Literature DB >> 20573200

Characterization of the equine skeletal muscle transcriptome identifies novel functional responses to exercise training.

Beatrice A McGivney1, Paul A McGettigan, John A Browne, Alexander C O Evans, Rita G Fonseca, Brendan J Loftus, Amanda Lohan, David E MacHugh, Barbara A Murphy, Lisa M Katz, Emmeline W Hill.   

Abstract

BACKGROUND: Digital gene expression profiling was used to characterize the assembly of genes expressed in equine skeletal muscle and to identify the subset of genes that were differentially expressed following a ten-month period of exercise training. The study cohort comprised seven Thoroughbred racehorses from a single training yard. Skeletal muscle biopsies were collected at rest from the gluteus medius at two time points: T(1) - untrained, (9 +/- 0.5 months old) and T(2) - trained (20 +/- 0.7 months old).
RESULTS: The most abundant mRNA transcripts in the muscle transcriptome were those involved in muscle contraction, aerobic respiration and mitochondrial function. A previously unreported over-representation of genes related to RNA processing, the stress response and proteolysis was observed. Following training 92 tags were differentially expressed of which 74 were annotated. Sixteen genes showed increased expression, including the mitochondrial genes ACADVL, MRPS21 and SLC25A29 encoded by the nuclear genome. Among the 58 genes with decreased expression, MSTN, a negative regulator of muscle growth, had the greatest decrease.Functional analysis of all expressed genes using FatiScan revealed an asymmetric distribution of 482 Gene Ontology (GO) groups and 18 KEGG pathways. Functional groups displaying highly significant (P < 0.0001) increased expression included mitochondrion, oxidative phosphorylation and fatty acid metabolism while functional groups with decreased expression were mainly associated with structural genes and included the sarcoplasm, laminin complex and cytoskeleton.
CONCLUSION: Exercise training in Thoroughbred racehorses results in coordinate changes in the gene expression of functional groups of genes related to metabolism, oxidative phosphorylation and muscle structure.

Entities:  

Mesh:

Year:  2010        PMID: 20573200      PMCID: PMC2900271          DOI: 10.1186/1471-2164-11-398

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

The phenotypic and biochemical changes occurring in response to exercise training have been extensively studied in humans and mammals, the results mainly being of a descriptive nature. The adaptive response to training is dependent on variations in exercise-induced changes in muscle load, energy requirements and calcium flux. Endurance training results in increased aerobic capacity [1], mitochondrial biogenesis [2] and a shift from carbohydrate to fat metabolism [3] whereas resistance training promotes protein synthesis [4,5], muscle hypertrophy [6] and a switch from slow to fast twitch muscle. Numerous equine studies have also confirmed an increase in VO2max and an increase in oxidative enzyme activity [7-12] following endurance training. An increase in type II and a concurrent decrease in type IIX fibres is observed in Thoroughbreds in response to high intensity training [13,14]. Also, anerobic capacity and speed and strength have been observed to increase following short duration high intensity (~100-150% VO2max) exercise [14-16]. In contrast, much less is known regarding the transcriptional reprogramming underlying the highly specific adaptive responses to endurance and resistance exercise. Exercise studies using human subjects and animal models have demonstrated that changes in the expression of a wide range of mRNA transcripts play a major role in the recovery of muscle following exercise with the expression levels of most genes returning to baseline within 24 hours [17-23]. However, it appears that repeated bouts of exercise lead to new basal levels of gene expression in resting muscle. Higher levels of mitochondrial genes and genes involved in energy metabolism were observed in endurance trained athletes compared to sedentary subjects [24]. Further evidence for a new steady state level of exercise related genes comes from a recent study in which differential levels of gene expression were observed in resting skeletal muscle from sedentary, endurance trained and resistance trained subjects. However the use of intra rather than inter-individual genetic comparisons as well as different training stimuli may have contributed to the observed differences in gene expression between the groups. The majority of differentially expressed genes were common to both trained states [25]. A surprisingly small number of genes were differentially expressed between endurance trained and resistance trained subjects given the very different phenotypic changes and distinct signalling pathways [26,27] associated with each form of exercise. Studies have indicated that concurrent endurance and resistance training results in impaired strength development and aerobic capacity when compared to a training regime with a single exercise mode [28-31] a phenomenon described as the interference effect. However, conflicting studies have found little or no effect of a combined training regime on strength and aerobic capacity [32-35]. The aim of this study was to investigate the global transcriptional response in skeletal muscle to a training regime combining endurance and high intensity sprint exercise in Thoroughbred racehorses. We hypothesise that following training differential expression of genes related to both aerobic capacity and muscle hypertrophy will be observed reflecting the dual nature of the training regime. The Thoroughbred is a novel and valuable model for identifying molecular mechanisms basic to both endurance and resistance adaptive responses. Competitive horse racing dates to 4500 BC and Thoroughbreds have been bred for speed and stamina since the 1700 s. This intense selection has resulted in a highly adapted athlete [36]. Thoroughbreds have a very high aerobic capacity or maximal oxygen uptake (VO2max) [37] relative to their body mass. For instance, VO2max can reach 180-200 mL O2/min/kg, approximately 2.5 times higher than other species of similar size[38]. This is achieved through a large lung volume, high cardiac output, high haemoglobin concentration, high muscle mitochondrial volume and a high skeletal muscle mass [38-44]. During intense exercise such as under racing conditions a Thoroughbred may increase its metabolic rate from basal levels by up to 60-fold [45]. Furthermore, the Thoroughbred has a very high skeletal muscle mass comprising over 55% of total body mass [46]. A Thoroughbred racehorse trained for flat racing undergoes a training regime comprising intermittent days of sprint exercise to promote increased muscle mass among periods of prolonged exercise at a slower pace to enhance aerobic capacity. In a previous study we detected molecular signatures of both endurance and resistance exercise in untrained Thoroughbred skeletal muscle following a single bout of exhaustive exercise [47]. A further advantage of using Thoroughbreds as an exercise model is that inter-individual comparisons can be made between subjects that come from a similar background (genetic and environmental) and have undergone a similar exercise regime with relatively little variation in management. Variations in genetic and environmental conditions cannot be controlled to the same extent in human subjects. To-date the main approach to investigating global transcriptional changes has been the use of gene expression microarray platforms [47-49]. In this study we have used digital gene expression (DGE, Illumina) profiling to characterize the assembly of genes expressed in equine skeletal muscle and to identify the subset of genes that were differentially expressed following a ten month period of exercise training. DGE is a recently developed alternative to microarray gene expression profiling [50-52]. The DGE method involves the generation of a cDNA library with a 17 bp tag generated by restriction digestions for each mRNA transcript. The tags are directly sequenced using the Illumina Genome Analyzer creating millions of short reads. In contrast to microarray technology which is limited to the hybridisation of cDNA to probes printed on the array platform, DGE is not dependent on currently available genome sequence and thus provides a global, hypothesis-free quantitative analysis of the transcriptome. The technique is conceptually similar to serial analysis of gene expression (SAGE) [53] but substantially less expensive, more general and capable of delivering more information. Using this technique we investigated 1) the overrepresentation of functional groups in skeletal muscle relative to the entire genome, 2) the genes differentially expressed in trained relative to untrained skeletal muscle, and 3) the overrepresentation of functional groups in genes differentially expressed following training in skeletal muscle.

Results and discussion

Representation of genes by DGE tags

A limitation of genome wide gene expression analysis using DGE is that it is not possible to evaluate the expression of genes that do not contain a NlaIII restriction site and in some cases there is ambiguity regarding the tag-gene matches as a single tag may match to two or more genes. 91% (n = 22,996) of equine genes with Ensembl gene IDs (n = 25,180) have a NlaIII restriction site but 13% of these are not unique; therefore, 78% (n = 19,271) of currently annotated equine genes are quantifiable using DGE. As poor quality sequence was obtained for one of the samples just 13 samples were used for analysis. Of the 13 samples successfully sequenced a total of 183 million raw reads were generated. Of these 119 million reads passed the Illumina pipeline quality filters. These 119 million usable reads consisted of 17.6 million unique tags. 66% of the usable reads mapped to the horse genome, 30% of the usable reads mapped to the predicted Ensembl gene restriction sites and 36% to the genomic regions. The intragenic reads may represent regulatory non-coding RNAs or novel genes. However, more likely is the explanation that these tags are a combination of segments of genes that were excluded from the current annotation (or assembly) of the equine genome; an observation which has been previously reported [54] as well as tags containing sequencing errors. We expect that as the annotation of the horse transcriptome improves that most of the genomic tags we have sequenced will be reassigned to genic tags. In particular we believe that a de novo transcriptome assembly approach (using longer sequencing reads) of the equine muscle transcriptome would enable us to more accurately allocate tags to the correct gene models. In the absence of an accurate muscle transcriptome we believe that the Ensembl horse transcriptome, which is predominantly automatically generated and infers much of the information about gene models by homology from better annotated organisms, represents the best available option for DGE tag mapping. The reasons that reads may not match a genomic location include ambiguous reads (same sequence tag present in more than one genomic location), reads overlapping an unannotated exon boundary, sequencing errors or single nucleotide variants present in the tag. Due to the short nature of the reads used in DGE compared to other sequencing protocols it is problematic to correct for SNPs or sequencing errors by allowing mismatched bases. Other protocols (e.g. RNAseq), which generate longer tags, can overcome this limitation but they introduce new problems, the most important of which is multiple tags per transcript and a bias towards highly expressed long transcripts [55]. The intragenic reads may represent regulatory non-coding RNAs or novel genes. However, more likely is the explanation that these tags represent segments of genes that were excluded from the current annotation (or assembly) of the equine genome; an observation which has been previously reported [54]. Only the 20% of reads that unambiguously matched Ensembl genes were used for further analysis. These represented 5,068 unique genes, ~25% of annotated equine genes. As some genes were represented by multiple different transcripts these were summed to calculate the total number of reads per gene. Highly expressed genes where > 50,000 tags per million (TPM) were detected made up 39% of all annotated reads. However, the majority of unique genes were expressed at low levels (i.e. 2,200 genes, < 40 TPM) and there was an inverse relationship between the level of gene expression and the number of genes expressed (Figure 1).
Figure 1

Relationship between the number of genes expressed and mRNA abundance. a - Number of genes compared to tags per million per gene. b - The % of the total number of reads compared to the tags per million per gene.

Relationship between the number of genes expressed and mRNA abundance. a - Number of genes compared to tags per million per gene. b - The % of the total number of reads compared to the tags per million per gene.

Functional annotation of muscle transcriptome

Using the online tool DAVID, 448 gene ontology groups and 14 KEGG pathways were observed to be significantly (FDR = 0.05) overrepresented in skeletal muscle relative to the entire genome. There was a substantial overlap of genes within these functional groups resulting in the overrepresentation of a large number of functionally similar gene ontology groups. Therefore only the highly significant groups are shown in Table 1. The overrepresentation of mitochondrial genes, and genes involved in muscle contraction and metabolism concurs with current SAGE data [56]. However, an overrepresentation of genes related to RNA processing, the stress response and proteolysis has not, to our knowledge, previously been reported in the muscle transcriptome. DGE is much more sensitive to the detection of low level transcripts than SAGE and consequently provides greater coverage of the muscle transcriptome. When functional analysis of only the highly expressed genes (those comprising > 0.05% of annotated muscle transcriptome) was performed, the novel overrepresented functional groups were not identified. This indicates that these are comprised of genes expressed at relatively low levels. Furthermore, functional groups involved in muscle contraction and aerobic respiration were more significantly overrepresented among the highly expressed genes (Table 1).
Table 1

Functional groups of genes identified in the equine skeletal muscle transcriptome.

All genesHigh abundance genes
GO IDTermCountFCAdj PCountFCAdj P

GO BP:0008152metabolic process24681.198.17 × 10-551311.24.13 × 10-08
GO MF:0005515protein binding21221.354.53 × 10-901051.32.88 × 10-12
GO CC:0043234protein complex7131.572.75 × 10-43682.91.32 × 10-15
GO CC:0005739mitochondrion4071.975.63 × 10-49534.93.71 × 10-23
GO BP:0006936muscle contraction731.941.78 × 10-07338.73.98 × 10-17
hsa00190Oxidative phosphorylation561.550.006329.54.47 × 10-18
GO MF:0003723RNA binding2891.763.84 × 10-23273.33.78 × 10-06
GO MF:0009055electron carrier activity941.811.47 × 10-07249.41.43 × 10-11
GO CC:0043292contractile fibre503.373.19 × 10-172329.95.32 × 10-18
GO CC:0005840ribosome931.321.63 × 10-02215.89.29 × 10-09
GO MF:0005524ATP binding4341.281.71 × 10-07201.2NS
GO BP:0006950response to stress3371.399.17 × 10-10191.5NS
GO CC:0044428nuclear part4291.889.51 × 10-46100.8NS
GO BP:0006457protein folding1322.125.64 × 10-18103.10.007
GO BP:0015031protein transport2901.855.91 × 10-2870.9NS
GO MF:0045182translation regulator activity762.409.13 × 10-1353.2NS
GO BP:0006396RNA processing1951.908.21 × 10-2040.8NS
GO MF:0008134transcription factor binding1531.671.89 × 10-0940.9NS
hsa00620Pyruvate metabolism272.283.30 × 10-0443.6NS
hsa00020Citrate cycle (TCA cycle)202.360.00345.1NS
hsa04120Ubiquitin mediated proteolysis551.490.01620.6NS

hsa00071Fatty acid metabolism241.890.01721.7NS

GO CC:0005681spliceosome782.712.04 × 10-1810.7NS
hsa03050Proteasome213.382.28 × 10-0711.7NS

GO categories and KEGG pathways overrepresented among genes expressed in equine skeletal muscle compared to all annotated equine genes. Terms in italics are more significantly overrepresented among the high abundance genes. High abundance genes are defined as those comprising > 0.05% of annotated muscle transcriptome. FC - fold change; Adj P - adjusted P value using the Benjamini and Hochberg method.

Functional groups of genes identified in the equine skeletal muscle transcriptome. GO categories and KEGG pathways overrepresented among genes expressed in equine skeletal muscle compared to all annotated equine genes. Terms in italics are more significantly overrepresented among the high abundance genes. High abundance genes are defined as those comprising > 0.05% of annotated muscle transcriptome. FC - fold change; Adj P - adjusted P value using the Benjamini and Hochberg method. A list of the most abundant genes (those comprising >0.5% of annotated muscle transcriptome) is presented in Table 2. Just 28 genes contribute to over 50% of the annotated mRNA in equine skeletal muscle and are principally involved in muscle contraction and energy metabolism. Creatine kinase muscle (CKM) was the most abundantly expressed gene in equine skeletal muscle representing 6.9% of the annotated transcriptome and creatine kinase, mitochondrial 2, (CKMT2), was ranked 20th among the most abundantly expressed genes, making up 0.8% of the transcriptome. Human studies using SAGE have indicated that CKM mRNA makes up ~1% of the human skeletal muscle transcriptome and CKMT2 did not feature in a list of the 54 most abundantly expressed genes [56]. The very high levels of both isoforms of creatine kinase in equine muscle compared to humans is indicative of the highly adapted athletic capacity of Thoroughbred horses as creatine kinases play a crucial role as an energy store in tissues with fluctuating energy demands. CKM is utilised during anaerobic respiration while CKMT2 is tightly coupled to oxidative phosphorylation [57-60]. The importance of CKM in athletic adaptation in the horse is further supported by the identification of a novel SNP in the CKM gene that, in a preliminary study, has been observed to be associated with racing performance [61]. The third most highly expressed gene in equine skeletal muscle, actin, alpha 1, skeletal muscle (ACTA1) has also been implicated as a candidate athletic performance gene following a genome scan for positive selection in Thoroughbred horses [62].
Table 2

Highly abundant transcripts in equine skeletal muscle

Gene symbolGene nameTotal reads% AllCumulative %Average no. reads pre-training% AllAverage no. reads post training% All
CKMCreatine kinase, muscle236,9426.96.918,6426.717,8707.1
MYL1Myosin, light polypeptide 1, alkali; skeletal, fast203,6345.912.817,4546.214,1305.6
ACTA1Actin, alpha 1, skeletal muscle147,8844.317.115,0655.48,2143.3
TNNC2Troponin C type 2 (fast)147,7794.321.412,1284.310,7164.2
ALDOAAldolase A, fructose-bisphosphate118,6363.424.89,5063.48,8003.5
TTNTitin116,3853.428.29,9193.58,1253.2
MYLPFMyosin light chain, phosphorylatable, fast skeletal muscle97,0942.831.07,4262.77,5063.0
MYH1Myosin, heavy polypeptide 1, skeletal muscle, adult91,2712.733.78,6113.15,6582.2
TPM2Tropomyosin 2 (beta)73,3952.135.86,2402.25,1362.0
ATP2A1ATPase, Ca++ transporting, cardiac muscle, fast twitch 159,8891.737.65,5162.03,8271.5
RPLP1P4Ribosomal protein, large, P1 pseudogene 455,2901.639.24,3401.64,1781.7
ENO3Enolase 3 (beta, muscle)40,8271.240.43,1431.13,1381.2
LOC440359Similar to cold shock domain protein A short isoform36,6811.141.42,8771.02,7741.1
ATP5OATP synthase, H+ transporting, mitochondrial f1 complex, o subunit34,2341.042.42,2120.82,9941.2
MYOZ1MYOZENIN 132,6380.943.42,4490.92,5641.0
PYGMPhosphorylase, glycogen; muscle31,7100.944.32,8951.02,0480.8
TPM1Tropomyosin 1 (alpha)30,8230.945.22,8201.01,9860.8
MYBPC2Myosin binding protein C, fast type28,3860.846.02,4090.91,9900.8
TNNT3Troponin t type 3 (skeletal, fast)27,4690.846.81,9600.72,2440.9
CKMT2Creatine kinase, mitochondrial 2 (sarcomeric)27,3940.847.61,6220.62,5231.0
TNNI2Troponin I type 2 (skeletal, fast)25,0050.748.31,6740.62,1380.8
PGK1Phosphoglycerate kinase 124,3780.749.02,0050.71,7640.7
RPL30Ribosomal protein L3023,5750.749.72,1620.81,5150.6
NDUFAB1NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1, 8 kDa22,2850.650.41,5700.61,8380.7
SLC25A4Solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 421,8810.651.01,2700.52,0370.8
ACTN3Actinin, alpha 321,0970.651.62,0420.71,2640.5
PGAM2Phosphoglycerate mutase 2 (muscle)21,0590.652.21,7360.61,5210.6
RPS13Ribosomal protein S1319,0630.652.81,6100.61,3430.5
Highly abundant transcripts in equine skeletal muscle

Differential gene expression following training

Following correction for multiple testing, a total of 92 transcripts were significantly (FDR = 0.05) differentially expressed in the skeletal muscle transcriptome following a ten month period of training: nineteen transcripts showed increased expression (+0.72-fold to +29.3-fold), and 73 displayed decreased expression (-0.43-fold to -4.2-fold). Twenty of the differentially expressed transcripts lay within annotated genes, 54 transcripts were located < 5 kb up or downstream of annotated genes and for 18 transcripts no annotated genes were located within 5 kb. The transcripts located in the vicinity of equine genes may represent regulatory regions of the genes and more in-depth analysis and annotation of the recently sequenced equine genome may lead to a reassessment of the boundaries of many currently annotated genes [63]. The uncharacterised transcripts that were not in the region of any known equine gene may represent novel equine exercise related genes or non-protein coding regulatory mRNAs. The differentially expressed transcripts, including those located within 5 kb of a known gene, and the associated gene names are listed in Table 3 and Table 4.
Table 3

Genes significantly up-regulated post-training compared to pre-training levels

TagGene symbolGene nameFCAdj P
gctgctctgcagtctgaACADVLAcyl-Coenzyme A dehydrogenase, very long chain0.720.037
gaataattgaagactggACTR3BArp3 Actin-Related Protein 3 Homolog B2.370.041
gcgtccttgaggtccggC14orf153*Chromosome 14 open reading frame 1531.140.049
ctgtttttctgttttttCUL3*Cullin 31.430.004
tgataccaatattcagtFBXO32*F-box protein 321.170.009
cagaaagagcagggaagGOT1*Glutamic-oxaloacetic transaminase 1, soluble1.460.035
tggatgtgtggctatggGRHPRGlyoxylate Reductase/Hydroxypyruvate Reductase1.450.043
ggacccatgaaggaccaIGFN1*Immunoglobulin-like and fibronectin type III domain-containing protein 12.030.019
tggttctgtttgttttgKIAA1303*P150 target of rapamycin (TOR)-scaffold protein2.700.049
gagtgcagcctttcaccMRPS2128 S ribosomal protein S21, mitochondrial3.240.024
accagagagatgaatgtMRPS2128 S ribosomal protein S21, mitochondrial1.760.032
tgttgaagcgatgcagtPER2*Period homolog 229.260.004
tgttggtaagtagatcgPER3*Period homolog 3 (Drosophila)1.050.047
tggctgtatggggaggcSLC25A29*Solute carrier family 25 member 291.320.013
gccttctgcacccagaaTNNT3*Troponin T Type 3 (Skeletal, Fast)1.550.002
ttaaatatacttggaagZAK*Sterile alpha motif and leucine zipper containing kinase AZK2.080.023

An asterisk (*) indicates that the tag lay within 5 kb of the gene. FC - fold change; Adj P - adjusted P value using the Benjamini and Hochberg method.

Table 4

Genes significantly down-regulated post-training compared to pre-training levels

TagGene SymbolGene NameFCAdj P
acccgagagacagccgaACTN3actinin, alpha 3-0.970.029
acacagttagttaatttAHCYL2*Putative adenosylhomocysteinase 3-1.390.006
acacagttagttaatttAHCYL2*Putative adenosylhomocysteinase 3-1.390.006
taattttattttttttaANKHD1*Ankyrin repeat and KH domain containing 1-2.300.043
ttttccctcacatcttcAPOOL*Apolipoprotein O-like-0.540.003
cttagtgtgtatatctcATP2B1ATPase, Ca++ transporting, plasma membrane 1-0.620.041
atcattattttacctttBCL6*B-cell CLL/lymphoma 6-3.090.011
acggttttccccagatcC1orf51*Chromosome 1 open reading frame 51-1.610.035
cactggccaaaagatttC21orf7Chromosome 21 open reading frame 7-3.080.035
ccactaccctcttactcCALM3*Calmodulin3-1.460.009
acagacacttggctaaaCALM3*Calmodulin3-0.830.043
aacagaatcaaggagctCCNDBP1Cyclin-D1-binding protein 1-0.810.035
gaaaacagtagctaaagDAG1dystroglycan 1-1.490.022
ctcaacagcaacatcaaEIF3FEukaryotic translation initiation factor 3, subunit F-0.520.002
tccagcctcaaagcattFBXL17*F-Box And Leucine-Rich Repeat Protein 17-0.520.002
aactgtagtgctttaaaGATMGlycine Amidinotransferase-1.350.035
taggttttacctccattGATM*Glycine Amidinotransferase-1.350.001
ctggaacaggggcgaacGLUL*Glutamate-ammonia ligase-3.940.007
cccatcatccccttcctGPSN2GLYCOPROTEIN, SYNAPTIC 2-1.060.004
aagtcccaccccaatatGSTM5*Glutathione S-transferase M5-1.10.004
tccacccataagcagatHOXC9*Homeobox protein Hox-C9-1.040.038
ggactgtctttatttttIGFBP5*Insulin-like growth factor binding protein-5-2.320.001
gtaaccctacacagtcaIGFBP5*Insulin-like growth factor binding protein-5-2.120.038
cccagaaagacatttgtIRF2BP2*Interferon regulatory factor 2 binding protein 2-1.570.001
caaaaggctctcctaatKCMF1potassium channel modulatory factor 1-0.810.048
tttccattcaacaaaaaKPNA1*Karyopherin alpha 1-1.80.006
aattactctttcactgtKPNA3*Karyopherin alpha 3-1.550.043
cttttcacacacaaaacLRRFIP1*Leucine Rich Repeat-0.954.1 × 10-5
ttaagtgccattactacMAP3K4Mitogen-activated protein kinase kinase kinase 4-0.850.048
ccccaccctactcccacMLEC*Malectin-1.130.017
tatgacagaaaagcaacMSTN*Myostatin-2.560.002
atgactgtataatgtgaMSTN*Myostatin-2.550.008
gttcctaaataaataatMSTN*Myostatin-4.20.004
ctgctgagcggcctctcMYLK2Myosin Light Chain Kinase 2, Skeletal Muscle-1.940.034
gctcattaaagaacaaaMYO9A*Myosin Ixa-1.030.043
ctatcttttccttttctNAT12*N-acetyltransferase MAK3 homolog-0.680.002
attgtttaaatatcactNEDD4*Neural precursor cell expressed, developmentally down-regulated 4-0.970.012
aaatcccaccctcccctNLN*Neurolysin-1.020.008
tccagctttctattcttPALLD*Palladin, cytoskeletal associated protein-1.060.039
cttctttccccacctccPCBP4Poly(rC) binding protein 4-0.820.004
taattgcagtttactatGNPNAT1*Similar to glucosamine-phosphate N-acetyltransferase 1-1.230.006
ctctagaacatttacctPTDSS1*Phosphatidylserine synthase 1-0.620.003
agagtcaatataaaggtPTPLA*Protein Tyrosine Phosphatase-Like-2.070.01
aaatctaaagttaaataRAB33B*RAB33B, member RAS oncogene family-1.240.04
cagccctgggggcctacRYKRyk Receptor-Like Tyrosine Kinase-0.940.005
attcccatttctagtaaSEPT7*Transcribed locus-0.720.018
tgaggacaaagctcaggSLC10A2*Solute carrier family 10-4.110.001
ccttcaactcaacaaatSNAP29*Synaptosomal-associated protein, 29 kDa-0.430.009
gtattgtaagatattaaSNORA24*Small nucleolar RNA SNORA24-0.890.037
aagcaagaaataaatttTET1*Tet oncogene 1-1.40.029
atgcagagcaccacagaTLE1transducin-like enhancer of split 1-1.582.0 × 10-5
actgacatatgtaaagaTOR3A*torsin family 3, member A-1.490.022
tgcctatcacctgccggTPD52*Tumor protein D52-0.680.005
tcctttcagtcttcacaTSPAN3Tetraspanin 3-0.580.04
ctttgtgacttccaagtULK2*Unc-51-like kinase 2-0.720.018
aaaccatatttcttcccVCL*Vinculin-1.130.005
cccaggcccgtccctgcZC3H3*Zinc finger CCCH-type containing 3-1.280.035
aagtctaacttccatttZNF704*Zinc finger protein 704-0.930.013
ttagtttcttttctttaZWINT*ZW10 interactor-1.211.1 × 10-4

An asterisk (*) indicates that the tag lay within 5 kb of the gene. FC - fold change; Adj P - adjusted P value using the Benjamini and Hochberg method.

Genes significantly up-regulated post-training compared to pre-training levels An asterisk (*) indicates that the tag lay within 5 kb of the gene. FC - fold change; Adj P - adjusted P value using the Benjamini and Hochberg method. Genes significantly down-regulated post-training compared to pre-training levels An asterisk (*) indicates that the tag lay within 5 kb of the gene. FC - fold change; Adj P - adjusted P value using the Benjamini and Hochberg method. Genes with higher post-training basal mRNA levels included those involved in the mitochondria, ubiquitination and circadian rhythm regulation, whereas genes with significantly reduced mRNA were mainly associated with cytoskeletal structure and the control of growth and development.

Functional profiling of differentially expressed genes

Significantly up and down-regulated blocks of functionally related genes were identified by performing a gene enrichment test (FatiScan) for all expressed genes ranked according to differential expression following training. Among the up-regulated genes we identified 275 significantly (FDR < 0.05) overrepresented GO terms and 13 KEGG pathways. Among the down-regulated genes we identified 207 significantly (FDR < 0.05) overrepresented GO terms and five KEGG pathways. Subsets of the functional groups are shown in Table 5 and Table 6, and were chosen to include all significant (FDR<0.05) KEGG pathways and all highly significantly (FDR < 0.0001) overrepresented functional groups satisfying GO > level 6 and for which at least six genes were identified.
Table 5

Gene ontology categories with significantly increased expression post-training compared to pre-training levels

GO IDGO TermP
BP:0009060aerobic respiration1.89 × 10-16
BP:0046356acetyl-CoA catabolic process2.28 × 10-16
BP:0006099tricarboxylic acid cycle5.83 × 10-16
BP:0006100tricarboxylic acid cycle intermediate metabolic process5.92 × 10-10
BP:0019395fatty acid oxidation4.65 × 10-08
BP:0006119oxidative phosphorylation3.69 × 10-06
BP:0006956complement activation4.07 × 10-06
BP:0002455humoral immune response mediated by circulating immunoglobulin4.07 × 10-06
BP:0002253activation of immune response5.31 × 10-06
BP:0006635fatty acid beta-oxidation6.70 × 10-06
BP:0002541activation of plasma proteins during acute inflammatory response8.46 × 10-06
BP:0050778positive regulation of immune response8.46 × 10-06
BP:0006631fatty acid metabolic process7.12 × 10-05
CC:0005739mitochondrion1.04 × 10-41
CC:0043231intracellular membrane-bound organelle8.17 × 10-21
CC:0019866organelle inner membrane2.16 × 10-19
CC:0044429mitochondrial part1.04 × 10-16
CC:0044444cytoplasmic part6.14 × 10-16
CC:0031967organelle envelope1.07 × 10-08
CC:0031090organelle membrane2.25 × 10-05
CC:0000793condensed chromosome5.40 × 10-05
CC:0005840ribosome7.74 × 10-05

KEGG IDKEGG pathway

hsa04510Complement and coagulation cascades5.61 × 10-06
has00750Vitamin B6 metabolism1.21 × 10-04
hsa00790Folate biosynthesis1.35 × 10-04
hsa00350Tyrosine metabolism3.93 × 10-04
hsa00760Nicotinate and nicotinamide metabolism4.51 × 10-04
hsa00020Citrate cycle (TCA cycle)0.002
hsa00190Oxidative phosphorylation0.002
hsa00500Starch and sucrose metabolism0.002
hsa00280Valine, leucine and isoleucine degradation0.003
hsa00380Tryptophan metabolism0.003
has00720Reductive carboxylate cycle (CO2 fixation)0.007
hsa00860Porphyrin and chlorophyll metabolism0.019
hsa00252Alanine and aspartate metabolism0.032
Table 6

Gene ontology categories with significantly decreased expression post-training compared to pre-training levels

GO IDGO TermP
BP:0006817phosphate transport2.92 × 10-20
BP:0015698inorganic anion transport7.84 × 10-18
BP:0050679positive regulation of epithelial cell proliferation9.57 × 10-05
CC:0005856cytoskeleton4.00 × 10-09
CC:0044430cytoskeletal part5.59 × 10-09
CC:0016528sarcoplasm6.32 × 10-07
CC:0015629actin cytoskeleton2.11 × 10-06
CC:0016529sarcoplasmic reticulum2.93 × 10-06
CC:0005887integral to plasma membrane6.96 × 10-06

KEGG IDKEGG pathwayP

hsa04530Tight junction5.30 × 10-04
hsa04630Jak-STAT signaling pathway0.008
hsa04720Long-term potentiation0.013
hsa01430Cell communication0.032
hsa04512ECM-receptor interaction0.046
Gene ontology categories with significantly increased expression post-training compared to pre-training levels Gene ontology categories with significantly decreased expression post-training compared to pre-training levels The most significantly overrepresented cellular compartment GO groups among the genes with increased abundance post-training were mitochondrion (CC GO:0005739; P < 1.04 × 10-41) and related terms such as organelle inner membrane (CC GO:0019866) and mitochondrial part (CC GO:0044429). Aerobic respiration (BP GO:0009060), oxidative phosphorylation (BP GO:0006119) and the tricarboxylic acid cycle (GO BP:0006099) were among the overrepresented GO biological processes groups. The KEGG pathways included Citrate cycle (TCA cycle) (hsa00020) and Oxidative phosphorylation (hsa00190) and multiple metabolism pathways. These transcriptional data concur with biochemical and physiological studies that have demonstrated an increase in mitochondrial volume and aerobic capacity following endurance training [1,2]. Although there is evidence to indicate that an increase in oxidative capacity is part of the maturation process in horses [64] it has been demonstrated that exercise training, not growth, causes increases in whole muscle activity of the oxidative enzyme succinate dehydrogynase and changes in muscle fibre type composition in young Thoroughbred horses [14]. To our knowledge, this is the first time that these GO groups have been shown to have increased expression following exercise training. This highlights the value of using a method such as FatiScan which incorporates all experimental data rather than limiting interpretation to those that rank among the highly differentially expressed. Only three mitochondrial genes were among those significantly differentially expressed: MRPS21, SLC25A29 and ACADVL. MRPS21 is a nuclear-encoded mitochondrial ribosomal gene required for protein synthesis in the mitochondria. Therefore, an increase in mitochondrial abundance would require an increase in mitochondrial protein synthesis. The SLC25A29 and ACADVL proteins are localized in the mitochondrial inner membrane and play a role in fat metabolism [65,66]. The fatty acid oxidation (BP GO:0019395), fatty acid beta-oxidation (BP GO:0006635) and fatty acid metabolic process (BP GO:0006631) GO ontologies were also overrepresented among genes that increased expression following training. This is in agreement with previous observations of a shift towards fatty acid metabolism in response to exercise training [3]. Furthermore, 12 of the 13 up-regulated KEGG pathways were associated with aerobic respiration and metabolism. Overall these results demonstrate that exercise training brings about a subtle but coordinated increase in the basal level of gene expression of a wide array of genes involved in energy production and metabolism. Interestingly there was also an up-regulation of GO terms involved in the immune response such as the KEGG pathway complement and coagulation cascades, complement activation and positive regulation of immune response. The up-regulation of the complement and coagulation cascades may be a response to exercise induced hemolysis. It has been suggested that exercise induced decreases in blood pH and increases in blood temperature may increase the osmotic fragility of erythrocytes. Previous studies have shown that an immune response is elicited in response to a single bout of exercise and that this response is attenuated in trained subjects. Furthermore, it appears that moderate exercise can enhance the immune response [67], whereas over-training in humans is detrimental to health and can leave athletes more susceptible to infection [68]. Overtraining in horses has been associated with increased levels of the alpha-1-antitrypsin protein [69] which is involved in protection of cells from inflammatory enzymes released from neutrophils [70]. This protein was also found to be increased in humans following a marathon run but returned to basal levels within a few hours [71]. Despite numerous studies documenting the immune response to a single bout of exercise [72-74], little is known regarding the molecular mechanisms governing the adaptations to the immune response brought about by exercise training. It has been suggested that exercise-induced reactive oxygen species (ROS) may play a major role in the modulation of the immune response following exercise [75]. It is also likely that exercise-induced muscle damage contributes to the inflammatory response [76]. The exercise regime undertaken by the horses in this study incorporated both endurance and sprint work which would be expected to elicit both increased ROS and intramuscular microtears. Another interesting observation was the increased expression of ribosomal genes as elevated rates of protein synthesis and degradation have been reported following resistance exercise with an overall increase in protein mass [4,77,78]. The down-regulated functional groups were mainly associated with structural genes and ion transport. It has been shown that the cellular response to mechanical stimuli, such as increased load, involves ECM signalling to the cytoskeleton at focal adhesion complexes via integrin receptors. Ion transport is central to muscular contraction. Calcium is the main regulatory and signalling molecule in muscle and ATP synthesis is dependent on phosphate transport. Although the down-regulation of these functional groups is counter-intuitive, the modulation of gene expression in these functional groups may reflect structural reorganization of myofibrils.

Validation of a panel of genes by real time qRT-PCR

Eleven genes represented by tags that were differentially expressed between untrained and trained skeletal muscle were selected for real time qRT-PCR validation. Four tags (acyl-coenzyme A dehydrogenase, very long chain [ACADVL], actinin, alpha 3 [ACTN3], dystroglycan 1 [DAG1] and 28 S ribosomal protein S21, mitochondrial [MRPS21]) were located within a known gene and seven (calmodulin 3 [CALM3], insulin-like growth factor binding protein-5 [IGFPB5], myostatin [MSTN], period homolog 2 [PER2], period homolog 3 [PER3], solute carrier family 25 member 29 [SLC25A29] and troponin T type 3 [TNNT3]) were located within 5 kb of a known gene and were predicted to represent the gene. Primers were designed to span exons 1 and 2 or exons 2 and 3 of the gene of interest. This approach was taken to validate both the differential expression of genes and to assess the prediction that the differentially expressed tags that were identified within 5 kb of a known gene were indeed representative transcripts of that gene. The mean expression of three of the four genes represented by intergenic tags reached significance (P < 0.05) and concurred with DGE data. ACTN3 showed the same direction of change as the DGE data and tended towards significance (P < 0.1). The mean expression of six of the seven genes predicted to be represented by adjacent tags agreed with the DGE data, the exception being TNNT3. The putative TNNT3 tag was matched to a region ~880 bp downstream of the TNNT3 gene and may represent a novel gene or mRNA. Alternatively the tag may span a splice site in an alternative gene and consequently may represent RNA transcribed from a different region in the genome. Real time qRT-PCR results are detailed in Table 7.
Table 7

Real time qRT-PCR results for genes used to validate DGE data

TagGene SymbolGene NameDGE FCRT-PCR FCP
gctgctctgcagtctgaACADVLAcyl-Coenzyme A dehydrogenase, very long chain1.651.720.014
acccgagagacagccgaACTN3Actinin, alpha 3-1.97-1.41NS
ccactaccctcttactcCALM3Calmodulin 3-2.75-1.810.028
gaaaacagtagctaaagDAG1Dystroglycan 1-2.81-1.270.021
ggactgtctttatttttIGFBP5Insulin-like growth factor binding protein-5-4.35-3.180.023
gagtgcagcctttcaccMRPS2128 S ribosomal protein S21, mitochondrial9.476.030.013
tatgacagaaaagcaacMSTNMyostatin-4.35-4.970.004
tgttgaagcgatgcagtPER2Period homolog 2+inf1.880.003
tgttggtaagtagatcgPER3Period homolog 3 (Drosophila)2.071.740.001
tggctgtatggggaggcSLC25A29Solute carrier family 25 member 292.501.220.035
gatgaagctgggatgcaTNNT3Troponin T Type 32.930.94NS

The figure for the DGE fold change could not be calculated due to the fact that the PER2 transcript was undetectable pre-training (the transcript had zero counts in all the pre-training samples).

Real time qRT-PCR results for genes used to validate DGE data The figure for the DGE fold change could not be calculated due to the fact that the PER2 transcript was undetectable pre-training (the transcript had zero counts in all the pre-training samples). The PER2 and PER3 genes, key molecular clock components within the mammalian circadian timing system [79], had mean post-training increases in expression of +1.88-fold and +1.74 fold respectively. The induction of these genes may represent an entrainment of the muscle transcriptional clock by a regular exercise regime. While primarily regulated by photoperiodic signals to the master pacemaker within the suprachiasmatic nucleus, peripheral circadian clocks, which are known to exist in almost all peripheral tissues examined to date [80], can also be entrained by alternative timing cues including exercise [81] and feeding [82]. The role of peripheral clocks is to align specific tissue function to the correct time of day via differential regulation of subsets of clock-controlled genes. As exercise is a known synchroniser of circadian rhythms in mice [83], humans [81] and horses [84], and PER2 has previously been shown to oscillate in equine tissues [85], the increased expression of PER genes post-training in the current study is thought to represent a strengthening of the endogenous circadian clock in equine muscle. Furthermore, human studies have shown time of day variations in exercise performance at the physiological level [86-88], and it has been suggested that circadian rhythms may play an important role in sports performance [89]. Combined with our results, this is strong incentive for further investigation of the influence of training times on daily muscle function in the horse, such that optimal athletic performance may be achieved. The proteins encoded by ACADVL (+1.72-fold, P = 0.014), MRPS21 (+6.03-fold, P = 0.013) and SLC25A29 (+1.22-fold, P = 0.350) function in the mitochondria to increase protein synthesis and fat metabolism. The increase in expression of the gene encoding the mitochondrial ribosomal protein MRPS21 likely reflects an increase in mitochondrial protein synthesis and an overall increase in mitochondrial volume. Numerous studies have demonstrated an increase in mitochondrial volume concurrent with an increase in VO2max following endurance training [90-93]. The proteins encoded by ACADVL and SLC25A29 are involved in fat metabolism and are located in the mitochondrial inner membrane. ACTN3, CALM3 and DAG1 were decreased in expression by -1.41-fold (P = 0.090), -1.81-fold (P = 0.028) and -1.27-fold (P = 0.021) respectively. The ACTN3 protein is localized to the skeletal muscle z-discs and DAG1 forms part of the dystroglycan complex. A null mutation in the ACTN3 gene has been associated with sprint performance in human athletes [94] and DAG1 has been proposed as a candidate gene in some muscular myopathies [95,96]. CALM3 is an isoform of calmodulin, a calcium-modulated protein which regulate numerous protein targets. The binding of calcium to calmodulin induces a conformational change which affects its ability to bind target proteins. In this manner calmodulin may be used by other proteins as a calcium sensor and signal transducer. CALM3 may be involved in muscle fibre type transformation in response to muscle excitation [97,98]. CALM3 gene expression was also decreased in equine muscle four hours post exhaustive treadmill exercise [47]. IGFBP5 and MSTN encode growth factors with large observed decreases in expression post training (-3.18-fold, P = 0.023 and -4.97-fold P = 0.004 respectively). IGFBP5 is one of family of modulators of insulin like growth factors (IGFs) which interact with IGFs resulting in an increase in half life and alteration of the interaction with receptors. IGF-1 promotes muscle hypertrophy and protein levels are increased in humans following administration of human growth hormone as an illegal doping agent [99,100]. The exact mode of action of IGFBP5 is poorly understood however it has been shown to associate with the extra cellular matrix and is a regulator of a wide range of physiological processes including cell proliferation and muscle cell differentiation [101-103]. Myostatin encoded by the MSTN gene is a negative regulator of muscle growth and an inhibitor of satellite cell proliferation[104]. The expression of MSTN was found to be decreased in humans following resistance training [105,106]. Null mutations in this gene have been found to cause a double muscling phenotype in cattle, dogs, and humans [107-111]. Structural variation in the MSTN gene has also been associated with athletic performance in dogs [110] and horses [112]. The differential expression of this gene is of particular significance as an intronic SNP in equine MSTN has been found to be a strong predictor of optimal racing distance in Thoroughbred racehorses [112].

Conclusion

Deep sequencing of the equine skeletal muscle transcriptome has revealed novel transcripts and functional groups associated with this tissue. Furthermore, following exercise training we have observed an increase in the occurrence of genes involved in metabolism and oxidative phosphorylation, and a decrease in the expression of structural genes. Overrepresented functional groups of genes post-training were associated with both endurance and resistance exercise. This study documents the transcriptome-wide reprogramming of skeletal muscle in Thoroughbred racehorses that brings about the well documented phenotypic adaptations to exercise.

Methods

Subjects

All animal procedures were approved by the University College Dublin, Animal Research Ethics Committee, a licence was granted from the Department of Health and Children (Ireland) and owners' consent was obtained for all horses. Seven two-year-old untrained Thoroughbred horses (n = 5 females, n = 2 entire males), raised on the same farm for the previous 2 - 3 months and destined for Flat racing with the same trainer comprised the study cohort. The horses had a mean height of 154.9 cm (± 2.8) and a mean pre-training weight of 437.4 kg (± 18.0). All horses undertook a regular exercise regime with the same trainer for 10 months (trained). This consisted of light canter (1,500 m) once a day six times a week on an all-weather gallop and higher intensity exercise ("work") no more than once a week which consisted of warm-up (walk and trot) followed by gallop with velocities reaching maximal intensity for 800-1,000 m.

Muscle biopsy sampling

Percutaneous needle muscle biopsies [113] were obtained from the dorsal compartment of the gluteus medius muscle according to Dingboom and colleagues [114] using a 6 mm diameter, modified Bergstrom biopsy needle (Jørgen KRUUSE, Veterinary Supplies). Biopsies were taken approximately 15 cm caudodorsal (one-third of the distance) to the tuber coxae on an imaginary line drawn from the tuber coxae to the head of the tail. The biopsies were obtained at a depth of 80 mm. Each biopsy site was shaved, scrubbed with an antiseptic and desensitized by a local anaesthetic. The biopsy samples were washed with sterile PBS (BD Biosciences, San Jose, CA) and preserved in RNAlater (Ambion, UK) for 24 hours at 4°C and then stored at -20°C. Muscle biopsy samples were collected at rest at two time points: T0-untrained and T2-trained.

RNA isolation and purification

Approximately 100 mg of each muscle biopsy sample was removed from RNAlater and homogenized in 1 ml TRIzol using a TissueLyser (Qiagen Ltd, Crawley, UK) and extracted according to the manufacturer's instructions. Each sample was purified using the RNeasy® Mini kit (Qiagen Ltd, Crawley, UK) and DNase treated with RNase free DNase (Qiagen Ltd, Crawley, UK). RNA was quantified using a NanoDrop® ND1000 spectrophotometer V 3.5.2 (NanoDrop Technologies, Wilmington, DE) and RNA quality was subsequently assessed using the 18S/28 S ratio and RNA integrity number (RIN) on an Agilent Bioanalyser with the RNA 6000 Nano LabChip kit (Agilent Technologies Ireland Ltd, Dublin, Ireland) according to the manufacturers' instructions.

Library preparation for Illumina sequencing

The Illumina cDNA library was prepared according to the manufacturer's instructions. All reagents were supplied by Illumina apart from SuperScript II Reverse Transcriptase (part # 18064-014) with 100 mM DTT. Briefly, 1.5 μg mRNA was isolated from total RNA by binding the mRNA to a magnetic oligo(dT) bead. Double stranded cDNA was synthesized and cleaved at each NlaIII site. The site of NlaIII cleavage was ligated with an Illumina-supplied adaptor using T4 DNA ligase. The bead bound double stranded cDNA was the cut by the restriction enzyme, MmeI. This resulted in a 17 bp tag which was no longer attached to the oligo(dT) bead. The cDNA construct was then precipitated and the site of MmeI cleavage was ligated with an Illumina-supplied adaptor using T4 DNA ligase. The adaptor ligated cDNA was PCR amplified with two adapter primers (Illumina). The PCR product of 85 bp was purified by gel extraction in preparation for loading on the Illumina Cluster Station. The quality and quantity of the purified constructs were assessed using an Agilent DNA series 7500 series II assay (Agilent Technologies Ireland Ltd, Dublin, Ireland) and Qubit fluorometer according to manufacturer's instructions. Cluster generation and sequencing analysis were carried out using Illumina's Solexa Sequencer according to the manufacturer's instructions.

Analysis

The DGE samples were processed through the standard software pipeline provided by Illumina for the Genome Analyzer. The sequence reads were base called using the Bustard base caller (part of the Illumina software). The tag annotation pipeline consisted of two parts: mapping to known Ensembl [115] cDNAs and mapping to the genome. The known cDNAs from version 49 of Ensembl for the EquCab2 assembly of the equine genome were downloaded in FASTA format using the Ensembl biomart tool. The FASTA files for the individual equine chromosomes were downloaded from the UCSC genome browser website [116]. A pipeline consisting of perl, C++ and linux shell scripts was used to conduct an in-silico digestion of both the transcriptome and genome and to generate tag location records which were loaded into a MySQL database. The tag records were then annotated according to their type (genomic or cDNA, canonical, noncanonical, repeat etc.). A matrix of tag counts for each sample was generated. The edgeR Bioconductor package [117] was used to determine differential expression of tags in each group.

Functional clustering according to gene ontology annotations

The equine Ensembl gene IDs were cross-matched to human Ensembl gene IDs. Using the Ensembl IDs of human homologues of equine genes it was possible to use the Database for Annotation, Visualization and Integrated Discovery (DAVID) [118,119] for functional clustering and overrepresentation analyses. The Expression Analysis Systematic Explorer (EASE) tool [120] within DAVID was used to investigate the representation of functional groups in equine skeletal muscle relative to the whole genome. The FatiScan [121,122] gene enrichment test was used to analyse the transcriptional profile post-training. FatiScan is part of the Babelomics Suite of web tools and tests for the asymmetrical distribution of biological labels in an ordered list of genes through application of a Fisher's exact test. Genes were ranked by differential expression and FatiScan was used to detect functional blocks (GO and KEGG pathways) that were significantly up-regulated and down-regulated post-training. Results from both EASE and FatiScan were corrected for multiple testing using the Benjamini and Hochberg method [123].

Real time quantitative RT-PCR

Selected cDNA samples were quantified by real time quantitative RT-PCR (qRT-PCR). 1 μg of total RNA from each sample was reverse transcribed into cDNA with oligo-dT primers using a SuperScript™ III first strand synthesis SuperMix kit according to the manufacturer's instructions (Invitrogen Ltd, Paisley, UK). The converted cDNA was diluted to 2.5 ng/μl working stocks and stored at -20°C for subsequent analyses. Oligonucleotide primers for real time qRT-PCR were designed using Primer3 version 3.0 http://www.primer3.sourceforge.net and commercially synthesized (MWG Biotech, Germany). Primer details are shown in Table 8. Each reaction was carried out in a total volume of 20 μl with 5 μl of cDNA (1 ng/μl), 10 μl SYBR® Green PCR Master Mix (Applied Biosystems, Cambridgeshire, UK) and 5 μl primer/H2O. Real time qRT-PCR was performed using a 7500 Fast Real-Time PCR machine (Applied Biosystems, Cambridgeshire, UK). All reactions were performed in duplicate. Hypoxanthine phosphoribosyltransferase 1 (HPRT) was selected as a stable reference gene based on a study of equine reference genes for real time qRT-PCR [124] and on the DGE results. Expression values were calculated using a standard curve which was plotted based on the expression of HPRT in serial dilutions of equine skeletal muscle RNA (1:1, 1:2, 1:4, 1:8, 1:16, 1:32, and 1:64). The standard curve method was used to normalise the gene expression data. The paired Student's t-test was used to identify significant differences in mRNA abundance between time-points.
Table 8

Real time qRT-PCR primers for genes used to validate DGE data

Gene symbolForward PrimerReverse Primer
ACADVLctgcccagcgatcctatgttccactggtcgaagtctca
ACTN3cggcgagtatatggaacagggtgagttgcaccaggcagt
CALMagcacttggtggactccttgaaatgcctgactgtgctcaa
DAG1ccaggaggagtgagcacctctcaccctctgcacacctg
IGFBP5ggaggagccgagaacactggcgaagcctccatgtgtc
MRPS21ggagatctgctgtttgctcatctctcaaagcgacccatct
MSTNtgacagcagtgatggctcttttgggttttccttccacttg
PER2agcctgatgatggcgaagtctgaaagttctttgtgcgtgtctgccttg
PER3aactatgcccttcgctgtgtgtacccggtcacatctgctt
SLC25A29ggacacccgtttgacactgctgatgatggattggaagca
TNNT3cggagggggagaaagtagaccaaagtggctgtcgatgaga
Real time qRT-PCR primers for genes used to validate DGE data

Authors' contributions

BMcG & EH designed the experiment. BMcG, EH, LK and RF participated in the collection of samples. BMcG performed the RNA extractions. BMcG and JB generated the cDNA libraries. BMcG performed the real time qRT-PCR experiments. PM was responsible for the bioinformatics pipeline. AL, BL and AE were responsible for the sequencing project. BMcG performed functional analysis of the data. PM, BM and DMacH assisted with manuscript preparation. BMcG and EH wrote the paper. EH coordinated and supervised the project. All authors read and approved the final manuscript.
  119 in total

1.  Effects of regular training at the same time of day on diurnal fluctuations in muscular performance.

Authors:  Nizar Souissi; Antoine Gauthier; Bruno Sesboüé; Jacques Larue; Damien Davenne
Journal:  J Sports Sci       Date:  2002-11       Impact factor: 3.337

2.  Global gene expression in skeletal muscle from well-trained strength and endurance athletes.

Authors:  Nigel K Stepto; Vernon G Coffey; Andrew L Carey; Anna P Ponnampalam; Benedict J Canny; David Powell; John A Hawley
Journal:  Med Sci Sports Exerc       Date:  2009-03       Impact factor: 5.411

Review 3.  Dystroglycan: important player in skeletal muscle and beyond.

Authors:  Ronald D Cohn
Journal:  Neuromuscul Disord       Date:  2005-01-28       Impact factor: 4.296

4.  Interference of strength development by simultaneously training for strength and endurance.

Authors:  R C Hickson
Journal:  Eur J Appl Physiol Occup Physiol       Date:  1980

5.  Effect of growth and training on muscle adaptation in Thoroughbred horses.

Authors:  Seiko Yamano; Daisuke Eto; Takao Sugiura; Makoto Kai; Atsushi Hiraga; Mikihiko Tokuriki; Hirofumi Miyata
Journal:  Am J Vet Res       Date:  2002-10       Impact factor: 1.156

6.  Identifying biological themes within lists of genes with EASE.

Authors:  Douglas A Hosack; Glynn Dennis; Brad T Sherman; H Clifford Lane; Richard A Lempicki
Journal:  Genome Biol       Date:  2003-09-11       Impact factor: 13.583

7.  Regularly scheduled voluntary exercise synchronizes the mouse circadian clock.

Authors:  D M Edgar; W C Dement
Journal:  Am J Physiol       Date:  1991-10

8.  Resistance training reduces the acute exercise-induced increase in muscle protein turnover.

Authors:  S M Phillips; K D Tipton; A A Ferrando; R R Wolfe
Journal:  Am J Physiol       Date:  1999-01

9.  Genomic DNA organization of human mitochondrial very-long-chain acyl-CoA dehydrogenase and mutation analysis.

Authors:  K O Orii; T Aoyama; M Souri; K E Orii; N Kondo; T Orii; T Hashimoto
Journal:  Biochem Biophys Res Commun       Date:  1995-12-26       Impact factor: 3.575

10.  Skeletal muscle characteristics in young trained and untrained standardbred trotters.

Authors:  M Ronéus; B Essén-Gustavsson; A Lindholm; S G Persson
Journal:  Equine Vet J       Date:  1992-07       Impact factor: 2.888

View more
  28 in total

1.  The genetic origin and history of speed in the Thoroughbred racehorse.

Authors:  Mim A Bower; Beatrice A McGivney; Michael G Campana; Jingjing Gu; Lisa S Andersson; Elizabeth Barrett; Catherine R Davis; Sofia Mikko; Frauke Stock; Valery Voronkova; Daniel G Bradley; Alan G Fahey; Gabriella Lindgren; David E MacHugh; Galina Sulimova; Emmeline W Hill
Journal:  Nat Commun       Date:  2012-01-24       Impact factor: 14.919

Review 2.  Physiological and pathological roles of mitochondrial SLC25 carriers.

Authors:  Manuel Gutiérrez-Aguilar; Christopher P Baines
Journal:  Biochem J       Date:  2013-09-15       Impact factor: 3.857

Review 3.  RNA sequencing as a powerful tool in searching for genes influencing health and performance traits of horses.

Authors:  Monika Stefaniuk; Katarzyna Ropka-Molik
Journal:  J Appl Genet       Date:  2015-10-07       Impact factor: 3.240

4.  Whole transcriptome analyses of six thoroughbred horses before and after exercise using RNA-Seq.

Authors:  Kyung-Do Park; Jongsun Park; Junsu Ko; Byung Chul Kim; Heui-Soo Kim; Kung Ahn; Kyoung-Tag Do; Hansol Choi; Hak-Min Kim; Sanghoon Song; Sunghoon Lee; Sungwoong Jho; Hong-Sik Kong; Young Mok Yang; Byung-Hak Jhun; Chulhong Kim; Tae-Hyung Kim; Seungwoo Hwang; Jong Bhak; Hak-Kyo Lee; Byung-Wook Cho
Journal:  BMC Genomics       Date:  2012-09-12       Impact factor: 3.969

5.  A genome-wide SNP-association study confirms a sequence variant (g.66493737C>T) in the equine myostatin (MSTN) gene as the most powerful predictor of optimum racing distance for Thoroughbred racehorses.

Authors:  Emmeline W Hill; Beatrice A McGivney; Jingjing Gu; Ronan Whiston; David E Machugh
Journal:  BMC Genomics       Date:  2010-10-11       Impact factor: 3.969

6.  Physical fitness and mitochondrial respiratory capacity in horse skeletal muscle.

Authors:  Dominique-Marie Votion; Erich Gnaiger; Hélène Lemieux; Ange Mouithys-Mickalad; Didier Serteyn
Journal:  PLoS One       Date:  2012-04-18       Impact factor: 3.240

7.  Peeling back the evolutionary layers of molecular mechanisms responsive to exercise-stress in the skeletal muscle of the racing horse.

Authors:  Hyeongmin Kim; Taeheon Lee; Woncheoul Park; Jin Woo Lee; Jaemin Kim; Bo-Young Lee; Hyeonju Ahn; Sunjin Moon; Seoae Cho; Kyoung-Tag Do; Heui-Soo Kim; Hak-Kyo Lee; Chang-Kyu Lee; Hong-Sik Kong; Young-Mok Yang; Jongsun Park; Hak-Min Kim; Byung Chul Kim; Seungwoo Hwang; Jong Bhak; Dave Burt; Kyoung-Do Park; Byung-Wook Cho; Heebal Kim
Journal:  DNA Res       Date:  2013-04-11       Impact factor: 4.458

8.  Investigation of de novo unique differentially expressed genes related to evolution in exercise response during domestication in Thoroughbred race horses.

Authors:  Woncheoul Park; Jaemin Kim; Hyeon Jeong Kim; JaeYoung Choi; Jeong-Woong Park; Hyun-Woo Cho; Byeong-Woo Kim; Myung Hum Park; Teak-Soon Shin; Seong-Keun Cho; Jun-Kyu Park; Heebal Kim; Jae Yeon Hwang; Chang-Kyu Lee; Hak-Kyo Lee; Seoae Cho; Byung-Wook Cho
Journal:  PLoS One       Date:  2014-03-21       Impact factor: 3.240

9.  Whole blood transcriptomics and urinary metabolomics to define adaptive biochemical pathways of high-intensity exercise in 50-60 year old masters athletes.

Authors:  Kamalika Mukherjee; Brittany A Edgett; Harrison W Burrows; Cecilia Castro; Julian L Griffin; Adel Giaid Schwertani; Brendon J Gurd; Colin D Funk
Journal:  PLoS One       Date:  2014-03-18       Impact factor: 3.240

10.  A gene expression atlas of the domestic pig.

Authors:  Tom C Freeman; Alasdair Ivens; J Kenneth Baillie; Dario Beraldi; Mark W Barnett; David Dorward; Alison Downing; Lynsey Fairbairn; Ronan Kapetanovic; Sobia Raza; Andru Tomoiu; Ramiro Alberio; Chunlei Wu; Andrew I Su; Kim M Summers; Christopher K Tuggle; Alan L Archibald; David A Hume
Journal:  BMC Biol       Date:  2012-11-15       Impact factor: 7.431

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.