Literature DB >> 20426872

Heterogeneous detection of circulating tumor cells in patients with colorectal cancer by immunomagnetic enrichment using different EpCAM-specific antibodies.

Dalibor Antolovic1, Luis Galindo, Anina Carstens, Nuh Rahbari, Markus W Büchler, Jürgen Weitz, Moritz Koch.   

Abstract

BACKGROUND: Circulating tumor cells (CTC) and disseminated tumor cells (DTC) are thought to be responsible for metastasis, so the detection of CTC may serve as individual prognostic factor in patients suffering from colorectal cancer. Therefore, a series of immunomagnetic enrichment methods for CTC have been developed using a variety of monoclonal antibodies against the Epithelial Cell Adhesion Molecule (EpCAM). However, it remains unclear whether all commercially available EpCAM antibodies show the same sensitivity and specificity. Furthermore, it remains unclear which method of sample preparation and cell extraction is most suitable for immunomagnetic enrichment and detection of CTC. In this study, we aimed to investigate whether the detection of CTC by a cytokeratin 20 reverse transcriptase-polymerase chain reaction (CK20 RT-PCR) may be influenced by the use of various Epithelial Cell Adhesion Molecule (EpCAM) antibodies for immunomagnetic isolation of CTC.
RESULTS: Using both EpCAM antibodies (mAb BerEP4 and mAb KS1/4) for immunomagnetic enrichment in blood samples of 39 patients with colorectal cancer we found heterogenous results in each patient with regard to tumor cell detection. In the tumor cell spiking experiments with whole blood samples the sensitivity of the CK 20 RT-PCR assay was higher using immunomagnetic beads coated with mAb KS1/4 compared to precoated mAb BerEP4 Dynabeads. Extraction of MNC fraction with Ficoll gradient centrifugation prior to immunomagnetic enrichment resulted in a higher sensitivity of the CK 20 RT-PCR assay.
CONCLUSIONS: We concluded that isolation and detection of CTC with immunomagnetic enrichment methods is critically dependent on the used EpCAM clone. Further studies with a larger number of patients should clarify if the enrichment protocol influences the prognostic value of the tumor cell detection protocol.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20426872      PMCID: PMC2868015          DOI: 10.1186/1472-6750-10-35

Source DB:  PubMed          Journal:  BMC Biotechnol        ISSN: 1472-6750            Impact factor:   2.563


Background

Detection of circulating tumor cells (CTC) in blood and disseminated tumor cells (DTC) in the bone marrow and/or lymph nodes, which are thought to be responsible for metastases, may allow a better prediction of the individual prognosis of patients with colorectal cancer [1-3]. Recent studies of our group indicated that the molecular detection of CTC and DTC in patients with colorectal cancer (CRC) may be of prognostic value [4-7]. Furthermore, immunomagnetic enrichment strategies have been developed to improve the detection and yield of CTC and DTC [8]. A large number of monoclonal antibodies (mAb) against the Epithelial Cell Adhesion Molecule (EpCAM) which is expressed only in epithelium and malignant tumors derived from epithelia have been increasingly used to enrich and isolate CTC from blood and DTC from bone marrow samples [9,10]. However, there are no data available comparing antibodies against various EpCAM epitopes for immunomagnetic isolation of CTC with regard to their sensitivity and specificity. Therefore, it remains unclear if all anti-EpCAM antibodies are able to detect and to capture the same range of CTC and if they have the same clinical and prognostic impact. Furthermore, it is still unknown which method of sample preparation and cell extraction is most suitable for immunomagnetic enrichment and detection of CTC. In this study, we aimed to compare two different specific antibodies against the epitope in the EGF-like domain I of EpCAM for immunomagnetic enrichment and subsequent detection of CTC in CRC patients. We used commercially available immunomagnetic beads coated with mAb BerEP4 [11] and magnetic beads coated with mAb KS1/4 [12]. Both monoclonal antibodies recognize specific epitopes of the extracellular domain of the EpCAM molecule. mAb BerEP4 recognizes two (34 kDa and 39 kDa) specific antigens, whereas mAb KS1/4 recognizes one (40 - 42 kDa) specific antigen of the extracellular domain of the EpCAM molecule [10]. Furthermore, we examined the effect of two different cell extraction protocols on subsequent immunomagnetic enrichment and detection of tumor cells in the blood.

Results

Specificity of the enrichment and extraction protocols

Both whole blood and MNC fractions of five healthy donors were tested regarding the specificity of cell extraction and enrichment protocols with immunomagnetic beads coated with BerEP4 and KS1/4. No CK20 signal was observed in all examined blood samples of healthy donors, demonstrating the specificity of the used assays.

Sensitivity of the enrichment and extraction protocols

Whole Blood

In the tumor cell spiking experiments with whole blood samples the sensitivity of the CK20 RT-PCR assay was higher using immunomagnetic beads coated with mAb KS1/4 compared to precoated mAb BerEP4 Dynabeads. In serial dilution assays, a minimum number of 104 HT29 cells could be detected in 5 ml whole blood using the BerEP4 mAb whereas 103 HT29 cells could be detected in the same volume using the KS1/4 mAb.

Mononuclear cell fraction

Extraction of MNC fraction with Ficoll gradient centrifugation prior to immunomagnetic enrichment of blood samples spiked with HT29 cells resulted in a higher sensitivity of the CK20 RT-PCR assay. 103 HT29 cells spiked in 5 ml blood (200 cells/ml) could be detected after isolation of the MNC fraction using the mAb BerEP4 Dynabeads, whereas 102 HT29 cells spiked in 5 ml blood (20 cells/ml) were detected using the mAb KS1/4 coated beads. Blood spiking experiments were repeated several times to confirm the above mentioned results. The observed higher sensitivity of tumor cell detection after isolation of the MNC fraction prior to immunomagnetic CTC enrichment prompted us to generally use Ficoll gradient centrifugation before further immunomagnetic enrichment and detection of CTC in the blood of CRC patients.

Detection of tumor cells in blood samples of CRC patients

Median age of included CRC patients was 63 years (range 27 - 90) with 16 females and 23 males. Eighteen of 39 (46%) patients presented with metastatic disease to the liver and were classified as UICC stage IV; 7 patients were UICC stage III, and 7 patients stage UICC II and I. Clinical data of the patients are shown in Table 1.
Table 1

Clinical data of our patient cohort with colorectal cancer.

Pat. No.AgeGenderTumor LocationTNMUICCMultimodal Therapy before SurgeryTherapy
167FMetachronous liver metastasis from Colon CancerTx Nx M1IVadjuvantLiver resection
281MRectumT3 N2 M0IIInoAnterior Rectal Resection
363FRectumT1 N0 M0InoAnterior Rectal Resection
465MRectumT3 N0 M0IIneoadjuvantAnterior Rectal Resection
571MColon, rightT2 N0 M0InoColectomy, right
660MSynchronous liver metastasis from Rectal CancerT2 N0 M1IVnoAnterior Rectal Resection
745FColon, leftT4 N1 M0IIInoColectomy, left
868FColon, rightT1 N0 M0InoColectomy, right
968MMetachronous liver metastasis from Rectal CancerTx Nx M1IVneoadjuvantLiver resection
1078FLocal Relapse of Rectal CancerT4 N0 M0IIadjuvantAbdominoperineal Rectal Resection and IORT*
1162MRectumT3 N0 M0IInoAnterior Rectal Resection
1253MMetachronous liver metastasis from Colon cancerTx Nx M1IVadjuvantHemihepatectomy, right
1364MSynchronous liver and lung metastasis from Colon CancerT4 N2 M1IVnopalliative Colectomy, right
1445MLocal Relapse of Rectal CancerT3 N0 M0IIadjuvantAnterior Rectal Resection and IORT*
1574FColon, leftT1 N0 M0InoColectomy, left
1652MColon, leftT1 N0 M0InoColectomy, left
1778MColon, rightT3 N1 M0IIInoColectomy, right
1872FColon, rightT1 N0 M0InoColectomy, right
1954FColon, leftT4 N0 M0IInoAnterior Rectal Resection and IORT*
2054FMetachronous liver metastasis from Colon CancerTx Nx M1IVadjuvantHemihepatectomy, right
2164FMetachronous liver metastasis from Rectal CancerTx Nx M1IVnopalliative loop-Ileostomy
2244MSynchronous liver metastasis from Colon CancerT3 N2 M1IVnoAnterior Rectal Resection
2373MMetachronous liver metastasis from Rectal CancerTx Nx M1IVnopalliative loop-Ileostoma
2463MMetachronous liver metastasis from Colon CancerT3 N0 M1IVadjuvantRectosigmoid Resection
2527MColon, rightT4 N2 M0IIInoColectomy, right
2668FColon, rightT3 N1 M0IIInoColectomy, right
2747MRectumT3 N1 M0IIIneoadjuvantAnterior Rectal Resection and IORT*
2868MSynchronous liver and bone metastasis from Colon CancerTx Nx M1IVnopalliative Bypass Ileotransversostomy
2976MMetachronous liver metastasis from Colon CancerTx Nx M1IVadjuvantLiver resection
3062MMetachronous liver metastasis from Colon CancerTx Nx M1IVadjuvantExploration, Biopsy
3162MRectumT1 N0 M0InoAnterior Rectal Resection
3278FMetachronous liver metastasis from Rectal CancerTx Nx M1IVnoSegment 2 and 3 Liver resection
3380MColon, leftT4 N0 M0IInoAnterior Rectal Resection
3486FRectumT3 N0 M0IInoAnterior Rectal Resection
3544FLocal Relapse Colon Cancer, PeritonealcarcinosisT4 N2 M1IVadjuvantLaparotomy and Biopsy
3690FColon, leftT4 N1 M0IIInoColectomy, left
3755MMetachronous liver metastasis from Rectal CancerTx Nx M1IVadjuvantHemihepatectomy, right
3856MSynchronous liver metastasis from Colon CancerT4 N1 M1IVadjuvantHemihepatectomy, left
3963FMetachronous liver metastasis from Rectal CancerTx Nx M1IVadjuvantHemihepatectomy, right

*Abbreviations: IORT: intraoperative radiotherapy; F: female; M: male; Pat. No.: Patients number.

Clinical data of our patient cohort with colorectal cancer. *Abbreviations: IORT: intraoperative radiotherapy; F: female; M: male; Pat. No.: Patients number. Using two different antibodies (mAb BerEP4 and mAb KS1/4) for immunomagnetic enrichment, CTC were detected in 11 of 39 (28%) patients with CRC. Among these, immunomagnetic enrichment with mAb BerEP4 beads accounted for 6 CK20 positive patients. Immunomagnetic enrichment using mAb KS1/4 beads showed 5 CK20 positive patients. Interestingly, there were no blood samples being CK 20 positive for both used antibodies (Table 2 and Figure 1).
Table 2

Characteristics of the CK20 positive patients and comparison of the two different antibodies used for immunomagnetic enrichment

Pat. No.DiagnosisTNMUICC-StageBerEP4-BeadsKS 1/4-Beads
2Rectal CancerT3 N2 M0IIIpositivenegative
5Left Colon CancerT2 N0 M0Inegativepositive
9Metachronous liver metastasis from Rectal CancerTx Nx M1IVpositivenegative
17Right Colon CancerT3 N1 M0IIIpositivenegative
22Synchronous liver metastasis from Colon CancerT3 N2 M1IVnegativepositive
23Metachronous liver metastasis from Rectal CancerTx Nx M1IVnegativepositive
25Right Colon CancerT4 N2 M0IIIpositivenegative
28Synchronous liver and bone metastasis from Colon CancerTx Nx M1IVpositivenegative
31Rectal cancerT1 N0 M0Inegativepositive
32Metachronous liver metastasis from Rectal CancerTx Nx M1IVpositivenegative
37Metachronous liver metastasis from Rectal CancerTx Nx M1IVnegativepositive
Figure 1

Cytokeratin 20 RT-PCR amplification products after immunomagnetic enrichment with both Ep-CAM antibodies from blood samples of two CRC patients. W, water negative control; Pos positive control (HT29 cells); Neg, negative control (blood of healthy person); L, ladder (molecular weight marker). Lanes A1-A2, patient ID 22 and Lanes B1-2, patient ID 23. A2 and B2 show CK20 products after CTC enrichment with KS1/4 beads whereas BerEP4 beads failed to detect CTC in the same patients (A1 and B1).

Cytokeratin 20 RT-PCR amplification products after immunomagnetic enrichment with both Ep-CAM antibodies from blood samples of two CRC patients. W, water negative control; Pos positive control (HT29 cells); Neg, negative control (blood of healthy person); L, ladder (molecular weight marker). Lanes A1-A2, patient ID 22 and Lanes B1-2, patient ID 23. A2 and B2 show CK20 products after CTC enrichment with KS1/4 beads whereas BerEP4 beads failed to detect CTC in the same patients (A1 and B1). Characteristics of the CK20 positive patients and comparison of the two different antibodies used for immunomagnetic enrichment CK20 PCR transcripts were detected in 3 of 18 (17%) blood samples from UICC stage IV patients after immunomagnetic enrichment with mAb KS1/4 coated beads. When mAb BerEP4 beads were used, we also observed positive CK20 products in 3 of 18 (17%) UICC stage IV patients. Among the 7 patients with UICC stage III, 3 patients showed CK20 positive samples after enrichment of CTC with BerEP4 beads only. Positive CK20 signals were observed in 2 of 7 patients with UICC stage I after enrichment with KS1/4 coated beads only (see Table 3). Furthermore, among 7 patients with UICC stage II no samples were found positive for CK20 using either BerEP4 or KS1/4 coated beads.
Table 3

Comparison of tumor cell detection with UICC stage of CRC patients after enrichment with mAb BerEP4 and KS14 coated beads.

UICC-StageNO. OF PATIENTSPOSITIVE CK20 SAMPLES
BerEP4KS1/4
I702
II700
III730
IV1833
Comparison of tumor cell detection with UICC stage of CRC patients after enrichment with mAb BerEP4 and KS14 coated beads.

Discussion

The first phase of the metastatic process of malignant epithelial tumors consists of local tumor cell migration, followed by tumor cell dissemination in the blood, invasion and homing to secondary distant organs [13,14]. Despite recent developments of various therapeutic approaches, distant metastases represent the major cause of death in patients with colorectal cancer [14]. Theoretically, postoperative metastatic recurrence should develop from isolated tumor cells or micrometastases already existing at time of surgery or they can derive from tumor cells that are hematogenously shed into circulation during surgical procedures. Thus, a reliable detection method for CTC in a small volume of peripheral blood might be of high interest to improve staging and to more accurately predict patients' individual prognosis. To increase the specificity of tumor cell detection, immunomagnetic beads labeled with an epithelium-specific monoclonal antibody (mAb) haven been used to isolate CTC from blood [15]. To our knowledge, this is the first study reporting the use of mAb KS1/4 coated beads to isolate CTC from CRC patients. The sensitivity of the KS1/4 coated bead system was evaluated by HT29 tumor cell dilution experiments and reproducibly allowed the detection of about 102 HT29 cells spiked in 5 ml blood. In our reference experiments, mAb KS1/4 retrieved 10 fold more tumor cells than the commonly used mAb BerEP4 precoated beads (103 cells in 5 ml blood) after MNC gradient enrichment. Our study also confirmed the study from Guo et al. which showed better results for MNC population extraction prior to immunomagnetic isolation of tumor cells than the immunomagnetic isolation of circulating tumor cells from whole blood [16]. Guo et al. combined immunomagnetic isolation followed by real-time RT-PCR to detect CTC in patients with colorectal cancer. This study showed that combining negative (CD45 depletion) and positive (CTC enrichment with BerEP4 beads) immunomagnetic selection successively yields a high amount of CTC (1 CTC/1 ml blood). As they used CEA as marker gene in their analyses, the authors did not assess the cytokeratin expression of the CTC, which is in our opinion the most widely used marker for CTC [16]. Moreover, negative enrichment with CD45 depletion of leucocytes may lead to a theoretical "loss" of CTC as they could stick together with the leucocytes-beads complexes. Denis et al. demonstrated CTC in whole blood samples in 4 of 5 patients with metastatic CRC using mAb BerEP coated magnetic beads and subsequent analysis with RT-PCR assays for CK8, CK19 and CK20 gene expression [15]. However, the previously described epithelial and tumor markers can also be expressed in normal peripheral blood leukocytes normally present in whole blood which may lead to false positive results [16-21]. Using spiking experiments with healthy donor blood Vlems et al. demonstrated that differences in sample handling and assay sensitivity influence CK20 detection in blood [22]. In the present study, isolation of CTC from CRC patients was only performed in the MNC population after Ficoll-gradient enrichment. In addition, Ficoll-gradients purge the MNC fraction from granulocytes, which constitutively express CK20 mRNA [19]. This is in accordance with our results as our nested RT-PCR retrieved consistently negative CK20 results in blood samples from healthy donors. Automated systems for immunomagnetic CTC isolation and subsequent immunocytochemical detection are nowadays available and usually rely on the principle of EpCAM based enrichment methods. Using the Cell Search system (Veridex) Cohen et al. demonstrated the prognostic value of CTC enumeration in the peripheral blood of metastatic CRC patients [23]. Future studies are needed to examine and compare the detection rates and prognostic differences between PCR based and immunocytochemical tumor cell detection methods after immunomagnetic enrichment of CTC. BerEP4 and KS1/4 are high affinity and specific mAb frequently used to detect EpCAM positive cells. Interestingly, we noted that CK20 RT-PCR products were commonly not found in both samples when analyzing blood of the same patient after enrichment with either mAb BerEP4 or mAb KS/4. Other authors have already described heterogeneity in reactivity of EpCAM specific antibodies. Balzar et al. suggested that different conformational states of the cell surface EpCAM protein might hide some epitopes leading to subpopulations of EpCAM and thus heterogeneous affinity [10]. Successful CTC enrichment depends on the level of EpCAM expression in the target cell [24]. Furthermore, downregulation of cytokeratins in tumor derived cell lines and cytokeratin negative CTC have also been reported in patients with breast cancer [25,26]. These findings might hinder the adequate detection of CTC. Promising results for the detection of CK20 positive CTC in colorectal cancer patients were shown by Wong et al [27] by blocking the Fc region of the anti-BerEP4 antibody with a goat anti-mouse antibody during immunomagnetic enrichment. Using this refined immunomagnetic enrichment method Wong et al. could demonstrate a specific detection of colorectal CTC in vitro and they confirmed the clinical significance of their results in large series of colorectal cancer patients [27]. The dissimilar capture of CTC by BerEP4 and KS1/4 mAbs in our analysis might be explained by various expression of the EpCAM molecule among the examined patients. Nevertheless, our KS1/4 system was able to retrieve 10 fold more CTC compared to the BerEP4 system. The use of different EpCAM clones might enhance the detection rate of CTC. Additional investigations to assess the variations of EpCAM molecule expression among different patients will be of critical importance to identify a panel of suitable mAbs which could be used for efficient and reliable CTC isolation. Our results also demonstrate that Ficoll-gradient isolation is a decisive step prior to the immunomagnetic enrichment of CTC from peripheral blood.

Conclusions

Our study for the first time shows that isolation and detection of CTC with immunomagnetic enrichment methods is critically dependent on the used EpCAM clone. Further analysis regarding the clinical importance of heterogenous expression of the EpCAM molecule in CTC of CRC patients is urgently needed.

Methods

Blood samples from healthy donors and patients

For blood spiking experiments and for testing the specificity of the various extraction and enrichment protocols peripheral blood samples were drawn from the antecubital vein of 5 healthy donors and collected in EDTA-coated tubes (S-Monovette®, Sarstedt, Germany). To avoid epithelial cell contamination from skin puncture, the first 5 ml of peripheral blood were discarded. After collection, blood samples were immediately processed for further experiments. Five ml blood samples were obtained after induction of general anesthesia (and before start of the operation) through a central venous line from 38 CRC patients (UICC stage I-IV) undergoing surgical therapy at the Department of Surgery, University of Heidelberg, Germany. Patients with histopathologically confirmed CRC were staged according to the classification of the UICC (6th edition) [28]. The study protocol was approved by the ethics committee of the University of Heidelberg. Informed consent for blood sampling was obtained from each patient.

Cell spiking experiments

For cell spiking experiments and the examination of different cell extraction methods, EpCAM and CK20 positive cells from the human colon cancer cell line HT29 were serially diluted in 5 ml blood samples taken from five different healthy donors. Dilutions performed were: 106, 105, 104, 103, 102, 10 and 0 HT29 cells per 5 ml whole blood.

HT29 cells

The human colon cancer cell line HT29 expressing EpCAM and Cytokeratin 20 (CK20) was purchased from American Type Cell Culture (Austria Branch). Cells were cultured in RPMI-1640 Medium with L-glutamine and HEPES (PAA Laboratories GmbH, Austria) supplemented with 100 U/ml penicillin, 100 μg/ml streptomycin (PAA Laboratories GmbH, Austria), and 10% fetal bovine serum (Biochrom AG, Germany) in plastic flasks at 37°C in a 5%CO2 atmosphere. Collection of cells was performed with help of Trypsin-EDTA (PAA Laboratories GmbH, Austria) and centrifugation at room temperature for 3 minutes at 300 g. Cells were then counted with a hemacytometer and viability was confirmed by Trypan blue stain.

Mononuclear cell collection

The mononuclear cell (MNC) population was extracted according to the following protocol: 5 ml peripheral blood samples were carefully layered over a 15 ml Ficoll gradient (FicoLite-H®, Linaris, Germany density 1.077) and covered with 10 ml phosphate buffered saline solution (PBS; PAA Laboratories GmbH, Austria). The samples were spun in a centrifuge at 4°C for 30 minutes at 300 g without brake. Concentrated MNCs were harvested from the interface with the help of a disposable pipette. The isolated cells were washed once in PBS, spun in a centrifuge for 10 minutes at 300 g and resuspended in 1 ml PBS. The MNCs were counted with a hemacytometer and then resuspended at 107 cells/ml in PBS.

Immunomagnetic enrichment and cell extraction protocols

The unspiked and spiked (with HT29 cells) blood samples (5 ml blood for each experiment) of healthy volunteers were processed using two different cell extraction protocols followed by immunomagnetic enrichment using the device of Dynal MPC-L (Dynal, Norway): 1. Whole blood samples underwent directly an immunomagnetic enrichment (107 beads per ml blood) using either Dynabeads Epithelial Enrich (Dynal, Oslo, Norway) coated with mAb BerEP4 or alternatively, Pan Mouse IgG beads (Dynal, Norway) coated (1 μg antibody/107 beads) with the mAb KS1/4 (BD PharMingen, Heidelberg, Germany). The samples were then placed in a roller at 4°C for rosetting to occur and after 30 minutes the tubes were placed in a magnetic device for 3 minutes; the blood supernatant was carefully removed and, while the tubes were still on the magnet, rosettes were washed three times with cold PBS. 2. The isolated MNC fraction of the blood sample was counted and resuspended with 107 beads, mAb BerEP4 Dynabeads Epithelial Enrich or alternatively, with Pan Mouse IgG beads coated with the mAb KS1/4, per 107 MNCs in 1 ml PBS. Further immunomagnetic processing was done in the same way as described above. Finally, the rosetted cells were pelleted by centrifugation at 300 g for 10 minutes and resuspended in 100 μl PBS. Immediately, the samples were processed for RNA isolation. In all blood samples from CRC patients isolation of the MNC fraction (prior to immunomagnetic enrichment using the two different EpCAM antibodies) was performed prior to further immunomagnetic enrichment. Immunomagnetic enrichment using the two different EpCAM antibodies was performed as described above.

RNA extraction and nested RT-PCR

CK20 transcripts were detected after immunomagnetic enrichment of tumor cells either derived from blood samples spiked with HT29 cells or from blood samples drawn from CRC patients. For the detection of tumor cells a CK 20 nested RT-PCR was performed as previously shown [12,13]. In brief, total RNA was extracted from the cells immobilized by the magnetic beads added to whole blood or MNC fractions. RNeasy Mini Kit (Qiagen, Hilden, Germany) was used to isolate total RNA according to the manufacturer's instructions. Each sample was eluted in 30 μl RNase-free water. For reverse transcription of the RNA the primer CK20 558.rev and the SuperScript II Kit (Invitrogen, Karlsruhe, Germany) was used following manufacturer's instructions. 2 μl aliquots of cDNA were used for the CK20 nested-PCR reaction using the Master Mix Kit from Promega (Wisconsin, USA) according to manufacturer's protocol. For the first PCR cDNA was subjected to amplification of CK20 with primers 1.for (ATGGATTTCAGTCGCAGA) and 558.rev (ATGTAGGGTTAGGTCATCAAAG) in 35 amplification rounds performed at 93°C for 51 seconds, 60°C for 63 seconds, and 72°C for 42 seconds, with a final extension step at 72°C for 10 minutes. The nested PCR was performed with 8 μl PCR product of the first PCR with primer 139.for (TCCAACTCCAGACACACGGTGAACTATG) and 429.rev (CAGGACACACCGAGCATTTT GCAG) under amplification conditions as following: 93°C for 51 seconds and 72°C for 81 seconds in 35 amplification rounds. PCR products were analyzed by electrophoresis on 2% agarose gels. RNA quality and performance of reverse transcription of the analyzed samples was confirmed by RT-PCR amplification of GAPDH transcripts.

Authors' contributions

DA, LG, and AC performed the experiments and contributed to clinical data collection and manuscript preparation. NR, MWB, and JW contributed to the conduction of the study and were involved in critical review and revision of the manuscript. MK designed the study and was responsible for manuscript preparation and revision. All authors read and approved the final manuscript
  27 in total

1.  Epidermal growth factor-like repeats mediate lateral and reciprocal interactions of Ep-CAM molecules in homophilic adhesions.

Authors:  M Balzar; I H Briaire-de Bruijn; H A Rees-Bakker; F A Prins; W Helfrich; L de Leij; G Riethmüller; S Alberti; S O Warnaar; G J Fleuren; S V Litvinov
Journal:  Mol Cell Biol       Date:  2001-04       Impact factor: 4.272

2.  Meta-analysis shows that detection of circulating tumor cells indicates poor prognosis in patients with colorectal cancer.

Authors:  Nuh N Rahbari; Maximilian Aigner; Kristian Thorlund; Nathan Mollberg; Edith Motschall; Katrin Jensen; Markus K Diener; Markus W Büchler; Moritz Koch; Jürgen Weitz
Journal:  Gastroenterology       Date:  2010-01-25       Impact factor: 22.682

Review 3.  Minimal residual disease in gastrointestinal cancer.

Authors:  P Kienle; M Koch
Journal:  Semin Surg Oncol       Date:  2001-06

4.  Detection of MUC1-expressing mammary carcinoma cells in the peripheral blood of breast cancer patients by real-time polymerase chain reaction.

Authors:  P de Cremoux; J M Extra; M G Denis; J Y Pierga; E Bourstyn; C Nos; K B Clough; E Boudou; E C Martin; A Müller; P Pouillart; H Magdelénat
Journal:  Clin Cancer Res       Date:  2000-08       Impact factor: 12.531

5.  Effect of blood sample handling and reverse transcriptase-polymerase chain reaction assay sensitivity on detection of CK20 expression in healthy donor blood.

Authors:  Femke Vlems; Richie Soong; Heleen Diepstra; Cornelis Punt; Theo Wobbes; Karim Tabiti; Goos van Muijen
Journal:  Diagn Mol Pathol       Date:  2002-06

Review 6.  The biology of the 17-1A antigen (Ep-CAM).

Authors:  M Balzar; M J Winter; C J de Boer; S V Litvinov
Journal:  J Mol Med (Berl)       Date:  1999-10       Impact factor: 4.599

7.  Clinical significance of cytokeratin 20-positive circulating tumor cells detected by a refined immunomagnetic enrichment assay in colorectal cancer patients.

Authors:  Sze Chuen Cesar Wong; Charles Ming Lok Chan; Brigette Buig Yue Ma; Edwin Pun Hui; Simon Siu Man Ng; Paul Bo San Lai; Moon Tong Cheung; Elena Siu Fong Lo; Amanda Kit Ching Chan; Money Yan Yee Lam; Thomas Chi Chuen Au; Anthony Tak Cheung Chan
Journal:  Clin Cancer Res       Date:  2009-02-01       Impact factor: 12.531

8.  The pathogenesis of cancer metastasis: the 'seed and soil' hypothesis revisited.

Authors:  Isaiah J Fidler
Journal:  Nat Rev Cancer       Date:  2003-06       Impact factor: 60.716

9.  Cytogenetic evidence that circulating epithelial cells in patients with carcinoma are malignant.

Authors:  Tanja Fehm; Arthur Sagalowsky; Edward Clifford; Peter Beitsch; Hossein Saboorian; David Euhus; Songdong Meng; Larry Morrison; Thomas Tucker; Nancy Lane; B Michael Ghadimi; Kerstin Heselmeyer-Haddad; Thomas Ried; Chandra Rao; Jonathan Uhr
Journal:  Clin Cancer Res       Date:  2002-07       Impact factor: 12.531

Review 10.  Dissemination and growth of cancer cells in metastatic sites.

Authors:  Ann F Chambers; Alan C Groom; Ian C MacDonald
Journal:  Nat Rev Cancer       Date:  2002-08       Impact factor: 60.716

View more
  20 in total

Review 1.  Screening for colorectal cancer: established and emerging modalities.

Authors:  Nikhil Pawa; Tan Arulampalam; John D Norton
Journal:  Nat Rev Gastroenterol Hepatol       Date:  2011-11-01       Impact factor: 46.802

Review 2.  Isolated, disseminated and circulating tumour cells in prostate cancer.

Authors:  David Schilling; Tilman Todenhöfer; Jörg Hennenlotter; Christian Schwentner; Tanja Fehm; Arnulf Stenzl
Journal:  Nat Rev Urol       Date:  2012-07-10       Impact factor: 14.432

3.  Circulating Tumor Cells and Colorectal Cancer.

Authors:  Joshua E Allen; Wafik S El-Deiry
Journal:  Curr Colorectal Cancer Rep       Date:  2010-10-01

Review 4.  Do circulating tumor cells, exosomes, and circulating tumor nucleic acids have clinical utility? A report of the association for molecular pathology.

Authors:  Bert Gold; Milena Cankovic; Larissa V Furtado; Frederick Meier; Christopher D Gocke
Journal:  J Mol Diagn       Date:  2015-05       Impact factor: 5.568

Review 5.  Clinical applications of liquid biopsies in gastrointestinal oncology.

Authors:  Jason Zhu; John H Strickler
Journal:  J Gastrointest Oncol       Date:  2016-10

Review 6.  Prognostic relevance of minimal residual disease in colorectal cancer.

Authors:  Ulrich Bork; Robert Grützmann; Nuh N Rahbari; Sebastian Schölch; Marius Distler; Christoph Reissfelder; Moritz Koch; Jürgen Weitz
Journal:  World J Gastroenterol       Date:  2014-08-14       Impact factor: 5.742

7.  Quantitative proteomic profiling of paired cancerous and normal colon epithelial cells isolated freshly from colorectal cancer patients.

Authors:  Chengjian Tu; Wilfrido Mojica; Robert M Straubinger; Jun Li; Shichen Shen; Miao Qu; Lei Nie; Rick Roberts; Bo An; Jun Qu
Journal:  Proteomics Clin Appl       Date:  2017-01-20       Impact factor: 3.494

8.  Nuclear and cytoplasmic accumulation of Ep-ICD is frequently detected in human epithelial cancers.

Authors:  Ranju Ralhan; Helen C-H He; Anthony K-C So; Satyendra C Tripathi; Manish Kumar; Md Raghibul Hasan; Jatinder Kaur; Lawrence Kashat; Christina MacMillan; Shyam Singh Chauhan; Jeremy L Freeman; Paul G Walfish
Journal:  PLoS One       Date:  2010-11-30       Impact factor: 3.240

9.  EpCAM nuclear localization identifies aggressive thyroid cancer and is a marker for poor prognosis.

Authors:  Ranju Ralhan; Jun Cao; Terence Lim; Christina Macmillan; Jeremy L Freeman; Paul G Walfish
Journal:  BMC Cancer       Date:  2010-06-25       Impact factor: 4.430

10.  Cholesterol loading and ultrastable protein interactions determine the level of tumor marker required for optimal isolation of cancer cells.

Authors:  Jayati Jain; Gianluca Veggiani; Mark Howarth
Journal:  Cancer Res       Date:  2013-02-01       Impact factor: 12.701

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.