Literature DB >> 20488877

Ferrochelatase is a conserved downstream target of the blue light-sensing White collar complex in fungi.

Alexander Idnurm1, Joseph Heitman2.   

Abstract

Light is a universal signal perceived by organisms, including fungi, in which light regulates common and unique biological processes depending on the species. Previous research has established that conserved proteins, originally called White collar 1 and 2 from the ascomycete Neurospora crassa, regulate UV/blue light sensing. Homologous proteins function in distant relatives of N. crassa, including the basidiomycetes and zygomycetes, which diverged as long as a billion years ago. Here we conducted microarray experiments on the basidiomycete fungus Cryptococcus neoformans to identify light-regulated genes. Surprisingly, only a single gene was induced by light above the commonly used twofold threshold. This gene, HEM15, is predicted to encode a ferrochelatase that catalyses the final step in haem biosynthesis from highly photoreactive porphyrins. The C. neoformans gene complements a Saccharomyces cerevisiae hem15Delta strain and is essential for viability, and the Hem15 protein localizes to mitochondria, three lines of evidence that the gene encodes ferrochelatase. Regulation of HEM15 by light suggests a mechanism by which bwc1/bwc2 mutants are photosensitive and exhibit reduced virulence. We show that ferrochelatase is also light-regulated in a white collar-dependent fashion in N. crassa and the zygomycete Phycomyces blakesleeanus, indicating that ferrochelatase is an ancient target of photoregulation in the fungal kingdom.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20488877      PMCID: PMC3068673          DOI: 10.1099/mic.0.039222-0

Source DB:  PubMed          Journal:  Microbiology (Reading)        ISSN: 1350-0872            Impact factor:   2.777


INTRODUCTION

Light represents both a signal that provides clues about environmental conditions and a detrimental form of radiation that can kill or mutate organisms. Many fungi are capable of sensing light to regulate growth, asexual or sexual reproduction, or pigmentation, and thereby light represents a common environmental signal that orchestrates important growth and survival strategies (Tisch & Schmoll, 2010). In the last 5 years, it has emerged that a conserved pair of proteins, homologues of the White collar 1 (WC-1) and White collar 2 (WC-2) proteins that were first characterized in the model ascomycete Neurospora crassa, mediate near-UV and blue-light responses in representative species across the kingdom, including other ascomycetes, basidiomycetes and the Mucormycotina that were formerly known as the zygomycetes (reviewed by Bahn ; Corrochano, 2007; Herrera-Estrella & Horwitz, 2007; Purschwitz ). Thereby, fungi are enabled to sense blue light emanating from the sky, and also sense UV light directly or via associated blue light as a proxy for concomitant exposure to potentially injurious solar irradiation. Other photoreceptors are distributed sporadically within fungi to control light responses at other wavelengths, such as the red/far-red sensor phytochrome (Blumenstein ). Curiously, in Aspergillus nidulans, there is evidence for the phytochrome protein forming a large complex with the blue-light sensory system controlled by the White collar proteins, as well as potentially other signalling components through interactions with the Velvet proteins (Bayram ; Purschwitz , 2009); this further implicates the White collar complex (WCC) as a central component of light sensing. Remarkably, model fungi such as Saccharomyces cerevisiae and Candida albicans, and other hemiascomycetes have lost this light-sensing pathway, presumably as they adapted to different environmental niches such as soil and the mammalian gastrointestinal tract, in which blue-light sensing is no longer advantageous, analogous to the loss of vision in the blind fish that have evolved independently in caves around the world. WC-1 is a photoreceptor protein in which the flavin chromophore is bound to a Light-Oxygen-Voltage (LOV) domain (He ). WC-1 binds to WC-2 to form a complex that functions as a transcription factor evoking light-responsive target gene expression via GATA-type zinc finger DNA-binding domains (Froehlich ). Given the diversity of responses of fungi to light, there are likely many different downstream targets of the WC-1 and WC-2 proteins. However, there are some conserved targets that are light-induced, such as genes for β-carotene pigment production in the ascomycetes (Li & Schmidhauser, 1995; Ruiz-Roldán ) and zygomycetes (Silva , 2008), although these are not universally conserved, since the basidiomycete Cryptococcus neoformans does not produce carotenoid pigments, nor is melanization induced by light exposure. The identification and functional analysis of conserved light-regulated genes should provide an understanding of the selective pressures that maintain this signalling system in some fungi but not others. C. neoformans is a globally distributed human pathogen that is a particular threat to immunocompromised individuals (Casadevall & Perfect, 1998). It is a member of the phylum Basidiomycota and thus quite divergent from species such as N. crassa in the Ascomycota. Previous research has established that the white collar homologous genes BWC1/CWC1 and BWC2/CWC2 control the ability of C. neoformans to sense light and serve to repress mating (Idnurm & Heitman, 2005; Lu ; Yeh ). In addition, these two genes are required for tolerance to UV exposure and virulence in a mouse model of cryptococcosis (Idnurm & Heitman, 2005). Inhibition of mating could be a consequence of the transcriptional repression by light of genes within the mating-type locus, as seen by Northern blot analysis (Idnurm & Heitman, 2005). However, those studies used 24 h light or dark exposures, and the mating-type genes could be secondary targets of genes directly regulated by Bwc1–Bwc2. The genes responsible for the UV-sensitivity and reduced-virulence phenotypes are unknown. Here we performed whole-genome microarray analysis to identify genes regulated by a short exposure to light. The two most highly regulated genes were CFT1 and HEM15. CFT1 is the homologue of the S. cerevisiae FTR1 gene, which encodes a high-affinity iron permease. Iron metabolism is an active area of investigation in pathogens including C. neoformans, and CFT1 has been characterized independently and shown to be essential for virulence in C. neoformans (Jung ) as well as in Candida albicans (Ramanan & Wang, 2000). Here we focused on the HEM15 gene, predicted to encode ferrochelatase, an enzyme that catalyses the conversion of highly phototoxic porphyrin molecules into haem. This enzyme is conserved from bacteria to fungi and humans and plays key roles in photobiology. In fact, in humans, mutations in ferrochelatase result in a disease called porphyria, in which the accumulation of photoreactive porphyrin molecules renders afflicted individuals uniquely sensitive to light, causing photophobia (Kauppinen, 2005). We show that C. neoformans HEM15 encodes ferrochelatase, and that ferrochelatase is light-regulated in representative species of photosensing fungi from three diverse phyla of the fungal kingdom. Ferrochelatase is thus a highly conserved transcription factor target in three major phyla of the kingdom. Our findings suggest that fungi produce ferrochelatase in response to light as a means to reduce their exposure to photosensitization via light-mediated actions on porphyrins.

METHODS

Fungal strains and culture conditions.

Fungal strains used in the study are listed in Table 1. Yeast species were maintained on yeast peptone dextrose (YPD) medium and filamentous species on 5 % V8 juice pH 5 medium. The C. neoformans strains were revived from laboratory −80 °C glycerol stocks. The N. crassa wild-type and wc-1 mutant strain, and the wild-type Rhizopus oryzae strain were obtained from the Fungal Genetics Stock Center [University of Missouri-Kansas City (McCluskey, 2003; McCluskey )]. Phycomyces blakesleeanus wild-type and mad mutant strains were as reported previously (Idnurm ; Sanz ). For light-induction experiments, equal quantities of yeast cells, conidia or sporangiospores of wild-type or white collar 1 mutant strains were inoculated onto YPD agar plates (15 cm diameter) and grown in complete darkness for 1 or 2 days depending on the growth rate of each species, after which one set was exposed to light (1600 lux, cool-white fluorescent) for 1 h. Light treatments were replicated at least once. For R. oryzae, a wild-type strain was grown on 10 cm diameter Petri dishes, and received white-light illumination, or wavelengths modified with Lee filters #47B blue, #58 green and #25 red (LE 4747, LE 4758 and LE 4725, Calumet). Irradience was estimated to be 22, 0.3, 4 and 5 μmol m−2 s−1, for white, blue, green and red light, respectively. For all samples, cells or mycelia were harvested and frozen in a dry ice/ethanol bath before being lyophilized overnight.
Table 1.

Fungal strains used in this study

StrainGenotypeParent or backgroundReference or source
C. neoformans var. grubii (serotype A) strains
KN99αWild-type, MATαNielsen et al. (2003)
AI81bwc1 : : NATKN99αIdnurm & Heitman (2005)
AI132PH3-HEM15-GFP-NATKN99αThis study
C. neoformans var. neoformans (serotype D) strains
JEC21Wild-type, MATαKwon-Chung et al. (1992)
JEC20Wild-type, MATaKwon-Chung et al. (1992)
AI5bwc1 : : URA5 ura5 MATαJEC43Idnurm & Heitman (2005)
RAS009ADE2/ade2 ura5/ura5 LYS1/lys1 LYS2/lys2Sia et al. (2000)
AI170hem15 : : NAT/HEM15 ADE2/ade2 ura5/ura5 LYS1/lys1 LYS2/lys2RAS009This study
AI94LYS2/lys2 ADE2/ade2Idnurm & Heitman (2005)
AI169hem15 : : NAT/HEM15 LYS2/lys2 ADE2/ade2AI94This study
AI156HEM15-HYGJEC21This study
AI158hem15 : : NAT HEM15-HYGAI156This study
AI154PH3-HEM15-GFP-NATJEC20This study
AI159hem15 : : NAT PH3-HEM15-GFP-NATAI154×AI158This study
AI165hem15 : : NATJEC21×MATa version of AI158This study
Candida albicans strain
SC5314Wild-typeFonzi & Irwin (1993)
S. cerevisiae strains
Σ1278bWild-typeGrenson et al. (1966)
BY4742MATα his3 leu2 lys2 ura3Brachmann et al. (1998)
AIY1hem15 : : KanMX MATα his3 leu2 lys2 ura3BY4742This study
AIY3pTH19 hem15 : : KanMX MATα his3 leu2 lys2 ura3AIY1This study
AIY4pTH19-CnHEM15 hem15 : : KanMX MATα his3 leu2 lys2 ura3AIY1This study
N. crassa strains
FGSC 4200Wild-typeKafer & Fraser (1979)
FGSC 4398wc-1Degli-Innocenti & Russo (1984)
P. blakesleeanus strains
NRRL1555Wild-typeBergman et al. (1973)
L51madA madBLipson et al. (1980)
R. oryzae strain
RA 99-880Wild-typeMa et al. (2009)

Microarray analysis.

C. neoformans strains JEC20 and JEC21 were cultured over a 24 h time period, and exposed to light for 0, 1, 1.25 or 2 h. These two strains are congenic, differing only in the ∼20 genes found within the mating-type locus (Heitman ; Kwon-Chung ). RNA was isolated from freeze-dried samples using Trizol reagent according to the manufacturer's instructions (Invitrogen). For C. neoformans microarrays, 15 μg RNA was subjected to reverse transcription, and the cDNAs were labelled with Cy3 and Cy5 dyes (Amersham) and hybridized to the slides as described previously (Ko ). The microarray was constructed as part of a consortium within the C. neoformans community and was printed at the Duke University Microarray facility. It comprises 8000 70-mer oligonucleotides consisting of all genes predicted for the serotype D genome, primarily represented as a single spot, as well as control 70-mers from other organisms. After co-hybridization with Cy3- and Cy5-labelled cDNAs derived from dark- and light-treated samples, arrays were scanned with a GenePix 4000B scanner (Axon Instruments) and analysed using GenePix Pro v4.0 and BRB-ArrayTools (developed by Richard Simon and Amy Peng Lam at the National Cancer Institute; http://linus.nci.nih.gov/BRB-ArrayTools.html). Data were normalized using LOWESS smoothing, and differential expression was determined using a randomized variance t/F test. The threshold P value for determining differential expression was P<0.05. Six replicates were analysed, three for strain JEC21 (MATα) and three for strain JEC20 (MATa), with the induction experiments being conducted on independent days spanning a 9 month time frame.

Northern blot analysis.

RNA was extracted from lyophilized yeast cells or mycelia using TRIzol reagent. Total RNA (15, 20 or 25 μg) was resolved on denaturing formaldehyde agarose gels, blotted to Zeta-Probe membranes (Bio-Rad), and probed with [α-32P]dCTP radiolabelled DNA fragments of genes amplified with the primers listed in Table 2.
Table 2.

Oligonucleotide primers used in this study

PrimerSequence (5′–3′)Purpose
JOHE16530TCATTTGCCCTCTTGACTTCDeletion of C. neoformans HEM15, 5′ flank
JOHE16531GCTTATGTGAGTCCTCCCTGGGACGTTGGATTGCAG
JOHE16532CTCGTTTCTACATCTCTTCATCCTCGACATGTGAGCCDeletion of C. neoformans HEM15, 3′ flank
JOHE16533GAGCCATTCTACAAAACCAC
JOHE8677GAAGAGATGTAGAAACGAGNAT cassette
JOHE11866GGGAGGACTCACATAAGC
JOHE17764ATACCTGCTATTTGGACAAATTTAGCAGTAAAAAAAAGAACGTTTAAAGACGTACGCTGCAGGTCGACDeletion of S. cerevisiae HEM15
JOHE17765ATAAATAAGAGAATATACTGATATTGAGATTGTGGGATGAATGGCCCTTAATCGATGAATTCGAGCTCG
JOHE16534GAGCTATGGCAAACACCGC. neoformans HEM1 probe
JOHE16535AGCTGCTTGTCAGACCAG
JOHE16536TGGTCGAGGGCACATCAAGC. neoformans HEM14 probe
JOHE16537ATGATGAATGTTACAGAC
JOHE16538TCGAATGCTGCCAAACCCC. neoformans HEM12 probe
JOHE16539CCCATATCTTCCGGTTTG
JOHE8713ATGGAAGAAGAAGGTACGC. neoformans ACT1 probe
JOHE8714TTAGAAACACTTTCGGTG
JOHE16577ATGGCCTCCATGGCACTGAGN. crassa hem-15 probe
JOHE16578TGTCCAGCAAAGAACTTC
JOHE16581TCTACTGGTTATCATGGGN. crassa act-1 probe
JOHE16582AGAAGCACTTGCGGTGCACG
JOHE16613GCHCCHCAYAARCMYTAYRTYGCNTTP. blakesleeanus hemH degenerate primers
JOHE16622GTYTCRATRTGRTCSWYDGTRAANGC
JOHE16609CACACTTTCTACAACGAGP. blakesleeanus act1 probe (AJ287184)
JOHE16610ACATCTGCTGGAAGGTAG
JOHE16799ATGACTGCAATCCAACGTCCCloning C. neoformans HEM15 cDNA
JOHE16800CTAAGCGGCCATTTTCGTACC
JOHE16645CCATGGCTGCAATCCAACGTCCLocalization of C. neoformans Hem15
JOHE16646CCATGGGAGCGGCCATATTCGTAC
JOHE17187ATGCTTTCCAGAACAATCCGS. cerevisiae HEM15 probe
JOHE17188TCAAGTAGATTTCGTGATTGC
JOHE17189ATGGATTCTGAGGTTGCTGCS. cerevisiae ACT1 probe (hybridizes with Candida albicans)
JOHE17190AGAAACACTTGTGGTGAACG
JOHE17191ACTTGCATTGCCAGAAGAGGCandida albicans HEM15 probe
JOHE17192CCTTGTGCTCTTTCACTACC
JOHE17342CACTGGATCTCTACTTGGR. oryzae HEM15 probe
JOHE17343TCGATGTGATCCTTGACG
JOHE15199ACGGTTCCGGTATGTGTAAGR. oryzae ACT1 probe
JOHE15200TCTGTGGACAATAGAAGGAC
JOHE16225CCAACGGTCAGGTATGTCC. neoformans HMP1 probe
JOHE16226ATCGTGCTGGACATTACC
JOHE12182GGATCCATGTCCCTCCTCGCCGAGTCC. neoformans BWC2 probe
JOHE12183GGATCCAGATTGCTTATCTTTTTTGGG
JOHE16221TCTGTGACTTTCATTCAGC. neoformans CFT1 probe
JOHE16222CCTTCTCAGATCCTTCTG
JOHE16223TGGACCTGCAGTTGGCTCC. neoformans HEM15 probe
JOHE16224CTCTAAATGCAAACAGTC

Generation of a hem15 deletion strain of C. neoformans.

The HEM15 gene was targeted for gene disruption by biolistic transformation with an overlap PCR product. The 5′ and 3′ flanking regions of the HEM15 gene were amplified from genomic DNA of strain JEC21 with primers JOHE16530/JOHE16531 and JOHE16532/JOHE16533, respectively. The nourseothricin acetyltransferase (NAT) gene was amplified with primers JOHE8677/JOHE11866 from plasmid pAI3. The three products were mixed in an equimolar ratio and an overlap amplification was performed with primers JOHE16530/JOHE16533. The construct was precipitated onto gold beads and wild-type strains were transformed using a PDS-1000/He particle delivery system (Bio-Rad) following reported protocols (Toffaletti ). Correct gene replacement events in strains were confirmed by PCR and Southern blot analysis. No transformants with homologous replacement events were obtained in wild-type haploid strains. The HEM15 gene was replaced with the NAT marker in diploid strains RAS009 and AI94, and in a strain transformed with HEM15 fused to a hygromycin-resistance cassette. To construct this plasmid, the wild-type HEM15 gene was amplified by PCR and cloned into pCR2.1 TOPO (Invitrogen), and an XbaI–SpeI fragment containing the Hyg gene from pJAF15 was inserted into the SpeI site. To isolate hem15Δ haploid strains, the haploid hem15 : : NAT HEM15-HYG strain was crossed to wild-type strain JEC20 (MATa) on V8 pH 7 medium or Murashige–Skoog agar (Xue ), basidiospores were micromanipulated onto YPD agar or YPD supplemented with 10 μg haematin ml−1, and the phenotype of germinated progeny was determined on different medium types.

Generation of a hem15 deletion strain of S. cerevisiae and its complementation with the C. neoformans HEM15 gene.

To demonstrate that the putative C. neoformans HEM15 gene encodes a functional ferrochelatase, an S. cerevisiae hem15 mutant was complemented with the C. neoformans HEM15 gene. The S. cerevisiae hem15 mutant was generated by replacing the HEM15 ORF with the KanMX6 construct in strain BY4742. Flanks of HEM15 were included in primers JOHE17764 and JOHE17765, and these primers were used to amplify the KanMX6 construct, and S. cerevisiae cells were transformed with the DNA fragment using a lithium acetate/PEG heat-shock method. Transformants were plated on YPD medium containing 200 μg G418 ml−1 and 20 μg haematin ml−1. Gene replacement was confirmed by PCR and Southern blot analysis. The cDNA of C. neoformans was amplified from reverse-transcribed RNA of strain JEC21 and cloned into plasmid pCR2.1 TOPO, and a clone with no errors, as determined by DNA sequencing, was subcloned into the EcoRI site of plasmid pTH19. This plasmid comprises a  μ circle, the URA3 gene for selection in S. cerevisiae, and the ADH1 promoter to drive expression of inserted cDNAs (Harashima & Heitman, 2005). The S. cerevisiae hem15Δ and wild-type BY4742 strains were transformed with the plasmid and empty vector control, and selection was on synthetic dextrose (SD) medium minus uracil and supplemented with haematin (20 μg ml−1). Growth of strains was compared on media with and without haematin.

Subcellular localization of Hem15.

To assess the intracellular localization of Hem15 in C. neoformans, the HEM15 gene was amplified from genomic DNA of strain JEC21 with primers JOHE16645/JOHE16646 and subcloned using NcoI restriction enzyme sites in-frame with the GFP ORF, in a plasmid driving expression from the C. neoformans histone H3 promoter (Idnurm ). The construct was introduced into strains JEC20 and KN99α by Agrobacterium-mediated transformation (Idnurm ). A hem15 : : NAT HEM15-GFP strain was generated by crossing the JEC20+HEM15-GFP strain with strain AI158, isolation of nourseothricin-resistant and hygromycin-sensitive progeny, and PCR analysis to determine which of these strains contained the hem15 : : NAT allele. Mitochondria were stained in live cells growing in YPD medium using MitoTracker Red (25 nM final concentration) according to the manufacturer's guidelines (Invitrogen). Fluorescence of cells was examined using a Zeiss Axiophot 2 Plus fluorescence microscope equipped with filters for excitation and detection of GFP and MitoTracker Red, and photographed with an AxioCam MRm digital camera.

Identification of fungal ferrochelatase homologues.

The N. crassa, S. cerevisiae, Candida albicans and R. oryzae ferrochelatase homologues were identified by blast searches of their genome sequences. The P. blakesleeanus genome sequence was unavailable at the time of the experiments, so the hemH gene was amplified from genomic DNA of strain NRRL1555 with degenerate oligonucleotide primers (JOHE16613/JOHE16622) designed for conserved regions in fungal ferrochelatase homologues. The 672 bp PCR fragment was amplified, cloned into the pCR2.1 TOPO plasmid, and sequenced. Each homologue was amplified with the primers listed in Table 2 and used as a probe for Northern blot analyses. Amplified fragments of the actin genes of each organism were used as loading and RNA transfer controls.

RESULTS

Identification of light-regulated genes in C. neoformans by whole-genome transcript analysis

To identify candidate targets for regulation by light as mediated by Bwc1–Bwc2 in C. neoformans, transcript abundance was assessed using microarray analysis. A microarray comprising 70-mer oligonucleotides for each of the ∼6000 genes in C. neoformans has been constructed by a consortium of C. neoformans research laboratories as based on the complete genome sequences of two serotype D strains (Loftus ). A series of initial microarrays used wild-type and bwc1 mutant strains grown in the light and dark compared with a pooled reference sample of RNA isolated from all four samples. It was apparent from these preliminary studies that insufficient transcript regulation was occurring in response to light to detect Bwc1-dependent transcripts through this approach. Therefore, an induction of 1–2 h was used to identify genes regulated by light in wild-type congenic strains JEC20 and JEC21. These two strains result from back-crossing strategies, such that they are identical except for the ∼20 genes that comprise the unique alleles (a or α) of the mating-type locus. Six replicates, three from each strain, were generated on six independent occasions, thus constituting a set of experimental replicates (rather than biological replicates, which are performed at the same time). Duplicate sets of strains were grown on YPD agar plates for 24 h, and one set was exposed to white fluorescent light (1, 1.25 or 2 h, 1600 lux white fluorescent light) shortly before harvesting the cells under safe red light conditions. cDNAs derived from either the light or constant dark treatment were labelled with Cy5 or Cy3 dyes and competitively hybridized to the microarray slides. The signal intensity for each dye was measured and analysed. All genes that provided hybridization data for at least four replicates (this eliminated about 200 probes on the array) were considered without exclusions based on signal intensity, with the rationale that our preliminary studies had suggested that the light-regulated genes of C. neoformans would be expressed at low basal levels and that any noise amplified by low transcript levels would be eliminated with at least four experimental replicates. The mean induction in response to light was calculated for each spot; it should be noted that variation exists between each replicate such that using the mean potentially reduces the number of regulated genes. The full dataset is available in the NCBI GEO database for those interested in alternative analyses. The microarray expression data revealed that no gene had a dramatic difference in transcript abundance between dark and light conditions (Table 3). Only a single gene, HEM15, responded to light to the extent that transcript levels were twice those observed in the dark. Many microarray studies cut off transcript changes at a twofold threshold; with such an approach this one gene alone would be considered as light-regulated in C. neoformans. In the C. neoformans analysis presented in Table 3, a stringent cut-off required at least a 1.5-fold increase or 0.5-fold decrease in transcription in the presence of light. This criterion was used, since we were uncertain whether or not we could confirm changes in abundance at levels below a 50 % increase or decrease, particularly given the complication that many genes tested showed low basal transcript abundance. In reducing the threshold, still very few genes were identified that were consistently upregulated or downregulated by light, that is 17 and 11, respectively (Table 3).
Table 3.

Summary of light-regulated and other genes in C. neoformans strains

Replicates 1–3 are for strain JEC21 (MATα) and replicates 4–6 are for strain JEC20 (MATa). log2 values are shown. For regulated genes to be included, the expression data of levels of transcript in the light versus the dark had to be present in at least four of the six experimental replicates, with a mean change in abundance set as 50 % higher or lower than in the dark. Note, however, the variation between experiments and that the mean value should be viewed accordingly. The seven genes in addition to HEM15 that encode the enzymes for haem biosynthesis are included. Two microarray probes are present on the slides for CNA03960 (predicted to encode glyoxal oxidase). Light exposure values are in h : min.

Northern blot analysis was used to test the validity of the microarray expression data. A subset of downregulated genes was examined, but their transcripts were of low abundance and photoregulation could not be confirmed, so other approaches will be needed to determine whether any of these genes are repressed by light. Through Northern blot analysis, the photoregulation of the two light-induced genes with greatest induction differences, HEM15 and CFT1, was demonstrated (Fig. 1). At least some genes that are light-regulated, such as BWC2 and HMP1, were not within the light-regulated category by microarray, but did exhibit light induction by Northern blot analysis (Fig. 1), providing a caveat that some genes may have been excluded by using the microarray technique and analysis approach. A similar exclusion of genes has occurred in other microarray studies, including the recent report on light-regulated genes in N. crassa in which ccg-1 and fluffy, which are known photoregulated genes, were absent (Chen ). For C. neoformans, BWC2 had been previously shown to be light-regulated in a Bwc1-dependent manner (Idnurm & Heitman, 2005). HMP1 is a homologue of a gene of Ustilago maydis that binds cruciform DNA structures but whose role in U. maydis biology is otherwise unknown (Dutta ). We were interested in this gene because of its potential role either in recombination during mating or in DNA repair. In C. neoformans, the homologue is regulated by multiple environmental conditions (X. Lin and others, unpublished data), as evident by the difference in transcript abundance of replicates 1 and 2 compared with replicate 3 in the Northern analysis (Fig. 1), and the homologue remains of unknown function in the fungus.
Fig. 1.

Light-regulated genes of C. neoformans, as illustrated by Northern blot analysis. Replicates 1–3 correspond to RNA samples with the same numbers in Table 3. Photoinduction of HMP1 in replicate 3 was evident in longer exposures of the membrane to X-ray film.

HEM15 encodes ferrochelatase, an essential, mitochondrial-targeted protein in C. neoformans

The most upregulated gene in response to light, based on the C. neoformans microarrays, was most similar to those in other fungi that encode ferrochelatase. Three experiments provided evidence that the C. neoformans HEM15 gene indeed encodes ferrochelatase. Ferrochelatase is essential in many organisms. We were unable to isolate hem15 deletion mutants in C. neoformans haploid strains through conventional gene replacement experiments using homologous recombination, even when the medium was supplemented with exogenous haematin. This suggested that the C. neoformans gene is also essential. The HEM15 gene was therefore mutated in two diploid strain backgrounds, and the strains were induced to undergo meiosis and sporulate to produce haploid basidiospores. A low germination efficiency was observed for the basidiospores (∼4 %, 5/139), suggesting that there may be a dosage effect in Hem15 function (or instability of the diploid strains leading to aneuploidy). Of the five F1 progeny, none was nourseothricin-resistant, as would be expected for a hem15 : : NAT deletion strain. Therefore, a second copy of the HEM15 gene adjacent to a hygromycin-resistance cassette was introduced into a wild-type strain, producing a strain with two functional copies of the HEM15 gene. The copy at the native locus was successfully targeted for gene disruption, as confirmed by PCR and Southern blot analysis (data not shown). This strain (hem15 : : NAT HEM15-HYG) was crossed to a wild-type strain and the progeny analysed. Again, the spore germination frequency was low (∼9 %, 18/208). Of the 18 progeny examined, none was NatR HygS (hem15 : : NAT), further supporting the hypothesis that HEM15 is essential in C. neoformans. Dissected spores from this cross were then micromanipulated onto YPD medium supplemented with 10 μg haematin ml−1. Of 32 basidiospores plated, five germinated, including two ‘microcolonies’ that exhibited extremely slow growth. No growth was seen when the microcolony strains were grown on YPD without supplemented haematin, and they were nourseothricin-resistant and hygromycin-sensitive, confirming that they were hem15 deletion mutants (Fig. 2).
Fig. 2.

C. neoformans HEM15 is essential and hem15 mutants exhibit an extreme growth defect even in the presence of haem. (a) Tenfold serial dilutions of C. neoformans cells onto YPD medium containing different drugs (hyg, hygromycin; nourseo, nourseothricin) and with or without haematin (10 μg ml−1). The three strains were wild-type, hem15 : : NAT HEM15-HYG and hem15 : : NAT. Plates were incubated for 2 days and photographed. (b) Micrographs of cells from the above plates, at 5 days post-inoculation. Bar, 1 mm. Panel 1 is the edge of a colony produced by the confluent growth of the hem15Δ+HEM15 complemented strain, and panel 2 is the wild-type isolate, both inoculated and grown on nourseothricin media. The remaining six panels (3–8) are the hem15 : : NAT isolate showing non-confluent growth, and the modest rescue of growth by exogenous haematin. (c) Tenfold serial dilutions on YPD+haematin medium, incubated at two temperatures for 2 days (wild-type) or 8 days (hem15Δ). (d) Tenfold serial dilutions on YPD+haematin medium, incubated in darkness or under white light for 2 days (wild-type) or 7 days (hem15Δ).

Growth of the hem15Δ mutant strains in the presence of haematin resulted in barely visible colonies after 2 (Fig. 2a) to 5 days when examined by microscopy (Fig. 2b). In addition, the colonies were brown-red in colour, rather than the usual off-white of wild-type C. neoformans, which can be an indicator of porphyrin accumulation in the cells (Gora et al., 1996). The strains were also unable to grow in the presence of light or at mammalian body temperature, even in media supplemented with haematin (Fig. 2c, d). Haematin or other haem sources such as haemin in media can rescue hem15 deletions in other fungi (e.g. see the S. cerevisiae results below and in Fig. 3), and our findings indicate that C. neoformans can also use haem from the surrounding environment, although at very low efficiency. However, studies on iron utilization show that C. neoformans can efficiently utilize haem as the sole iron source (Jung ). Taken together, these observations suggest that C. neoformans can take up haem from its surrounding environment efficiently, since it can be used as an iron source, although it cannot use exogenous haem as a general substitute for haem generated endogenously.
Fig. 3.

The C. neoformans HEM15 gene complements an S. cerevisiae hem15Δ mutant. Tenfold serial dilutions of wild-type (WT) or hem15Δ mutant strains of S. cerevisiae transformed with a control plasmid or a plasmid expressing C. neoformans HEM15. Cells were plated on YPD, SD medium without uracil (SD−ura), and SD−ura supplemented with haematin (20 μg ml−1).

The C. neoformans HEM15 gene was used to complement an S. cerevisiae hem15 mutant to test the function of the C. neoformans homologue when heterologously expressed. Hem15 has been purified from S. cerevisiae and shown to catalyse the incorporation of either iron or zinc into protoporphyrin IX to form haem (or zinc protoporphyrin), thus establishing its enzymic activity (Camadro & Labbé, 1988; Eldridge & Dailey, 1992; Gora et al., 1996). Deletion of the HEM15 gene results in an inviable phenotype unless the medium is supplemented with exogenous haem (Labbe-Bois, 1990). A hem15Δ strain was generated in the S. cerevisiae BY4742 strain background by replacing the ORF with the KanMX6 cassette. This strain was unable to grow unless haematin was added to the medium (Fig. 3), as seen previously with hem15 mutants in other S. cerevisiae strain backgrounds. The C. neoformans HEM15 cDNA was cloned into a plasmid and expressed in the S. cerevisiae hem15Δ mutant strain. The C. neoformans gene complemented the growth defect in the absence of haem (Fig. 3). Thus, by complementation of the S. cerevisiae hem15Δ mutant, we demonstrated that the C. neoformans HEM15 gene encodes a functional ferrochelatase enzyme. Ferrochelatase is localized to the mitochondrial inner membrane in eukaryotic species. As a third line of evidence for C. neoformans Hem15 function, we examined the subcellular localization of the C. neoformans gene by fusing the HEM15 gene to the N-terminal end of GFP. The resulting HEM15–GFP gene was introduced into wild-type cells, or hem15Δ cells, where it complemented the hem15 phenotype, demonstrating that the fusion allele is functional. The cells were stained with MitoTracker Red, which is a vital dye that results in red fluorescence of mitochondria. In unstained or untransformed wild-type cells, a low-level background fluorescence was observed, and in untransformed strains stained with MitoTracker Red, no green fluorescence was observed (data not shown). When the GFP distribution in transformed cells was compared with that of MitoTracker Red, the two co-localized either to punctate spots or to tubular structures (Fig. 4). Analysis of the predicted Hem15 protein using Psort II software suggests that there is a mitochondrial localization signal at the N terminus, which is consistent with co-localization of this protein with a mitochondrial marker. These observations support the conclusion that the ferrochelatase protein of C. neoformans is also localized to the mitochondria.
Fig. 4.

Subcellular colocalization of the Hem15–GFP fusion protein with the mitochondrial marker MitoTracker Red. Globular and tubular examples of the mitochondria are illustrated. Bar, 10 μm.

bwc1 or bwc2 C. neoformans mutants have normal responses to oxidative and other stresses

Haem is a cofactor for many proteins, including those, such as flavohaemoglobin, required for antioxidant defences. If the Bwc1–Bwc2 complex regulates haem levels, then bwc1 or bwc2 mutants may show an oxidative stress-sensitive phenotype. In addition, light induces the expression of glutathione peroxidase, an enzyme known to be required for protection against oxidative stress in C. neoformans (Missall ). The bwc1 and bwc2 mutant strains have been tested previously on a number of medium types and under different conditions to reveal only a UV-sensitive phenotype (Idnurm & Heitman, 2005). The strains were tested here with growth in the light and dark on YPD medium supplemented with oxidative stress agents or DNA-damaging agents, including nitric oxide (diethylenetriamine NONOate; DETA-NONOate), methyl methanesulfonate, ethidium bromide, t-butyl hydroperoxide and H2O2, titrated over concentration ranges that showed growth inhibition. No altered sensitivity to these molecules was observed for the bwc1 and bwc2 mutant strains.

Conservation of ferrochelatase as a target for light regulation in fungal species

Haem biosynthesis is an ancient biological pathway that branches at protoporphyrin IX by the incorporation of iron into porphyrin to make haem (e.g. in eukaryotes functioning in oxidative respiration in the mitochondria) or magnesium to make chlorophyll (e.g. in eukaryotes functioning in capturing energy from light in the chloroplasts). We hypothesized that ferrochelatase could be light-regulated in other fungi because other eukaryotes such as plants and animals regulate enzymes in porphyrin biosynthesis in response to light. We conducted Northern blot analysis on ferrochelatase expression in the ascomycete N. crassa wild-type and a wc-1 mutant strain, as well as the zygomycete P. blakesleeanus wild-type and a madA madB (wc-1 wc-2) mutant. These species represent two phyla of the fungi that diverged from C. neoformans more than 460 million years ago, based on the fossil record, or earlier based on molecular clock estimates (Taylor & Berbee, 2006). To rule out ferrochelatase upregulation being a consequence of an indirect effect, e.g. degradation of haem or porphyrin intermediates by light, two non-photosensing fungi, S. cerevisiae and Candida albicans, were also included in the study. Strains were grown overnight or for 2 days (depending on growth rate) in complete darkness on YPD medium with 1 h of light exposure for one set of cultures, employing a regime similar to that used for the C. neoformans treatment for microarray experiments. Total RNA was purified, resolved on agarose gels, blotted to membranes, and probed with radiolabelled fragments of the ferrochelatase gene amplified from each species (Fig. 5a). The blots were stripped, and reprobed with the actin gene from each species as a control for RNA loading and transfer. For wild-type strains of C. neoformans, N. crassa and P. blakesleeanus, ferrochelatase transcript levels were higher after 1 h light exposure when compared with those of the strains grown in the dark. This transcript induction was not observed in the control species S. cerevisiae and Candida albicans, which have lost the white collar genes from their genomes during evolution. Strikingly, the upregulation of ferrochelatase was not observed in the white collar mutant strains of C. neoformans, N. crassa or P. blakesleeanus. This demonstrates that the regulation of ferrochelatase in the light-sensing fungi tested depends upon the function of this conserved photoreceptor complex.
Fig. 5.

Ferrochelatase HEM15 transcript levels are light-regulated in a white collar-dependent fashion in fungi. Northern blot analysis of ferrochelatase gene homologues in different fungal species and strains grown in constant darkness or exposed to light for 1 h. The actin genes serve as RNA loading and transfer controls. (a) Wild-type or white collar 1 mutant (or wc-1 wc-2 madA madB double mutant for P. blakesleeanus) strains of three species, compared with two non-photosensing ascomycete yeasts. (b) Induction of the HEM15 homologue in wild-type R. oryzae exposed to 1 h light of different wavelengths.

Ferrochelatase has the potential to serve as a marker for photoinduction in fungi, especially in species in which no photobiology has yet been reported. As proof of principle, we investigated light regulation of ferrochelatase in R. oryzae, a Mucormycotina species closely related to Mucor and Phycomyces. In the genome of this species there are three copies of wc-1, as in the other two Mucormycotina genera, suggesting functional photobiology (Ma ; Sanz ). However, as far as we are aware, there is no report of light sensing in this species, and we were unable to identify a clear phenotypic change in response to light for the isolate in which the genome was sequenced. We therefore treated this strain under the dark or dark–light regime described above, as well as under blue, green and red illumination. The ferrochelatase transcript levels in R. oryzae were higher in the light than in the dark, and were induced by blue wavelengths and to a lesser extent by green wavelengths (Fig. 5b), demonstrating the ability of this species to sense light at wavelengths consistent with one or more of the wc-1 homologues being functional.

DISCUSSION

Light and darkness are environmental cues commonly encountered by organisms. In the fungi, blue-light responses are controlled by the conserved WC-1 and WC-2 proteins. In previous studies of the pathogenic basidiomycete fungus C. neoformans it was observed that light inhibits mating (Shen ). Two genes, BWC1 and BWC2, regulate the inhibition of mating by light, and they also regulate virulence and sensitivity to UV irradiation (Idnurm & Heitman, 2005; Lu ). A homologue of BWC1 in the basidiomycete species Coprinopsis cinerea is also required to mediate light sensing (Terashima ), while other basidiomycetes encode copies of BWC1 and BWC2 in their genomes (Sano ). Bwc1 and Bwc2 are the homologues of N. crassa WC-1 and WC-2, and thus are predicted to encode a transcription factor complex that binds to the promoters of light-regulated genes to induce their transcription. The downstream targets of Bwc1–Bwc2 in the light signal transduction pathway are unknown, but are of interest because of their possible roles in regulating the production of sexual spores and in virulence. One approach to the identification of these targets has been to perform forward genetic screens to identify genes mutated in strains that have altered responses to light (Yeh ). This study identified the SSN8 gene, which encodes a general transcriptional regulatory protein. Because the WC-1 and -2 protein complex is predicted to be a transcriptional regulator, assessing transcript abundance under light and dark conditions should also be able to provide clues about downstream targets of Bwc1–Bwc2 in the light signal transduction process. Microarray expression analysis detected few light-regulated genes in C. neoformans. This was a surprising result based on regulatory changes in response to light in other fungi, such as Trichoderma species, N. crassa and P. blakesleeanus, in which light causes large-magnitude changes in the expression of light-regulated genes (Chen ; Li & Schmidhauser, 1995; Rodríguez-Romero & Corrochano, 2004; Rosales-Saavedra ). This appears to be specific to C. neoformans rather than an effect of the light treatment, because a comparison with the transcript abundances in other species cultured under identical conditions showed large differences between light and dark (see Fig. 5). Genome-wide expression analyses in other fungi indicate that many genes are light-regulated, from 300–700 genes in N. crassa (Chen ; Dong ) to a 2.8 % estimate for Trichoderma atroviride (Rosales-Saavedra ). It is feasible that alternative microarray approaches would result in the detection of additional photoregulated genes, e.g. using strains overexpressing Bwc1 or Bwc2, higher light intensities, the use of blue wavelengths, growth on different media, or at different developmental stages such as during dikaryotic filament formation. The genes identified in the microarray analysis mostly encode hypothetical or uncharacterized proteins. Genes that have been characterized include CFT1, which is involved in iron uptake and is required for virulence in C. neoformans (Jung ), and GPX1, which encodes a glutathione peroxidase that is required for protection against certain oxidative stresses, but not for virulence (Missall ). The most interesting gene to emerge from this analysis was HEM15, which by blast comparisons is homologous to genes encoding ferrochelatase (EC 4.99.1.1). This was the primary light-induced gene (Table 3), and warranted further study because ferrochelatase mutations cause photosensitivity in all organisms in which mutants have been examined. These organisms include the bacterium Escherichia coli, in which ferrochelatase mutants also become light-sensitive and negatively phototactic (Miyamoto ; Yang ), and the non-photosensing fungus S. cerevisiae (Abbas & Labbe-Bois, 1993; Zoladek ). Mutation of ferrochelatase is one basis of porphyria, a class of genetic disorders in humans, in which ferrochelatase impairment leads to severe sensitivity to sunlight and subsequent skin damage if exposed (Cox, 1997; Kauppinen, 2005). The basis behind the increase in photosensitity in all organisms is the accumulation of porphyrin intermediates that are highly phototoxic. Of further interest, haem is a cofactor for many proteins, including some implicated in antioxidant defence during infection, such as flavohaemoglobin of C. neoformans (de Jesús-Berríos ). Native biosynthesis or utilization of host haem is required for many bacterial pathogens to cause disease (reviewed by Wilks & Burkhard, 2007). The production of haem requires at least seven dedicated enzymes in addition to ferrochelatase. One question is whether or not these other enzymes are coordinately regulated. The genes encoding the other seven enzymes in the haem biosynthesis pathway are not light-regulated at the transcript level in C. neoformans, based on the microarray data (Table 3). To confirm this observation by an alternative technique, transcripts of three genes (HEM1, HEM12 and HEM14) were tested for light regulation by Northern blot analysis: none of these three genes was light-regulated (data not shown). This finding suggests that upregulation of ferrochelatase activity should be sufficient to reduce porphyrin levels in the cell, rather than a co-regulatory induction by light of every component in the pathway. Upregulation of the CFT1 transcript levels by light may function to provide more of the iron permease to import exogenous iron to be incorporated into protoporphyrin IX to produce haem. The FET3 iron oxidase homologue (CFO1) is adjacent to CFT1 in the C. neoformans genome with shared promoter regions (Jung ). CFO1 transcript abundance may be also slightly upregulated by light, as measured by microarray analysis (Table 3). The co-regulation of HEM15 and CFT1 but not other genes for haem biosynthesis supports a hypothesis in which haem levels increase in response to light, while the porphyrin precursor levels decrease. Thus, we hypothesize that light induction of these genes controlled by Bwc1 and Bwc2 would be consistent with the increased UV sensitivity and reduced virulence observed in strains bearing a mutation in either the BWC1 or the BWC2 gene. Nevertheless, the observation that the hem15 deletion strain shows such poor growth in culture requires further analysis to support this hypothesis. In other organisms, mutation of ferrochelatase leads to haem auxotrophy, which can be rescued by addition of haem to the medium (e.g. see S. cerevisiae, Fig. 3). For C. neoformans, additional haem only partially rescues the defect of deletion of HEM15. It may be that this fungus, which produces a polysaccharide capsule, has difficulties in taking up haem or in relocalization of haem within the cell after uptake. Despite the goal of revealing the underlying links between light sensing and virulence and discovering that haem biosynthesis is light-regulated, it is still not clear how Hem15 functions to control the phenotypes observed after mutation of the bwc1 or bwc2 genes. A hypothesis is that haem biosynthesis is impaired in the bwc1 or bwc2 mutants, and this influences virulence. It may be that either normal levels of haem are required for pathogenesis or the strains are less fit due to changes in regulation, since HEM15 is essential. Haem biosynthesis is required for virulence in both plant and animal pathogenic fungi (Kirsch & Whitney, 1991; Solomon ). The hemH gene encoding ferrochelatase of the α-proteobacterium Brucella abortus is required for virulence (Almirón ). Curiously, a LOV domain histidine kinase in the same organism is also required for light sensing and virulence (Swartz ), and it is worth speculating that these two observations may be linked in B. abortus, which would expand the overlapping roles of light sensing and haem biosynthesis into pathogenic bacteria. Fig. 6 is a working model of how light and ferrochelatase function may regulate sensitivity to light in C. neoformans, and presumably haem levels in cells prior to inoculation into mice, which could influence the virulence outcome, although this model needs to be addressed further experimentally. A challenge in demonstrating function through the manipulation of HEM15 is that the gene is essential, so may require careful regulation to reveal a phenotype. Future studies could focus on haem biology in C. neoformans and the proteins that use haem as a cofactor.
Fig. 6.

Model of light-regulated changes in C. neoformans affecting the physiology of the fungus. In the dark, porphyrin levels are high (represented by dots) and transcription of HEM15 and CFT1 is at a basal level. Exposure to light triggers a conformational change in Bwc1–Bwc2 (1 and 2), leading to induction of CFT1 and HEM15 expression to produce proteins located on the plasma membrane (Cft1) or mitochondrial membrane (Hem15). Porphyrins are converted to haem by ferrochelatase. In the absence of Bwc1 or Bwc2, no increase in Cft1 or Hem15 occurs, and exposure of the porphyrins to light results in photooxidative damage.

HEM15 is light-regulated across the fungal kingdom (Fig. 5). It will be of interest to see how many of the diverse and as yet unaccounted for photobiological effects in fungi (Tisch & Schmoll, 2010) are mediated by haem availability. Haem biosynthesis is regulated by the circadian clock in plants and mammals (Kaasik & Lee, 2004; Papenbrock ), and we predict that in fungi haem levels will also be regulated by the circadian clock. N. crassa represents the best fungal system to study the circadian clock (see recent review by Heintzen & Liu, 2007). Ferrochelatase has not been reported to be regulated by light or the clock, although microarrays have been performed on this species to examine light- and/or clock-regulated transcripts. It is possible that in the early microarrays the gene was absent, since the microarray did not cover the entire gene set (Lewis ; Nowrousian ). In two recent whole-genome studies, ferrochelatase is not discussed in the main text as a light- or clock-regulated gene. Nevertheless, the N. crassa ferrochelatase homologue NCU08291.2 is included amongst the original data as a gene induced by light and under the control of the circadian clock (Chen ; Dong ), providing confirmation of our Northern blot data and supporting our hypothesis. Two other genes that are light-regulated in both C. neoformans and N. crassa based on microarray studies encode glutathione peroxidase and the Hmp1 cruciform DNA-binding protein. An example of one research area to re-explore is the function of nitrate reductase in N. crassa circadian rhythms (Christensen ). Nitrate reductase is a haem-containing enzyme, and one can propose a system of haem availability controlled by WCC regulating the activity of the enzyme, providing interconnected clocks. The major phyla of the fungal kingdom are estimated to have diverged at least 460 million years ago, based on fossil evidence, and perhaps as long as a billion years ago (Taylor & Berbee, 2006). Our finding that ferrochelatase is regulated by the White collar system of transcription factors is a unique example of conserved regulatory function across the kingdom, and is in contrast to what is emerging from functional genomic studies on signal transduction, where the trend is for conserved transduction pathways but divergent input and output proteins or targets (Bahn ). Why has ferrochelatase been light-regulated by the same transcription factor complex for so long? As outlined in a working model (Fig. 6), light induction of ferrochelatase should reduce the levels of highly photoactive porphyin molecules in a cell. We have previously advanced the hypothesis that the White collar proteins are under selective pressure for protection against UV irradiation (Idnurm & Heitman, 2005). We hypothesize, based on the transcript profile here, as well as the other phenotypes commonly associated with photosensing in fungi, which include upregulation of pigmentation and the DNA repair enzyme photolyase, that the original purpose of light sensing in fungi was in protection against damage caused by light and that this is responsible for its continued presence. In addition to induction of other protective properties such as pigmentation or photolyase, which are not present in all fungi, the photoregulation of ferrochelatase by the Wc1Wc2 complex provides another, and ancient, means to reduce light-mediated damage.
  20 in total

Review 1.  A glimpse into the basis of vision in the kingdom Mycota.

Authors:  Alexander Idnurm; Surbhi Verma; Luis M Corrochano
Journal:  Fungal Genet Biol       Date:  2010-05-06       Impact factor: 3.495

2.  Calcineurin colocalizes with P-bodies and stress granules during thermal stress in Cryptococcus neoformans.

Authors:  Lukasz Kozubowski; Eanas F Aboobakar; Maria E Cardenas; Joseph Heitman
Journal:  Eukaryot Cell       Date:  2011-07-01

3.  The contribution of the White Collar complex to Cryptococcus neoformans virulence is independent of its light-sensing capabilities.

Authors:  Pinkuan Zhu; Alexander Idnurm
Journal:  Fungal Genet Biol       Date:  2018-09-25       Impact factor: 3.495

4.  Regulation of conidiation by light in Aspergillus nidulans.

Authors:  Carmen Ruger-Herreros; Julio Rodríguez-Romero; Raul Fernández-Barranco; María Olmedo; Reinhard Fischer; Luis M Corrochano; David Canovas
Journal:  Genetics       Date:  2011-05-30       Impact factor: 4.562

Review 5.  Cryptococcus neoformans and Cryptococcus gattii, the etiologic agents of cryptococcosis.

Authors:  Kyung J Kwon-Chung; James A Fraser; Tamara L Doering; Zhou Wang; Guilhem Janbon; Alexander Idnurm; Yong-Sun Bahn
Journal:  Cold Spring Harb Perspect Med       Date:  2014-07-01       Impact factor: 6.915

Review 6.  Light-regulated promoters for tunable, temporal, and affordable control of fungal gene expression.

Authors:  Kevin K Fuller; Jay C Dunlap; Jennifer J Loros
Journal:  Appl Microbiol Biotechnol       Date:  2018-03-22       Impact factor: 4.813

Review 7.  Fungal photobiology: visible light as a signal for stress, space and time.

Authors:  Kevin K Fuller; Jennifer J Loros; Jay C Dunlap
Journal:  Curr Genet       Date:  2014-10-17       Impact factor: 3.886

8.  Strain-related differences in antibody-mediated changes in gene expression are associated with differences in capsule and location of binding.

Authors:  Erin E McClelland; Arturo Casadevall
Journal:  Fungal Genet Biol       Date:  2012-02-01       Impact factor: 3.495

9.  Congenic strains for genetic analysis of virulence traits in Cryptococcus gattii.

Authors:  Pinkuan Zhu; Bing Zhai; Xiaorong Lin; Alexander Idnurm
Journal:  Infect Immun       Date:  2013-05-13       Impact factor: 3.441

Review 10.  Virulence-Associated Enzymes of Cryptococcus neoformans.

Authors:  Fausto Almeida; Julie M Wolf; Arturo Casadevall
Journal:  Eukaryot Cell       Date:  2015-10-09
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.