants contain oocytes that fail to progress through meiosis.
Histological comparison of germ cell development in fancl homozygous mutants (fancl) and wild-type sibling controls (WT), by hematoxylin and eosin staining of gonads at different stages of development: undifferentiated, 19–22 dpf (A,B), transitional juveniles, 26 dpf (C–F), post-transitional juveniles, 32 dpf (G–I) and adults (J–L). At 19–22 dpf, no morphological differences were observed between WT (n = 10) and fancl animals (n = 10) and both genotypes showed early stage IB perinucleolar oocytes (epo in A,B). At 26 dpf, the first histological differences between WT and fancl became apparent. Most WT controls (7 out of 9 individuals) had abundant enlarged perinucleolar oocytes that had progressed from early stage IB to late stage IB (lpo in C), and only two lacked late stage IB oocytes (E). In contrast, only one of twelve fancl mutant animals had enlarged oocytes at late stage IB (lpo in D), while the majority (11 out of 12) lacked late stage IB oocytes (F). Both wild-type and fancl mutant gonads that lacked oocytes possessed spermatogonia (sg in E,F). Remarkably, in contrast to wild types, fancl mutants showed abundant pyknotic cells (pc) at 26 dpf (D,F). At 32 dpf, gonads showed unmistakably the morphology of either ovary or testis, and in wild-type controls, approximately half of the animals (6 out of 11) had ovaries with perinucleolar oocytes at late stage IB (lpo in G) and the other half (5 out of 11) showed the typical testis morphology with abundant spermatogonia (sg) and spermatocytes (sc) arranged in cysts (dashed line in H). In contrast to controls, all fancl mutants (n = 8) had gonads that lacked perinucleolar oocytes, and showed testis morphology with groups of spermatogonia (sg) and spermatocytes (sc) (I). Finally, in adults, half of the WT controls (5 out of 10) had mature ovaries filled with oocytes at different stages of oogenesis: stage IA, IB, II, III and IV (J), and the other half (5 out of 10) had mature testes (K), in contrast to fancl mutants in which all animals (n = 7), had mature testes filled with germ cells at different stages of spermatogenesis: spermatogonia (sg), spermatocytes (sc) and sperm (sp) (L), and none of the seven fancl mutants had ovaries. Oocyte stages described according to [49]; Spermatogenesis stages described according to [28]. Scale bar: 0.02 mm (as in A, except for J).
Juvenile gonads of fancl mutants contain oocytes that fail to progress through meiosis.
Histological comparison of germ cell development in fancl homozygous mutants (fancl) and wild-type sibling controls (WT), by hematoxylin and eosin staining of gonads at different stages of development: undifferentiated, 19–22 dpf (A,B), transitional juveniles, 26 dpf (C–F), post-transitional juveniles, 32 dpf (G–I) and adults (J–L). At 19–22 dpf, no morphological differences were observed between WT (n = 10) and fancl animals (n = 10) and both genotypes showed early stage IB perinucleolar oocytes (epo in A,B). At 26 dpf, the first histological differences between WT and fancl became apparent. Most WT controls (7 out of 9 individuals) had abundant enlarged perinucleolar oocytes that had progressed from early stage IB to late stage IB (lpo in C), and only two lacked late stage IB oocytes (E). In contrast, only one of twelve fancl mutant animals had enlarged oocytes at late stage IB (lpo in D), while the majority (11 out of 12) lacked late stage IB oocytes (F). Both wild-type and fancl mutant gonads that lacked oocytes possessed spermatogonia (sg in E,F). Remarkably, in contrast to wild types, fancl mutants showed abundant pyknotic cells (pc) at 26 dpf (D,F). At 32 dpf, gonads showed unmistakably the morphology of either ovary or testis, and in wild-type controls, approximately half of the animals (6 out of 11) had ovaries with perinucleolar oocytes at late stage IB (lpo in G) and the other half (5 out of 11) showed the typical testis morphology with abundant spermatogonia (sg) and spermatocytes (sc) arranged in cysts (dashed line in H). In contrast to controls, all fancl mutants (n = 8) had gonads that lacked perinucleolar oocytes, and showed testis morphology with groups of spermatogonia (sg) and spermatocytes (sc) (I). Finally, in adults, half of the WT controls (5 out of 10) had mature ovaries filled with oocytes at different stages of oogenesis: stage IA, IB, II, III and IV (J), and the other half (5 out of 10) had mature testes (K), in contrast to fancl mutants in which all animals (n = 7), had mature testes filled with germ cells at different stages of spermatogenesis: spermatogonia (sg), spermatocytes (sc) and sperm (sp) (L), and none of the seven fancl mutants had ovaries. Oocyte stages described according to [49]; Spermatogenesis stages described according to [28]. Scale bar: 0.02 mm (as in A, except for J).At 19–22 dpf, WT sibling controls and fancl homozygous mutants had undifferentiated gonads with no obvious morphological differences between genotypes. Gonads of both genotypes contained stage IB perinucleolar oocytes (arrows in Figure 5A and 5B), as indicated by the presence of nucleoli at the periphery of the nuclei [49]. Shortly after the beginning of stage IB, chromosomes decondense and form lampbrush chromosomes [50], which occurs during the diplotene stage of meiosis I as the synaptonemal complex dissolves and recombination nodules keep homologous chromosomes together [51]. We define “early” perinucleolar oocytes (epo) as stage IB oocytes that have not yet decondensed their chromosomes, and “late” perinucleolar oocytes (lpo) as stage IB oocytes that have already formed lampbrush chromosomes and entered the diplotene stage of meiosis I. Gonads of fancl (10 individuals) and WT siblings (10 individuals) at 19–22 dpf both had early (epo in Figure 5A and 5B) but not late stage IB oocytes, indicating that at this time, oocytes had not yet entered the diplotene stage of meiosis I in either genotype.At 26 dpf (Figure 5C–5F), most WT controls (7 of 9 individuals) showed late perinucleolar oocytes that had progressed through meiosis from early to late stage IB (lpo in Figure 5C), in which lampbrush chromosomes were visible, indicating that recombination had completed and oocytes had already entered the diplotene stage of meiosis I [51]. In contrast to WT, most fancl mutants (11 of 12) lacked oocytes at late stage IB (Figure 5F), indicating that oocytes in fancl mutants failed to progress through meiosis to the diplotene stage. Only one of the twelve fancl mutants showed late stage IB oocytes (lpo in Figure 5D), and this individual also contained pyknotic cells (pc in Figure 5D), some of which were identifiable as oocytes and some of which were of unclear origin due to their advanced stage in the process of degeneration. The fancl mutants that lacked oocytes (11 of 12) also had numerous pyknotic cells (pc in Figure 5F), and showed groups of spermatogonia (sg in Figure 5F), which were also found in WT animals (sg in Figure 5E) that had gonads with a testis-like morphology.The difference between fancl and WT controls became accentuated at 32 dpf (Figure 5G–5I). At 32 dpf, all fancl gonads lacked oocytes and had become immature testes with spermatogonia and spermatocytes (sg and sc in Figure 5I), but only about half of WT siblings had immature ovaries with late stage IB oocytes (lpo in Figure 5G) while the other half had immature testes (Figure 5H).At adult stages (Figure 5J–5L), consistent with results observed at 32 dpf, all fancl mutants lacked oocytes and had mature testes filled with germ cells at different stages of spermatogenesis (Figure 5L). In contrast, half of the WT controls had mature ovaries filled with oocytes at different stages of oogenesis (Figure 5J), and the other half had mature testes (Figure 5K).This analysis of developmental histology revealed that in fancl mutants, oocytes failed to progress through meiosis and rarely reached the diplotene stage. Interestingly, in contrast to wild types, we observed abundant pyknotic cells in all fancl mutant gonads at 26 dpf (pc in Figure 5D and 5F), suggesting that the absence of oocytes in older fancl mutants could be related to increased germ cell apoptosis associated with the failure to complete meiosis.
fancl Mutants Show an Abnormal Increase of Germ Cell Apoptosis
To examine whether germ cell apoptosis could be the cause of both the abnormally high number of pyknotic germ cells in fancl juvenile gonads and the absence of oocytes at late stage IB, we used immunoassay to examine the activation of Caspase-3, an early marker of apoptosis [52], [53]. We scored the number of Caspase-3-positive cells in 70 gonadal cross-sections in each of 12 individuals: six wild-type sibling controls (Figure 6A) and six fancl homozygous mutants (Figure 6B) at 25 dpf, a stage within the time-window critical for sex determination. The morphology of the Caspase-3-positive cells detected in the immunoassay (shown in red in Figure 6B), and the subsequent staining of the same slides with hematoxylin and eosin (data not shown) confirmed that the Caspase-3-positive cells were germ cells and not somatic cells, and corroborated our earlier finding that germ cells that appeared to be pyknotic in our histological analysis are indeed apoptotic cells. In many cases, the shape and size of the apoptotic Caspase-3-positive cells was appropriate for oocytes, however, we cannot rule out the possibility that some Caspase-3-positive cells might be undifferentiated gonial cells (oogonia or spermatogonia). Results revealed that the average number of apoptotic germ cells in gonads of fancl
−/− mutants was almost three fold higher than in gonads of wild-type sibling controls (Figure 6C) (t-test p = 0.0058, statistically significant at the p = 0.01 level). Therefore, these results suggest the hypothesis that the absence of oocytes in fancl mutants is caused by increased apoptosis of germ cells, especially oocytes, which ultimately leads to the sex reversal phenotype observed in fancl mutants.
Figure 6
Increased germ cell apoptosis in fancl mutants at 25 dpf.
Immunodetection of apoptosis by anti-active Caspase-3 in paraffin sections of gonads of wild-type sibling controls (WT) and fancl homozygous mutants (fancl-/-) at 25 dpf (A,B). Presence of Caspase-3-positive cells (shown in red) was lower in gonads of WT (A) than in fancl mutants (B). Gonads outlined by a dashed line (A,B). Bar graph representing the average number of Caspase-3-positive germ cells in each genotype: wild-type sibling controls (WT; n = 6) and fancl homozygous mutants (fancl-/-; n = 6) at 25 dpf (C). Results showed that the average number of apoptotic germ cells in fancl mutants (x– = 99±43) was about three fold higher than in wild-type sibling controls (x– = 35±14), revealing an abnormal increase of germ cell apoptosis in fancl mutants at 25 dpf, a critical period for sex determination (C).
Increased germ cell apoptosis in fancl mutants at 25 dpf.
Immunodetection of apoptosis by anti-active Caspase-3 in paraffin sections of gonads of wild-type sibling controls (WT) and fancl homozygous mutants (fancl-/-) at 25 dpf (A,B). Presence of Caspase-3-positive cells (shown in red) was lower in gonads of WT (A) than in fancl mutants (B). Gonads outlined by a dashed line (A,B). Bar graph representing the average number of Caspase-3-positive germ cells in each genotype: wild-type sibling controls (WT; n = 6) and fancl homozygous mutants (fancl-/-; n = 6) at 25 dpf (C). Results showed that the average number of apoptotic germ cells in fancl mutants (x– = 99±43) was about three fold higher than in wild-type sibling controls (x– = 35±14), revealing an abnormal increase of germ cell apoptosis in fancl mutants at 25 dpf, a critical period for sex determination (C).
Mutation of tp53 Rescues the fancl Female-to-Male Sex Reversal Phenotype by Reducing Germ Cell Apoptosis
The hypothesis that the female-to-male sex reversal of fancl mutants is caused by increased germ cell apoptosis predicts that blocking apoptotic pathways should rescue the sex reversal phenotype. Because tumor protein Tp53 (alias p53) is an important activator of apoptosis [54], we can inhibit apoptosis in fancl mutants by introducing a tp53 mutation into the fancl mutant line. To generate double mutants, we crossed a zebrafish female carrier of the hypomorphic mutation tp53
[55] to a male homozygous fancl mutant, identified double heterozygotes (fancl
;tp53
called fancl;tp53 below) among F1 progeny by PCR, and in-crossed double heterozygotes to obtain an F2 population containing double homozygous mutants. Among the F2 raised to adulthood, 44/171 (25.7%), or about a quarter, were fancl homozygous mutants. Among these 44 fancl homozygous mutants, 15 were also tp53 homozygous mutants, from which 11 developed as females and four as males (Figure 7A). All of the fancl homozygous mutant siblings (n = 29) that were either homozygous wild type for tp53 (n = 8) or heterozygous for the tp53 mutation (n = 21) developed exclusively as males (Figure 7A). This result shows that the female-to-male sex reversal phenotype characteristic of fancl mutants was rescued in fancl doubly homozygous mutants (Figure 7A). The sex-ratio scores observed in the three genotypes showed strong statistical support (chi-square likelihood ratio = 32.088, p-value<0.0001) for the hypothesis that the presence of females in fancl;tp53 double mutants and the absence of females in the other tp53 genotypes (fancl;tp53 and fancl;tp53) is linked to the tp53 genotype. Histological analyses of fancl females corroborated the conclusion that external female sex characteristics were accompanied by ovaries filled with normal oocytes at all stages of development similar to fancl; tp53 wild-type female siblings (Figure 7B and 7C).
Figure 7
Mutation of tp53 rescues the female-to-male sex-reversal phenotype of fancl mutants by reducing germ cell apoptosis.
(A) The distribution of individuals of different tp53 genotypes among fancl
homozygous mutant progeny (n = 44) from an in-cross of double heterozygotes (fancl
;tp53
) is shown in a bar graph representing the number of females (purple bar) and males (green bars) distributed according to their tp53 genotypes (wild type, heterozygous or homozygous mutant). Rescue of female-to-male sex reversal was observed exclusively in fancl
mutant homozygotes that were also homozygous for the tp53 mutation (n = 15): 11 fancl
;tp53
animals developed as females and 4 developed as males. No rescue was observed in fancl mutants that were either wild-type (n = 8; fancl
;tp53
) or heterozygous for the tp53 mutation (n = 21; fancl
;tp53
), which all developed as males. Total numbers of animals (n) are indicated on the graph per each sex in each genotype. (B,C) Hematoxylin and eosin staining of gonad sections of wild-type female (fancl
+/+;tp53
+/+, B) and rescued female doubly homozygous mutant (fancl
−/−;tp53
−/−, C) at adult stage, revealed the presence of morphologically normal ovaries in the rescued fancl
−/−;tp53
−/− females. Ovaries of both genotypes had oocytes at different stages of development (i.e.: IB, II, III, IV). Scale bar: 0.1 mm (B,C). (D,E,F) tp53 mutation reduces germ cell apoptosis in fancl mutants at 25 dpf. Immunodetection of apoptosis by anti-active Caspase-3 in paraffin sections of gonads of fancl homozygous mutants simultaneously homozygous wild-type (D) or homozygous mutant for tp53 (E) at 25 dpf. Dashed lines outline gonad boundaries (D,E). (F) Bar graph representing the average number of Caspase-3-positive germ cells in fancl;tp53 (n = 5) and fancl;tp53 (n = 5) at 25 dpf. Results showed that the average number of apoptotic germ cells was approximately three fold lower in doubly homozygous mutant animals (fancl;tp53 x– = 30±56) than their fancl
−/− mutant siblings that were wild-type for tp53 (fancl;tp53; x– = 105±71). This result shows that tp53 mutation decreased the number of apoptotic germ cells in fancl mutants at 25 dpf and demonstrates that the abnormal increase in germ cell apoptosis in fancl mutants that compromised the survival of developing oocytes was the mechanism responsible for the female-to-male sex reversal.
Mutation of tp53 rescues the female-to-male sex-reversal phenotype of fancl mutants by reducing germ cell apoptosis.
(A) The distribution of individuals of different tp53 genotypes among fancl
homozygous mutant progeny (n = 44) from an in-cross of double heterozygotes (fancl
;tp53
) is shown in a bar graph representing the number of females (purple bar) and males (green bars) distributed according to their tp53 genotypes (wild type, heterozygous or homozygous mutant). Rescue of female-to-male sex reversal was observed exclusively in fancl
mutant homozygotes that were also homozygous for the tp53 mutation (n = 15): 11 fancl
;tp53
animals developed as females and 4 developed as males. No rescue was observed in fancl mutants that were either wild-type (n = 8; fancl
;tp53
) or heterozygous for the tp53 mutation (n = 21; fancl
;tp53
), which all developed as males. Total numbers of animals (n) are indicated on the graph per each sex in each genotype. (B,C) Hematoxylin and eosin staining of gonad sections of wild-type female (fancl
+/+;tp53
+/+, B) and rescued female doubly homozygous mutant (fancl
−/−;tp53
−/−, C) at adult stage, revealed the presence of morphologically normal ovaries in the rescued fancl
−/−;tp53
−/− females. Ovaries of both genotypes had oocytes at different stages of development (i.e.: IB, II, III, IV). Scale bar: 0.1 mm (B,C). (D,E,F) tp53 mutation reduces germ cell apoptosis in fancl mutants at 25 dpf. Immunodetection of apoptosis by anti-active Caspase-3 in paraffin sections of gonads of fancl homozygous mutants simultaneously homozygous wild-type (D) or homozygous mutant for tp53 (E) at 25 dpf. Dashed lines outline gonad boundaries (D,E). (F) Bar graph representing the average number of Caspase-3-positive germ cells in fancl;tp53 (n = 5) and fancl;tp53 (n = 5) at 25 dpf. Results showed that the average number of apoptotic germ cells was approximately three fold lower in doubly homozygous mutant animals (fancl;tp53 x– = 30±56) than their fancl
−/− mutant siblings that were wild-type for tp53 (fancl;tp53; x– = 105±71). This result shows that tp53 mutation decreased the number of apoptotic germ cells in fancl mutants at 25 dpf and demonstrates that the abnormal increase in germ cell apoptosis in fancl mutants that compromised the survival of developing oocytes was the mechanism responsible for the female-to-male sex reversal.To determine whether the tp53 mutation rescues fancl sex reversal phenotype by reducing germ cell apoptosis, we studied the activation of Caspase-3 in histological sections of fancl homozygous mutants that were either homozygous for the tp53 mutation (n = 5) or wild-type for the tp53 mutation (n = 5) at 25 dpf, a critical stage for sex determination (Figure 7D and 7F). Counts of Caspase-3-positive cells of 70 gonadal cross-sections per animal in these ten animals showed that double homozygotes (fancl
−/−;tp53
−/−) had an average number of apoptotic germ cells approximately three fold lower (Figure 7E and 7F) than their fancl
−/− mutant siblings that were homozygous wild-type for the tp53 mutation (Figure 7D and 7F) (t-test p = 0.1032, approaching statistical significance given the small sample size). These results support the hypothesis that the tp53 mutation rescues the fancl female-to-male sex reversal phenotype by decreasing the number of apoptotic germ cells, thereby counteracting the abnormally high frequency of apoptotic germ cells observed in fancl homozygous mutants. This result is consistent with the hypothesis that the fancl mutation causes the female-to-male sex reversal phenotype by increasing germ cell apoptosis during a critical time for sex determination.
Discussion
Despite the broad use of zebrafish as a model for vertebrate development, its sex determination mechanism remains poorly understood. In this work, we characterize a zebrafishfancl mutation that causes homozygotes to develop exclusively as fertile males due to female-to-male sex reversal. We show that an increase of germ cell apoptosis in mutants compromises the survival of oocytes undergoing meiosis, which may imply an alteration of the signaling between germ cells and somatic cells of the gonads, masculinization of gonads to form testes, and the development of a male phenotype. We show that the mutant sex reversal phenotype can be rescued by reducing Tp53-mediated apoptosis, which allows oocyte survival, and suggests a pivotal role of germ cell apoptosis in zebrafish sex determination. Extending these results from fancl mutants to wild-type zebrafish, we propose a model in which genetic and environmental sex determining factors act to increase or decrease germ cell apoptosis and oocyte survival and thus alters the strength of a hypothetical oocyte-derived signal that maintains expression of female genes in somatic cells and hence determines sex in zebrafish.
Female-to-Male Sex Reversal in Zebrafish fancl Mutants Is Due to the Failure of Oocytes to Progress through Meiosis
Fancl protein helps mediate cellular responses to a variety of stresses, especially DNA damage and apoptosis [36]. Mutations in humanFANCL lead to Fanconi Anemia (FA) [39], a disease of bone marrow failure, enormous risks of cancer, and hypogonadism and impaired fertility (reviewed in [38]). Likewise, the most consistent FA phenotype in murineFA gene knockout models (e.g. Fancc, Fancg, Fanca, Fancd1, Fancd2), is hypogonadism, impaired gametogenesis and infertility (reviewed in [56]). Our work shows that the disruption of fancl in zebrafish causes homozygous mutants to develop exclusively as males due to female-to-male sex reversal rather than female-specific lethality. This is the first demonstration, to our knowledge, that a mutation in a Fanconi gene can cause female-to-male sex reversal.Our work revealed expression of fancl in germ cells during zebrafish gonad differentiation, which is consistent with a role of Fancl in germ cell development. Other species, such as mouse, also express fancl in their germ cells [57], [58], suggesting a conserved role of Fancl in vertebrate germ cell development. Previous work had shown exclusive male development in zebrafish lacking germ cells due to total loss-of-function of dead end, nanos, ziwi, or zili
[31]–[34], [59]. We demonstrate here, however, that germ cells are present throughout the entire life in all individuals homozygous for the fancl mutation, which rules out the possibility that male development in fancl mutants that otherwise would have become females is due to lack of germ cells. Work presented here shows specifically that the mere presence of germ cells is insufficient to feminize gonads, but rather, it suggests that oocytes passing through meiosis are essential to support differentiation of ovaries. Our results are in agreement with previous suggestions that zili mutants all become phenotypic males probably due to the lack of oocytes at week 4 during the window of sex determination rather than due to the total loss of germ cells at week 8 [59]. Homozygous fancl mutants, in which germ cells are always present, provide a useful tool to better understand the role of germ cell-soma signaling that tips gonad fate towards the male pathway.Comparison of sex-specific gonadal markers among fancl mutants, WT controls and dnd-MO animals, which lack germ cells, reveals that the onset of expression of the female marker cyp19a1a and the early male marker amh in individual undifferentiated gonads at 19 dpf is similar in all genotypes. This result supports the conclusion that the onset of early somatic makers is independent of germ cell signaling [31]. These results also show that undifferentiated gonads of fancl mutants initially develop as normal bipotential “juvenile ovaries” containing oocytes at early stage IB with no obvious histological differences from gonads of WT controls.During the critical time-window for sex determination in zebrafish (e.g. 26 dpf), however, fancl mutant gonads become morphologically different from wild-type gonads. Wild-type animals have perinucleolar oocytes that progress through meiosis from early stage IB to late stage IB with obvious lampbrush chromosomes, indicating that recombination is complete and oocytes are at the diplotene stage of meiosis I, in which homologous chromosomes begin to separate but remain attached at chiasmata [51]. In contrast to wild types, most fancl mutants lack late stage IB oocytes, indicating that oocytes fail to progress beyond pachytene stage, when recombination occurs, and do not enter diplotene. Our results show that the levels of fancl transcripts are regulated during the process of gametogenesis because fancl expression up-regulates in oocytes transitioning from early to late stage IB (Figure 3I). Consistent with this result, a large-scale gene expression profiling study of developing ovaries in trout found fancl in a group of many genes that were over-expressed when the first oocyte meioses were observed [60]. In fanclzebrafish mutants, the failure of oocytes to transition from early to late stage IB suggests that Fancl might promote the successful progression of oocytes through meiosis I or the survival of meiotic oocytes. The FA pathway is apparently involved in meiosis because in mouse, Fanca is expressed in pachytene spermatocytes and Fanca knockout mice have elevated rates of mis-paired meiotic chromosomes and increased germ cell apoptosis [37]. Whether this effect on meiosis depends on the known role of FA proteins in homologous recombination in somatic cells [61] or some other aspect of meiosis is as yet unknown.The failure of oocytes to progress through meiosis in fancl mutants correlates with the observation that most mutant gonads do not express the female somatic marker cyp19a1a, but instead up-regulate the male somatic marker amh. Interestingly, we found a few fancl mutants with some late stage IB oocytes accompanied by expression of cyp19a1a, but also showing high expression levels of amh; we interpret these animals as females whose progress towards ovary development was being derailed due to the mutation of fancl. These results would be expected if oocytes are essential to maintain cyp19a1a expression.We hypothesize that in juvenile fancl mutants, the absence of oocytes progressing through meiosis alters oocyte signaling to the soma that maintains the female program. Without this signal, somatic cells do not maintain the expression of cyp19a1a, do not suppress amh expression, and as a result, gonads do not become ovaries but instead become masculinized and form testes. It is likely that this signal arising from meiotic oocytes is essential for somatic pre-granulosa cyp19a1a-expressing cells to proliferate and to differentiate as mature granulosa cells. In mammals, it has been suggested that meiotic oocytes reinforce ovarian fate by antagonizing the testis pathway [62], [63]. Studies on gonadal somatic cell lineages in mice and medaka, have shown that granulosa cells of the ovary and Sertoli cells of the testis develop from a common precursor [64]–[66]. It is possible that mammalian meiotic oocytes reinforce the ovarian pathway by preventing granulosa cells from trans-differentiating into Sertoli-like cells, because the loss of oocytes in mammals induces maturing follicular cells (or pre-granulosa cells) to acquire Sertoli-like cells characteristics [67]. We hypothesize that the action of meiotic oocytes in preventing pre-granulosa cells from trans-differentiating into Sertoli-like cells is an ancestral function that has been conserved in mammals and fishes. Although our experiments do not address the question of whether somatic cells trans-differentiate in fancl mutant gonads, our results are consistent with the hypothesis that fancl mutants, which lack oocytes at the diplotene stage of meiosis, can not prevent the trans-differentiation of pre-granulosa cyp19a1a-expressing cells into Sertoli-like amh-expressing cells. This hypothesized mechanism could explain the disappearance of cyp19a1a-expressing cells and the maintenance and proliferation of amh-expressing cells in fancl mutant gonads that results in gonad masculinization. Future transcription profiling analyses comparing wild-type animals and fancl mutants lacking oocytes will help to identify genes involved in oocyte-soma signaling essential for ovary development.
Increased Apoptosis in fancl Mutants Compromises Oocyte Survival and Causes Female-to-Male Sex Reversal
We observed that the loss of oocytes in fancl mutants during the time-window of sex determination (25 dpf) is accompanied by an abnormal increase of Caspase-3-mediated apoptosis of germ cells compared to wild-type siblings. This result suggests the hypothesis that the disappearance of meiotic oocytes in fancl mutants is due to an increase in germ cell apoptosis, which provides a cellular mechanism for the female-to-male sex reversal phenotype of fancl mutants. To test this hypothesis, we suppressed cell death in fancl mutants by making them homozygous for a tp53 mutation. We show that the reduction of apoptosis in fancl
−/− double mutants is sufficient to promote the survival of developing oocytes and to rescue the female-to-male sex reversal phenotype of fancl mutants. Our result showing that only fancl
−/− double mutants developed any females, while their fancl
+/− and fancl
+/+ sibling controls developed exclusively as males, indicates that the amount of germ cell apoptosis alters sex determination in fancl mutants.The double mutant experiments further show that Tp53 activity mediates increased apoptosis associated with the fancl mutation. Doubly homozygous fancl rescued females were fertile and developed normal ovaries full of oocytes maturing through all stages of oogenesis. Active Caspase-3 results show that the amount of germ cell apoptosis is lower in double homozygous fancl individuals than in their fancl
−/−;tp53
+/+ mutant sibling controls, which further supports the hypothesis that the abnormal increase of apoptosis in fancl mutants that compromises the survival of meiotic oocytes is the mechanism responsible for the female-to-male sex reversal.We did not notice a sex ratio biased towards females in the tp53
mutant line. This allele, however, is hypomorphic, and may possess levels of apoptosis compatible with the male pathway. This conclusion is supported by our finding that a few fancl double mutants developed as males. An alternative explanation is that mechanisms of apoptosis independent of Tp53 might occur in male gonads that promote oocytes to disappear in developing testes.
Mutation of Fanconi Anemia Genes Promotes Activation of Tp53-Mediated Apoptosis in Both Zebrafish and Mice
Our finding of increased germ cell apoptosis in fanclzebrafish mutants is consistent with the increase of apoptosis in a variety of cell types reported in Fanconi Anemia knockout mice. For instance, Fanca
−/−, Fancc
−/−, and Fancg
−/− knockout mice show increased apoptosis of hematopoietic or neuronal cells, which might lead to a progressive loss of stem and progenitor cells [68]–[70]. Bone marrow failure in children with Fanconi Anemia is attributed to excessive apoptosis and subsequent failure of the hematopoietic stem cell compartment (reviewed in [56]). Interestingly, Fanca knockout mice also show increased male germ cell apoptosis [37], suggesting that a role of the FA network related to apoptosis of germ cells might be a conserved feature in fish and mammals. Young Fancl
−/− knockout mice, in contrast to fancl mutant zebrafish, do not show sex reversal but initially develop as sterile males and sterile females. Fancl
−/− knockout male mice – but significantly, not Fancl
−/− knockout female mice – can recover fertility and become fertile adult males. These results suggest that Fancl is necessary for germ cell proliferation in mouse embryos and for the maturation of oocytes, but not for the proliferation or maturation of spermatogonia in adulthood [58]. In zebrafish, the fact that fancl mutant males are fertile and that fancl rescued females are also fertile indicates that Fancl function is not essential for the maturation of zebrafish spermatogonia and oogonia to become sperm or mature oocytes, but rather that Fancl function affects specifically germ cell survival.The loss of oocytes progressing through meiosis in fancl mutants suggests that Fancl function is involved in the survival of developing germ cells through meiosis, and that when Fancl is mutated, developing oocytes cannot survive due to an inappropriate increase of Tp53-dependent germ cell apoptosis. This idea is consistent with the fact that genetic deletion of Tp53 can rescue the TNF-alpha dependent apoptosis caused by accumulation of the pro-apoptotic protein kinase PKR resulting from a mutation of the humanFANCC gene [68], reviewed in [56]. Therefore, inappropriate activation of Tp53-dependent apoptosis might be a common mechanism affecting cell survival in both zebrafish and human after alteration of the FA network. Given the fundamental similarity of the cellular mechanisms of the FA pathway in zebrafish and humans, the screening of small molecule libraries for compounds that can rescue the sex-reversal phenotype of zebrafishfancl mutants might identify compounds of therapeutic importance for Fanconi Anemiapatients.
A Model for Zebrafish Sex Determination: Oocyte Survival Regulated by Tp53-Mediated Apoptosis Can Alter Gonad Fate
Our analysis of zebrafishfancl mutants suggests a model in which oocyte survival regulated by Tp53-mediated apoptosis is a central element that can tip gonad fate towards the male or the female pathway (gradient red box in Figure 8). Zebrafish develop initially as juvenile hermaphrodites, and have immature ovaries during the juvenile stage regardless of their definitive sex [26]–[28]. This immature ovary is bipotential, and expresses both female (cyp19a1a) and male (amh) specific markers (Figure 8A) [29], [31], [48]. During the fate decision period, some wild-type animals up-regulate cyp19a1a and suppress amh expression (Figure 8B) thereby tipping the fate of the gonad towards the female ovarian pathway (Figure 8C). Complementarily, other wild-type individuals suppress cyp19a1a and up-regulate amh expression (Figure 8D) and gonad fate tips towards the male testis pathway (Figure 8E). In this work, we show that oocyte survival is crucial to maintain the female gene expression profile of somatic cells that is essential for ovary development.
Figure 8
A model for zebrafish sex determination: oocyte survival regulated by Tp53-mediated apoptosis can alter gonad fate.
This model suggests germ cell apoptosis as a central feature that can integrate genetic and environmental factors to tip the fate of the gonad towards the female or the male pathway and thus determine zebrafish sex. (A) Zebrafish juveniles initially develop an undifferentiated bipotential immature ovary regardless of their eventual definitive sex. The juvenile gonad contains developing oocytes (shown in yellow), as well as somatic cells that express female-specific markers like cyp19a1a (purple) and early male-specific markers like amh (green). This model suggests that different levels of germ cell apoptosis (indicated as a red gradient box from low (white) to high apoptosis (red)) has the potential to tip the fate of the gonad: high apoptosis (e.g fancl mutants) tips fate towards the male pathway, while low apoptosis (e.g. fancl mutants) tips fate towards the female pathway and rescues the sex-reversal phenotype of fancl mutants. In this model, wild-type zebrafish can enter the male pathway at different times during the fate decision time-window (dashed arrows in apoptosis box) ([30] and this work), which is probably related to the level of apoptosis that affects oocyte survival in each particular individual. (B) Analysis of somatic markers reported here shows that the survival of oocytes during the fate decision time-window is crucial to maintain and increase expression of cyp19a1a in the somatic cells of the gonad (B, purple gradient) and to down-regulate the expression of amh in the somatic cells of the gonad (B, green gradient), perhaps due to an oocyte-derived signal, which in fancl mutants would be compromised. (C) This gene expression profile feminizes the gonad, oocytes continue to develop, the gonad differentiates as an ovary, and the individual becomes a female. (D) In the absence of oocytes during sex fate decision time, as in fancl mutants, gonads do not maintain cyp19a1a (D, purple gradient), but instead up-regulate amh expression (D, green gradient). (E) This gene expression profile masculinizes the gonad, which differentiates as a mature testis and the individual becomes a male. (F,G) The absence of surviving oocytes in fancl
−/− mutants is probably due to high levels of germ cell apoptosis, which causes all animals to develop as males due to female-to-male sex reversal. This sex reversal phenotype can be rescued by decreasing germ cell apoptosis in double homozygous fancl
−/−;tp53
−/− mutants. Therefore, our analysis of fancl mutants provides evidence supporting the model that the survival of developing oocytes through meiosis, and not the mere presence of germ cells, is a critical factor that tips the fate of the gonad towards the female pathway in zebrafish. (H) Other work has shown that environmental factors such as high temperature can also induce oocyte apoptosis and tip the fate of the gonads towards the male pathway [71]. In light of this analysis, our model suggests that sex-determining mechanisms in zebrafish integrate signals from genetic and environmental factors that can modify the levels of Tp53-mediated germ cell apoptosis, which influence oocyte survival during the period of gonad fate decision, and tip the fate of the gonad towards the female or the male pathway, thus determining the sex of zebrafish.
A model for zebrafish sex determination: oocyte survival regulated by Tp53-mediated apoptosis can alter gonad fate.
This model suggests germ cell apoptosis as a central feature that can integrate genetic and environmental factors to tip the fate of the gonad towards the female or the male pathway and thus determine zebrafish sex. (A) Zebrafish juveniles initially develop an undifferentiated bipotential immature ovary regardless of their eventual definitive sex. The juvenile gonad contains developing oocytes (shown in yellow), as well as somatic cells that express female-specific markers like cyp19a1a (purple) and early male-specific markers like amh (green). This model suggests that different levels of germ cell apoptosis (indicated as a red gradient box from low (white) to high apoptosis (red)) has the potential to tip the fate of the gonad: high apoptosis (e.g fancl mutants) tips fate towards the male pathway, while low apoptosis (e.g. fancl mutants) tips fate towards the female pathway and rescues the sex-reversal phenotype of fancl mutants. In this model, wild-type zebrafish can enter the male pathway at different times during the fate decision time-window (dashed arrows in apoptosis box) ([30] and this work), which is probably related to the level of apoptosis that affects oocyte survival in each particular individual. (B) Analysis of somatic markers reported here shows that the survival of oocytes during the fate decision time-window is crucial to maintain and increase expression of cyp19a1a in the somatic cells of the gonad (B, purple gradient) and to down-regulate the expression of amh in the somatic cells of the gonad (B, green gradient), perhaps due to an oocyte-derived signal, which in fancl mutants would be compromised. (C) This gene expression profile feminizes the gonad, oocytes continue to develop, the gonad differentiates as an ovary, and the individual becomes a female. (D) In the absence of oocytes during sex fate decision time, as in fancl mutants, gonads do not maintain cyp19a1a (D, purple gradient), but instead up-regulate amh expression (D, green gradient). (E) This gene expression profile masculinizes the gonad, which differentiates as a mature testis and the individual becomes a male. (F,G) The absence of surviving oocytes in fancl
−/− mutants is probably due to high levels of germ cell apoptosis, which causes all animals to develop as males due to female-to-male sex reversal. This sex reversal phenotype can be rescued by decreasing germ cell apoptosis in double homozygous fancl
−/−;tp53
−/− mutants. Therefore, our analysis of fancl mutants provides evidence supporting the model that the survival of developing oocytes through meiosis, and not the mere presence of germ cells, is a critical factor that tips the fate of the gonad towards the female pathway in zebrafish. (H) Other work has shown that environmental factors such as high temperature can also induce oocyte apoptosis and tip the fate of the gonads towards the male pathway [71]. In light of this analysis, our model suggests that sex-determining mechanisms in zebrafish integrate signals from genetic and environmental factors that can modify the levels of Tp53-mediated germ cell apoptosis, which influence oocyte survival during the period of gonad fate decision, and tip the fate of the gonad towards the female or the male pathway, thus determining the sex of zebrafish.In wild-type zebrafish, juvenile bipotential gonads contain immature oocytes at early stage IB ([49]; and this work). In transitional stages, gonads that become ovaries possess oocytes that progress through meiosis to late stage IB and reach diplotene, where they arrest for the remainder of oocyte development [49]. In fancl homozygous mutants, loss of oocytes at or before diplotene likely alters signaling from germ line to the soma, leading to loss of cyp19a1a expression, failure to down regulate amh expression, and consequent masculinization of the gonads to form testes (Figure 8G). The cyp19a1a gene encodes aromatase, the enzyme that converts testosterone to estrogen. It is known that aromatase is critical for female fate in zebrafish because pharmacological treatments with the aromatase inhibitor fadrozole masculinizes gonads [71]–[73] and because, complementarily, treatments with estrogen (estradiol) down-regulate amh expression and feminize the gonad [74]. We hypothesize that the apoptotic loss of oocytes in fancl mutants causes cyp19a1a gene expression to disappear and leads to the failure to maintain aromatase levels, which results in failure to produce and sustain high estrogen levels in the gonad, causing gonads to abandon the female fate and instead, enter the testis developmental program.The presence of oocytes appears to be important for sex determination not only for zebrafish, but also for medaka. In contrast to zebrafish, in which all individuals begin oogenesis, in medaka only XX females start oogenesis while XY males suppress oogenesis and all germ cells remain undifferentiated (reviewed in [75]). A feature common to both species is that the number of developing oocytes is a key feature that tips undifferentiated gonads towards an ovary fate ([31], [75] and this work). In medaka, the partial removal of PGCs can reduce the number of developing oocytes below a threshold necessary for female development [76]. In addition, medaka hotei mutants, which have aberrant oocyte development [77], fail to maintain cyp19a1a expression and gonads develop into testes. Therefore, the survival of developing oocytes appears to be important for sex determination in both zebrafish and medaka. These considerations support the hypothesis that when the number of oocytes exceeds a threshold, sexual fate tips towards the female pathway, and alternatively, when the oocyte number fails to exceed that threshold, the sexual fate tips towards the male pathway, as we observed in zebrafishfancl mutants.In zebrafish, presumptive juvenile males had more TUNEL signal in germ cells than presumptive females had suggesting the hypothesis that oocyte apoptosis could be the mechanism of testicular and ovarian differentiation in zebrafish [27]. Consistent with this hypothesis, analysis of ziwi null mutants showed that total loss of germ cells by apoptosis caused ziwi mutants to develop exclusively as sterile males [34]. Our results show that Tp53-mediated germ cell apoptosis is a mechanism that can tip gonad fate towards the female or male pathway, at least in fancl mutants. Because environmental factors such as high temperature (Figure 8H) or endocrine-disrupting chemical treatments can also increase oocyte apoptosis and cause sex reversal [71]–[73], it is plausible to suggest that the integration of genetic and environmental factors converge to modify the levels of Tp53-mediated germ cell apoptosis, which affect oocyte survival during the critical time window to determine the sexual fate of the gonad, and ultimately alter zebrafish sex determination.
Materials and Methods
Ethics Statement
Animals were handled in accordance with good animal practice as defined by relevant animal welfare bodies, and the University of Oregon Institutional Animal Care and Use Committee approved all animal work (Animal Welfare Assurance Number A-3009-01, IACUC protocol #08-13).
Animals
The zebrafishfancl mutation (HG10A; GenBank accession AB353980) was generated by insertional mutagenesis by Tol2 transposon-mediated enhancer trap [42]. The tp53 mutant line tp53 causing the amino acid substitution M214K was obtained from ZIRC (http://zebrafish.org/zirc/home/guide.php) [55]. Genotyping of tp53 animals was performed as described [55]. Genetic nomenclature follows guidelines from ZFIN (http://zfin.org/zf_info/nomen.html).
Genotyping of fancl Mutants
The full-length zebrafishfancl cDNA was previously described [44] (GenBank accession AY968598). Primer pairs used to amplify the fancl wild-type or mutant alleles were: WT_F:CTGGTCTTTATTGACTGTAATGGC; WT_R:TAGATAAGCTCCAGATTTGGCTTG; Mutant_F:GTCAGCCCATCCAGATCAGCAG; Mutant_R:CATGACGTCACTTCCAAAGGACC. PCR conditions were: 5′94°C; 32 cycles of: 30″94°C, 30″55°C, 1′72°C; followed by 10′72°C. Sizes of PCR-amplified bands: Wild type: 479 bp; Mutant: 370 bp.
Reverse Transcriptase–PCR
Total RNA isolation from dissected adult testes and cDNA synthesis were performed as described [41]. Primers used for reverse transcriptase-PCR (RT-PCR) experiments were: F1:GACGGCTTCATCACAGTGCTG; R1:CATGACGTCACTTCCAAAGGACC; F2:GAACCCTGACTGCACTGTCCTAC; R2:GCTTTGGCGACTGGTTGGCAGAC. PCR conditions were: F1-R1: 3′94°C; 40 cycles of: 30″94°C, 30″58°C, 1′30″72°C; followed by 10′72°C; F2-R2: 3′94°C; 37 cycles of: 20″94°C, 30″60°C, 45″72°C; followed by 10′72°C. Sizes of PCR-amplified bands: F1-R1: 1239 bp F2-R2: 232 bp.
dead end Morpholino Injections
To obtain animals lacking germ cells, wild-type zebrafish embryos from the AB strain were injected at the 1–2 cell stage with antisense morpholino oligonucleotide (Gene Tools, Oregon) directed against dead end as described [46]. Sibling non-injected embryos and a fraction of dnd MO-injected embryos were fixed at 24 hours post-fertilization to confirm the presence or absence of germ cells by whole-mount in situ hybridization using vasa probe as described [47].
In Situ Hybridization and Histology
Animals were reared and collected under standard conditions [78]. In situ hybridization experiments on zebrafish cryosections were performed as described [29]. Adjacent sections of gonads were obtained by placing three consecutive sections of the gonad on three different slides. Probes for amh and cyp19a1a were made as described [29] and probe for vasa was made from its 3′end as described [47]. A fancl cDNA fragment of 786 nt containing the PHD domain (nucleotides 646-1431 of AY968598) was cloned in TOPO vector (Invitrogen) and used to synthesize DIG-labeled riboprobe (Boehringer Mannheim). For gonad histology, euthanized animals were fixed in Bouin's fixative for about 24–48 hours and washed repeatedly in 70% ethanol. Animals were dehydrated and embedded in paraffin, sectioned at 7 microns, and stained with hematoxylin and eosin.
Immunohistochemistry
Animals were fixed at 25 dpf in 4% PFA ON at 4°C, dehydrated, embedded in paraffin, and sectioned at 7 microns. Apoptotic cells were detected by immuno-fluorescence using anti-active Caspase-3 as primary antibody (1∶200, BD Pharmingen) and Alexa-Fluor594goat anti-rabbit as secondary antibody (1∶1000, Invitrogen) following an immuno-histochemical protocol (S. Cheesman, personal communication). Gonads were screened for positive signal by DIC-fluorescence microscopy. The number of positive cells in gonads of fancl and wild-type animals was scored in 840 sections: 70 sections containing gonads per each animal (n = 12).
Authors: Brian Ciruna; Gilbert Weidinger; Holger Knaut; Bernard Thisse; Christine Thisse; Erez Raz; Alexander F Schier Journal: Proc Natl Acad Sci U S A Date: 2002-10-23 Impact factor: 11.205
Authors: Brian Freie; Xiaxin Li; Samantha L M Ciccone; Kathy Nawa; Scott Cooper; Catherine Vogelweid; Laurel Schantz; Laura S Haneline; Attilio Orazi; Hal E Broxmeyer; Suk-Hee Lee; D Wade Clapp Journal: Blood Date: 2003-07-10 Impact factor: 22.113
Authors: Joseph A Ross; James R Urton; Jessica Boland; Michael D Shapiro; Catherine L Peichel Journal: PLoS Genet Date: 2009-02-20 Impact factor: 5.917
Authors: J Gubbay; J Collignon; P Koopman; B Capel; A Economou; A Münsterberg; N Vivian; P Goodfellow; R Lovell-Badge Journal: Nature Date: 1990-07-19 Impact factor: 49.962
Authors: Heather R Shive; Robert R West; Lisa J Embree; Mizuki Azuma; Raman Sood; Paul Liu; Dennis D Hickstein Journal: Proc Natl Acad Sci U S A Date: 2010-10-25 Impact factor: 11.205
Authors: Kaitlyn A Webster; Katrin Henke; Delaney M Ingalls; Adeeba Nahrin; Matthew P Harris; Kellee R Siegfried Journal: Reproduction Date: 2018-04-01 Impact factor: 3.906
Authors: Shubhangi Prabhudesai; Sharmistha Sinha; Aida Attar; Aswani Kotagiri; Arthur G Fitzmaurice; Rajeswari Lakshmanan; Ravi Lakshmanan; Magdalena I Ivanova; Joseph A Loo; Frank-Gerrit Klärner; Thomas Schrader; Mark Stahl; Gal Bitan; Jeff M Bronstein Journal: Neurotherapeutics Date: 2012-04 Impact factor: 7.620
Authors: Yi-Lin Yan; Peter Batzel; Tom Titus; Jason Sydes; Thomas Desvignes; Ruth BreMiller; Bruce Draper; John H Postlethwait Journal: Genetics Date: 2019-08-09 Impact factor: 4.562
Authors: Kaitlyn A Webster; Ursula Schach; Angel Ordaz; Jocelyn S Steinfeld; Bruce W Draper; Kellee R Siegfried Journal: Dev Biol Date: 2016-12-08 Impact factor: 3.582