Literature DB >> 20350378

Escherichia albertii in wild and domestic birds.

J Lindsay Oaks1, Thomas E Besser, Seth T Walk, David M Gordon, Kimberlee B Beckmen, Kathy A Burek, Gary J Haldorson, Dan S Bradway, Lindsey Ouellette, Fred R Rurangirwa, Margaret A Davis, Greg Dobbin, Thomas S Whittam.   

Abstract

Escherichia albertii has been associated with diarrhea in humans but not with disease or infection in animals. However, in December 2004, E. albertii was found, by biochemical and genetic methods, to be the probable cause of death for redpoll finches (Carduelis flammea) in Alaska. Subsequent investigation found this organism in dead and subclinically infected birds of other species from North America and Australia. Isolates from dead finches in Scotland, previously identified as Escherichia coli O86:K61, also were shown to be E. albertii. Similar to the isolates from humans, E. albertii isolates from birds possessed intimin (eae) and cytolethal distending toxin (cdtB) genes but lacked Shiga toxin (stx) genes. Genetic analysis of eae and cdtB sequences, multilocus sequence typing, and pulsed-field gel electrophoresis patterns showed that the E. albertii strains from birds are heterogeneous but similar to isolates that cause disease in humans.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20350378      PMCID: PMC3321939          DOI: 10.3201/eid1604.090695

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


In late December 2004, deaths of common redpoll finches (Carduelis flammea) were reported around the city of Fairbanks, Alaska, USA, coincident with a prolonged period of extreme cold (below –40°F). The final reported death occurred on February 24. At the beginning of the outbreak, the local at-risk population was estimated to be ≈8,000 redpoll finches, a historic high for the area. Although ≈100 deaths were documented, the actual number is assumed to be considerably higher. Outbreaks of disease in wild finches (family Fringillidae) have been associated with Salmonella enterica subsp. enterica serotype Typhimurium, Mycoplasma gallisepticum, poxvirus, and Escherichia coli (–). Diagnostic investigation into the Alaska outbreak identified Escherichia albertii as the probable cause of death and as a new pathogen for birds. E. albertii had been identified as an enteric pathogen of humans in Asia () and, more recently, in Africa and North America (T.S. Whittam and H. Steinsland, unpub. data), but to our knowledge, until this outbreak its presence in animals had not been observed. We describe the identification and characterization of E. albertii from birds in North America, Europe, and Australia. We show that bacterial isolates from dead finches in Scotland, previously identified as E. coli O86:K61, were actually E. albertii. The genetic diversity of 2 virulence loci (intimin and cytolethal distending toxin) for the bird isolates was compared with characterized human pathotypes. We also determined genetic relatedness among isolates from birds and humans by multilocus sequence typing (MLST) and clonality of multiple isolates from dead or clinically healthy birds by pulsed-field gel electrophoresis (PFGE).

Methods

Bird Isolate Collection

In the United States during 2004–2005, dead redpoll finches from Alaska were submitted to the Alaska Department of Fish and Game. Three clinically healthy redpoll finches were trapped near the outbreak site. Standard necropsies included gross examination and collection of tissues into 10% neutral buffered formalin for histopathologic examination. Fresh tissues were frozen for microbiologic assays. Two other dead birds, a captive adult gyrfalcon (Falco rusticulos) from Idaho and a chicken (Gallus gallus) from Washington, were submitted for diagnosis to the Washington Animal Disease Diagnostic Laboratory in Pullman, Washington, USA. In Canada in 2005, isolates were obtained from feces of clinically healthy redpolls and pine siskins (Carduelis pinus) trapped on Prince Edward Island. A total of 158 finches were sampled and included redpolls, pine siskins, and purple finches (Carpodacus purpureus). In Australia in 2001–2002, isolates from birds were obtained from feces of clinically healthy domestic and trapped wild birds (). Domestic birds included 9 chickens (G. gallus), 4 geese (Anser anser domesticus), 3 ducks (Anas platyrhynchos domesticus), and 1 guinea fowl (family Numididae). Wild birds totaled 634 birds representing 112 species. In Scotland, isolates obtained during 1998–2000 from dead birds—Eurasian siskins (Carduelis spinus), greenfinches (Carduelis chloris), and chaffinches (Fringilla coelebs)—previously identified as E. coli O86:K61 (), were obtained from M.J. Woodward (Veterinary Laboratories Agency Weybridge, Inverness, UK). Information about all isolates is summarized in Table 1.
Table 1

Escherichia albertii isolates and hosts information

Isolate Origin (state)*Host species of originClinical statusYear of isolationReference
1568-05-27C†USA (AK)Redpoll finch (Carduelis flammea)Dead2005This study
1568-05-27D†USA (AK)Redpoll finch (C. flammea)Dead2005This study
1615-05-A†USA (AK)Redpoll finch (C. flammea)Dead2005This study
1615-05-B†USA (AK)Redpoll finch (C. flammea)Dead2005This study
1297-05-19†‡§¶USA (AK)Redpoll finch (C. flammea)Dead2005This study
7991-07†‡§¶USA (WA)Chicken (Gallus gallus)Dead2007This study
12055-07†‡§¶USA (ID)Gyrfalcon (Falco rusticulos)Dead2007This study
5419-05-R†‡§¶CanadaRedpoll finch (C. flammea)Healthy2005This study
5419-05-S†‡CanadaPine siskin (Carduelis pinus)Healthy2005This study
EC370-98†‡§¶ScotlandFinch spp. (Carduelis spp.)Dead1998(9)
EC558-00†ScotlandEurasian siskin (Carduelis spinus)Dead2000(9)
EC744-99†ScotlandGreenfinch (Carduelis chloris)Dead1999(9)
EC746-99‡ScotlandEurasian siskin (C. spinus)Dead1999(9)
EC748-99†ScotlandGreenfinch (C. chloris)Dead1999(9)
B090†‡¶AustraliaMagpie (Gymnorhina tibicen)Healthy2001This study
B101†‡§¶AustraliaMagpie(G. tibicen)Healthy2001This study
B156†‡§¶AustraliaMagpie (G. tibicen)Healthy2001This study
B249†‡¶AustraliaMagpie (G. tibicen)Healthy2001This study
B198†‡§¶AustraliaHoneyeater (Melithreptus brevirostris)Healthy2002This study
B992†‡§¶AustraliaWren (Malurus cyaneus)Healthy2001This study
B1086†‡§¶AustraliaFantail (Rhipidura fulginosa)Healthy2002This study
B1068†‡§¶AustraliaChicken (G. gallus)Healthy2002This study
B1074†‡§¶AustraliaChicken (G. gallus)Healthy2002This study
616‡No dataHumanDiarrheaNo data(10)
3103-99‡USA (IL)HumanDiarrheaNo data(10)
C-425‡§No dataHumanDiarrheaNo data(10)
106A5‡§Guinea-BissauHumanHealthy1997(11)
9194†‡BangladeshHumanDiarrhea1990(10)
19982दBangladeshHumanDiarrhea1990(10)
79D4†‡Guinea-BissauHumanHealthy1997(11)
97F8‡Guinea-BissauHumanHealthy1997(11)
M2005000616 #8‡USA (MN)HumanDiarrheaNo dataT.S. Whittam, unpub data
I2005002880 #36‡USA (MN)HumanDiarrheaNo dataT.S. Whittam, unpub data
K-694¶BangladeshHumanDiarrheaNo data(10)
K-1दBangladeshHumanDiarrheaNo data(10)

*AK, Alaska; WA, Washington; ID, Idaho; IL, Illinois; MN, Minnesota.
†Included in pulsed-field gel electrophoresis analysis.
‡Included in multilocus sequence typing analysis.
§Included in eae allele analysis.
¶Included in cdtB allele analysis.

*AK, Alaska; WA, Washington; ID, Idaho; IL, Illinois; MN, Minnesota.
†Included in pulsed-field gel electrophoresis analysis.
‡Included in multilocus sequence typing analysis.
§Included in eae allele analysis.
¶Included in cdtB allele analysis.

Isolation and Identification of Bacteria

To detect Enterobacteriaceae, we inoculated tissues, intestinal contents, or feces onto MacConkey agar and incubated the plates at 35°C. Isolated colonies were characterized by fermentation of lactose and glucose, production of oxidase, and production of indole from tryptophan. Additional biochemical characterization was performed by using a commercial kit (API 20E; bioMérieux, Hazelwood, MO, USA). E. coli serotyping was performed by the Gastroenteric Disease Center (Wiley Laboratory, Pennsylvania State University, University Park, PA, USA). Genetic identification was based on 16S rRNA gene sequencing and/or PCR to detect housekeeping gene polymorphisms unique for the E. albertii/Shigella boydii lineage. 16S rRNA analysis was performed on 1 isolate from Alaska by sequencing >1,400 nt of the 16S rRNA gene (). The amplicon was cloned into the pCR2.1 sequencing vector (TOPO TA Cloning Kit; Invitrogen, Carlsbad, CA, USA) and sequenced bidirectionally by automated dideoxy DNA methods. Partial 16S rRNA sequences of ≈500 bp of the 5′ end, including the V1, V2, and V3 variable regions (), were determined for other isolates with the same primers, after which direct dideoxy sequencing was performed. A sequence similarity search was performed by searching the GenBank database with BLASTN.2.2.3 (), and sequences were aligned with ClustalW2 (www.ebi.ac.uk/Tools/clustalw2/index.html). PCR was used to detect E. albertii lineage–specific genetic polymorphisms in the housekeeping genes lysP and mdh (). As a positive control, PCR for the gene clpX, which is conserved in E. coli, Shigella, and the E. albertii/S. boydii lineage, was performed as described (), except a corrected primer sequence for clpX_28 (5′-TGG CGT CGA GTT GGG CA-3′) (T.S. Whittam, unpub. data) was used. The negative control for the lysP and mdh PCR was E. coli strain DH10b.

Virulence Gene PCR and Sequence Analysis

PCR was used to test isolates for virulence genes found in Enterobacteriaceae—the central conserved region of intimin (eae, the attaching-and-effacing ligand), heat-stable enterotoxin (sta), and Shiga toxins (stx1 and stx2)—as described (). Positive controls were E. coli strains S2 (for sta) and S14 (for stx1, stx2, and eae) from the Pennsylvania State University E. coli Reference Center. A multiplex PCR protocol that amplified the consensus portion of the B subunit of the cytolethal distending toxin gene (cdtB) as described by Toth () was modified by using each of the primer pairs (s1/as1 and s2/as2) individually to screen for cdtB in all isolates. For sequencing eae, PCR primers that amplified ≈800 nt of the variable 3′ end of the eae gene were used as described (). Because these primers did not work for all bird isolates, additional primer sequences were either taken from other studies or designed for this study (Tables 2 and 3). Sequence analysis was based on ≈726 nt in the 3′ variable region of eae, which corresponded to amino acids 33–275 within the C-terminal 280 aa of intimin (Int280). Nucleotide sequences were determined for each of the cdtB products obtained by using the s1/as1 (403 bp) and s2/as2 (411 bp) primer pairs (). Predicted amino acid sequences for eae and cdtB were aligned with reference alleles by using the ClustalW method and MegAlign software (DNASTAR, Madison, WI, USA). Neighbor-joining dendrograms were constructed by using MEGA version 4 () with the p-distance metric and pairwise gap deletion.
Table 2

Primers used for amplification and sequencing of eae gene of Escherichia albertii

Primer Sequence, 5′ → 3′Position (GenBank accession no.)Reference
Intimin γ FCGTTGAAGTCGAGTACGCCA1867–1887 (AF081185)(9)
Intimin γ RTTCTACACAAACCGCATAGA2782–2803 (AF081185)(9)
EaeA-FCAAACCAAGGCCAGCATTAC1963–1982 (AF081185)This study
EaeA-R outerCCCCAAGAGAGAGGGTTCTT2743–2763 (AF081185)This study
EaeA-R innerACTTGATACCCCAGACCTTCA2703–2725 (AF081185)This study
EscD-R1GTATCAACATCTCCCGCCA27918–27937 (AF022236)(17)
Intimin-R2CAGAATATTAAACAAGCGCAGTTG3103–3126 (FJ609833)This study
EaeA F06sGTAACGGACTTTACGGCTGATA1803–1824 (FJ609833)(10)
Intimin B101 int RTGACCATATTGCAACCA2460–2476 (FJ609833)This study
Intimin B156 int RTGACCATATCGCAACCA2459–2475 (FJ609822)This study
Table 3

Primer sets used for amplification and sequencing of eae gene of Escherichia albertii in specific isolates

IsolatePCR amplificationSequencing
1297–05–19Intimin γ F, intimin γ RIntimin γ F, intimin γ R
7991–07EaeA-F, EaeA-R outerEaeA-F, EaeA-R inner
12055–07Intimin γ F, intimin γ RIntimin γ F, intimin γ R
5419–05-RIntimin γ F, intimin γ RIntimin γ F, intimin γ R
EC370–98Intimin γ F, intimin γ RIntimin γ F, intimin γ R
EC746–99Intimin γ F, intimin γ RIntimin γ F, intimin γ R
B101Intimin γ F, intimin γ RIntimin γ F, intimin γ R
B156EaeA-F, Intimin-R2EaeA-F, intimin-R2, intimin B156 int R
B198EaeA-F, intimin-R2EaeA-F, intimin-R2, intimin B156 int R
B992EaeA F06s, EscD-R1EaeA F06s, EscD-R1, EaeA-F, intimin B101 int R
B1086EaeA-F, intimin γ REaeA-F, intimin γ R, EaeA-R outer
B1068EaeA F06s, EscD-R1EaeA F06s, EscD-R1, EaeA-F
B1074EaeA F06s, EscD-R1EaeA F06s, EscD-R1, EaeA-F

MLST

MLST was performed on 26 isolates of E. albertii (Table 1) as described (), with slight modification. Briefly, partial gene sequences for 6 conserved housekeeping loci (aspC, clpX, fadD, icdA, lysP, and mdh) were obtained by PCR and direct sequenced by automated dideoxy sequencing. Raw sequences were aligned by using Seqman Pro software (DNASTAR). Sequences for 11 E. albertii isolates from humans and 6 common E. coli pathotypes were obtained from www.shigatox.net. E. coli was used as an outgroup; strains used were enterohemorrhagic E. coli strain EDL933, Shigella flexneri strain 2747-71, enteroaggregative E. coli strain 042, enteropathogenic E. coli strain e2348/69, uropathogenic E. coli strain CFT073, and E. coli K-12. A neighbor-joining dendrogram was based on the concatenated nucleotide sequence and the maximum composite likelihood model by using MEGA version 4 (). Details of the MLST procedure, including allelic typing and sequence type assignment methods, can be found at www.shigatox.net. An overall phylogenetic representation of the genus Escherichia was generated by combining nucleotide sequence data from GenBank for Escherichia fergusonii with outgroup strains Salmonella bongori, S. enterica subsp. enterica serotype Typhi, and S. enterica subsp. enterica serotype Typhimurium. A neighbor-net network analysis was generated by using SplitsTree 4 software () (Figure 1, inset).
Figure 1

Neighbor-joining dendrogram of bird and human isolates, based on nucleotide variation at 6 conserved housekeeping loci in the Escherichia albertii genome (multilocus sequence typing), supporting identification of all isolates as E. albertii. Three distinct clades are designated EA 1–EA 3. No clustering of isolates is apparent on the basis of their host type, geographic origin, or association with disease. Inset is a SplitsTree phylogenetic network of the genus Escherichia, showing the E. albertii/Shigella boydii serotype 7/13 lineage with respect to the other named species. S. bongori, Salmonella bongori; S. enterica, Salmonella enterica. Scale bars indicate genetic distance.

Neighbor-joining dendrogram of bird and human isolates, based on nucleotide variation at 6 conserved housekeeping loci in the Escherichia albertii genome (multilocus sequence typing), supporting identification of all isolates as E. albertii. Three distinct clades are designated EA 1–EA 3. No clustering of isolates is apparent on the basis of their host type, geographic origin, or association with disease. Inset is a SplitsTree phylogenetic network of the genus Escherichia, showing the E. albertii/Shigella boydii serotype 7/13 lineage with respect to the other named species. S. bongori, Salmonella bongori; S. enterica, Salmonella enterica. Scale bars indicate genetic distance.

PFGE

E. albertii isolates were compared by using a standard PFGE method () with minor modifications. Briefly, fragments of XbaI-digested bacterial DNA were separated in 1% agarose gel by using a CHEF-DR III PFGE apparatus (Bio-Rad, Hercules, CA, USA); pulse times were ramped from 2.2 to 54.2 seconds over 19 hours. Digital gel images were analyzed with Bionumerics software (Applied Maths, Sint-Martens-Latem, Belgium) by using the unweighted pair group method with arithmetic mean algorithm for cluster analysis of Dice similarity coefficients with a position tolerance of 2%.

Nucleotide Sequence Accession Numbers

Nucleotide sequences from this study were deposited in GenBank. Their accession numbers are EU926632–EU926649 and GQ140242–GQ140261.

Results

Pathologic Findings

Redpoll finches from the Alaska outbreak were typically found dead without obvious signs of disease. All those evaluated had adequate pectoral muscle mass, suggestive of acute death. Some had green fecal material pasted around their cloacae, suggestive of diarrhea. Gross lesions were inconsistent, but a few birds had darkened intestines distended with excessive yellow to green digesta. Histologic lesions were also inconsistent, but when present they were consistent with acute, severe, fibrinous, and necrotizing proventriculitis; multifocal heterophilic enteritis; and small-crypt abscessation. For some, gram-negative bacilli in large numbers were observed within the intestinal lumens. Attachment of bacteria to intestinal epithelial cells was not observed, although autolysis precluded assessment of the epithelium and ultrastructural studies to detect attaching-and-effacing lesions. No lesions consistent with septicemia were observed in any affected redpolls. The affected gyrfalcon had appeared clinically healthy until found dead. Histologic examination failed to demonstrate enteric lesions, although evidence of septicemia was found. The chicken from Washington died after ≈1 week of illness, during which it appeared depressed and anorexic. Histopathologic examination showed severe, diffuse, necrotizing typhlitis; mild to moderate enterocolitis; and septicemia.

Bacteria Isolated

Bacterial cultures were performed for 8 dead redpolls from Alaska and 3 healthy redpolls trapped in the same area. Large numbers of non–lactose-fermenting gram-negative rods were isolated from the intestines and tissues of 5 of the dead redpolls but from none of the 3 healthy redpolls. Similar organisms were also isolated in large numbers from the tissues of the gyrfalcon and intestines of the chicken. In the healthy birds trapped on Prince Edward Island, non–lactose-fermenting bacteria were isolated from the feces of 11 (12%) of 95 siskins and 4 (12%) of 33 redpolls but from none of 30 samples from purple finches. From the healthy birds trapped in Australia, non–lactose-fermenting bacteria were isolated from 4 (18%) of 22 magpies (Gymnorhina tibicen), 1 (10%) of 10 honeyeaters (Melithreptus brevirostris), 1 (3%) of 38 wrens (Malurus cyaneus), 1 (7%) of 15 fantails (Rhipidura fulginosa), and 2 (22%) of 9 chickens. The isolates were oxidase negative; fermented glucose but not lactose, sucrose, or xylose; produced indole from tryptophan; and were nonmotile at 35°C. Further biochemical characterization with the API 20E panel indicated that the isolates produced lysine decarboxylase and ornithine decarboxylase and fermented d-glucose, d-mannitol, and l-arabinose. The isolates did not utilize citrate; did not produce arginine decarboxylase, hydrogen sulfide, urease, tryptophan deaminase, acetoin, or gelatinase; and did not ferment inositol, l-rhamnose, d-sucrose, d-melibiose, or amygdalin. All isolates except that from the fantail from Australia (B1086) used β-galactosidase. Fermentation of d-sorbitol varied; it was not fermented by the isolates from finches from Alaska, Canada, and Scotland or the gyrfalcon or by 3 of the 9 isolates from birds in Australia (B1068, B1074, and B1086). API 20E testing identified the isolates that used β-galactosidase and fermented d-sorbitol as code 5144102 and weakly (43%) identified them as E. coli. Identical API 20E profiles were reported for the isolates identified as E. coli from the dead finches from Scotland (). Although the isolates from Scotland were serotyped as O86:K61, an isolate from Alaska (1297-05-019) did not react with any of the 175 O E. coli antiserum samples, including O86. Variable use of β-galactosidase and fermentation of d-sorbitol resulted in API 20E codes of 5144502 or 4144102 and more robust identifications as E. coli (84% and 90%, respectively). The nearly full-length 16S rRNA sequence of isolate 1297-05-19 from the redpoll in Alaska was most similar (1,470 [99.7%] of 1,475 nt) to sequences of E. albertii (AY696669) and S. boydii (1,467 [99.5%] of 1,475 nt, AY696670) isolated from humans. The 495-nt sequence of the 5′ end of 16S rRNA was determined for redpoll 5419-05-R from Canada, finch EC37098 from Scotland, and gyrfalcon 12055-07 and chicken 7991-07 from the United States. In all, 9 nucleotide polymorphisms were observed among these 5 isolates, including 5 clustered in the V1 region (98.2% overall identity). These sequences were 99.2%–99.6% identical to the sequence of an eae-positive strain of Hafnia alvei (Z83203), E. albertii from humans (AJ508775, AY696662–AY696664, AY696669), and S. boydii serotypes 7 and 13 (AY696670–AY696680). PCRs were positive for the E. albertii–specific alleles of lysP and mdh () in all isolates from birds. Collectively, these data tentatively identified these isolates as E. albertii.

Virulence Genes

All isolates from birds were positive for eae and cdtB but negative for stx1, stx2, and sta, the same repertoire of virulence genes reported for E. albertii isolates from humans (). Alignment of the 3′ portion of the eae gene showed that the bird isolates possessed a variety of eae alleles, some novel and some similar to previously reported alleles (Figure 2, panel A). There was no clustering of bird eae alleles related to geographic origin, bird versus human origin, or isolation from diseased versus clinically healthy birds or humans. The largest cluster of bird alleles was found in representative isolates (Figure 2, panel A) from the redpolls from Alaska and Canada, the gyrfalcon and chicken from the United States, and the fantail from Australia, which were all nearly identical (1 nonsynonymous nt change each in the isolate from the redpoll and fantail from Alaska). This allele was distinct from other reference eae alleles and thus novel, but it was most similar to γ intimin. Alleles from the isolates from finch E37098 and siskin EC74699 from Scotland and magpie B101 from Australia were identical to each other but were also novel alleles most closely related to the μ allele in E. coli (). The alleles from isolates from other wild birds and chickens from Australia were similar to previously reported allelic subtypes, including ε, α, and ν (). Only the isolates from chickens B1068 and B1074 in Australia had an allelic subtype, ν 1.1, previously reported for an E. albertii isolate from a human (,).
Figure 2

Neighbor-joining dendrogram based on the predicted amino acid sequences of the intimin (eae) and cytolethal distending toxin (cdtB) loci of Escherichia spp. Isolates analyzed in this study are designated by their isolate identification number; reference alleles are designated by their GenBank accession numbers. All Escherichia albertii isolates are indicated by circles or squares; all other isolates are E. coli. Scale bars indicate genetic distance. A) eae alleles carried by E. albertii isolates from birds (filled circles) represent diverse allelic subtypes and do not form separate clusters from allelic subtypes carried by isolates from humans (open circles). The eae alleles from North America and 1 from Australia (B1086) are novel but most similar to γ intimins. The eae alleles from Scotland and 1 from Australia (B101) are also novel but most similar to μ intimins. B) The E. albertii cdtB alleles from bird isolates, amplified by the s1/as1 primers, are most similar to cdtB types II, III, and V. E. albertii alleles from human isolates are marked with open circles. The bird E. albertii cdtB alleles amplified by the s2/as2 primers are distantly related to the other bird and human E. albertii alleles and are most similar to cdtB type I in E. coli. Because all the avian alleles amplified by the s2/as2 primers in each group are identical, only 1 sequence for each is shown.

Neighbor-joining dendrogram based on the predicted amino acid sequences of the intimin (eae) and cytolethal distending toxin (cdtB) loci of Escherichia spp. Isolates analyzed in this study are designated by their isolate identification number; reference alleles are designated by their GenBank accession numbers. All Escherichia albertii isolates are indicated by circles or squares; all other isolates are E. coli. Scale bars indicate genetic distance. A) eae alleles carried by E. albertii isolates from birds (filled circles) represent diverse allelic subtypes and do not form separate clusters from allelic subtypes carried by isolates from humans (open circles). The eae alleles from North America and 1 from Australia (B1086) are novel but most similar to γ intimins. The eae alleles from Scotland and 1 from Australia (B101) are also novel but most similar to μ intimins. B) The E. albertii cdtB alleles from bird isolates, amplified by the s1/as1 primers, are most similar to cdtB types II, III, and V. E. albertii alleles from human isolates are marked with open circles. The bird E. albertii cdtB alleles amplified by the s2/as2 primers are distantly related to the other bird and human E. albertii alleles and are most similar to cdtB type I in E. coli. Because all the avian alleles amplified by the s2/as2 primers in each group are identical, only 1 sequence for each is shown. All isolates tested (Figure 2, panel B) were PCR positive for cdtB with the s1/as1 primer pair. With the exception of the chicken from the United States and 5 isolates from birds in Australia (2 chickens [B1068 and B1074], 1 fantail, 1 honeyeater, and 1 wren), all were also positive for cdtB with the s2/as2 primer pair. Because these 2 primer pairs are specific for different types of cytolethal distending toxin (), at least some isolates from birds appeared to carry multiple cdtB genes. Sequencing and alignment of the s1/as1 PCR products showed these to have ≈91% nt and 92% aa identity. On the basis of amino acid polymorphisms (Figure 2, panel B), avian cdtB alleles amplified by the s1/as1 primers were most similar to type II (birds from North America and Australia) and types III and V (the gyrfalcon, finches from Scotland, other birds from Australia) reference alleles (–). Sequencing and alignment of the s2/as2 PCR product showed that the sequences from the isolates from Australia were identical to each other, that the sequences from the isolates from North America and Scotland were identical to each other, and that these 2 groups of sequences were similar to each other with ≈99% identity at both the nucleotide and amino acid levels. These sequences were similar (1- or 2-aa differences) to the type I cdtB reference allele (). The presence of a type I cdtB is consistent with the previous finding of a type I cdtB in the isolates from the finches from Scotland, identified by type-specific PCRs ().

MLST Findings

MLST of nucleotide variation at 6 loci (a total of 3,165 bp) in the genomes of isolates (Table 1) showed 3 main clades of E. albertii (EA 1, EA 2, and EA 3 in Figure 1). Isolates did not appear to cluster on the basis of host disease status (healthy, with diarrhea, or dead) or host type. All isolates from birds from North America were closely related and clustered in clade EA 2, along with 3 isolates from birds from Australia (honeyeater, wren, and fantail) and an isolate from a human with diarrhea (I2005002880 #36). The isolate from chicken 7991-07 was slightly divergent from the rest of the isolates from North America (5 synonymous and 1 nonsynonymous nt changes) and was indistinguishable from isolate I2005002880 #36 from the human. Isolates from the dead redpolls from Alaska, healthy finches from Canada, and the gyrfalcon were identical. The isolate from finch EC370-98 from Scotland was distantly related to other bird isolates and clustered with an isolate from a human with diarrhea (M2005000616 #8) in clade EA 1. MLST strongly supported the biochemical and other molecular data indicating that the bird isolates in this study were E. albertii. Collectively, these isolates represent a distant relative of E. coli, a divergent lineage in the genus Escherichia, and novel diversity within the E. albertii species (Figure 1, inset).

PFGE Findings

PFGE showed that isolates from the 2 bird death epornithics (in Alaska and Scotland) each formed a clonal group (Figure 3), which suggests that these events were associated with expansion of a single clone from either a common source or bird-to-bird transmission. Overall, the PFGE banding patterns and dendrogram indicate that the isolates from birds and humans constitute a heterogeneous group, consistent with the heterogeneity identified in eae and cdtB and by MLST.
Figure 3

Dendrogram (unweighted pair group method with arithmetic mean) of Escherichia albertii isolates from birds, based on pulsed-field gel electrophoresis band profiles. Isolates from disease outbreaks in Alaska and Scotland form clonal groups, indicating that these outbreaks are associated with expansion of a single clone. The profiles for the other isolates indicate that the bird and human E. albertii isolates are heterogeneous and do not segregate on the basis of host, geographic origin, or disease status. Scale bar indicates percent similarity.

Dendrogram (unweighted pair group method with arithmetic mean) of Escherichia albertii isolates from birds, based on pulsed-field gel electrophoresis band profiles. Isolates from disease outbreaks in Alaska and Scotland form clonal groups, indicating that these outbreaks are associated with expansion of a single clone. The profiles for the other isolates indicate that the bird and human E. albertii isolates are heterogeneous and do not segregate on the basis of host, geographic origin, or disease status. Scale bar indicates percent similarity.

Discussion

E. albertii is a recently described member of the Enterobacteriaceae and has been associated with diarrheal illness in humans (–). Until now, however, it has not been associated with disease or infection in animals. E. albertii was originally described as an unusual strain of H. alvei with virulence genes that included eae and the cdtABC operon (,). Subsequent characterization of these H. alvei strains demonstrated that they were members of the genus Escherichia (,,) and constituted a new taxon for which the name E. albertii was proposed (). The E. albertii lineage diverged before the radiation of E. coli and Shigella spp. and includes the atypical S. boydii serotypes 7 and 13 (). The prevalence, epidemiology, and clinical relevance of E. albertii are poorly defined, in part because E. albertii is likely to either remain unidentified or be misidentified by current commercial biochemical identification methods as E. coli, H. alvei, S. boydii, or Yersinia ruckeri (,,). Our phenotypic, biochemical, 16S rRNA sequence, and MLST analyses are in strong agreement that the bird isolates in this study, including the previously identified O86:K61 E. coli isolates from Scotland, are correctly classified as E. albertii. In addition, all bird isolates carried genes for 2 characteristic E. albertii virulence factors (intimin and cytolethal distending toxin). Our findings indicate that E. albertii is likely pathogenic to birds and can be associated with epornithics and sporadic disease. The primary pathologic lesion in birds was consistent with enteritis, but the classic attaching-and-effacing lesions typically associated with eae-positive pathogens were not detected. The postmortem condition of the dead finches may have prevented such detection, but experimental work with chicks and the isolates from Scotland suggests that other disease mechanisms need to be considered (). We also conclude that E. albertii is able to subclinically colonize various species of wild birds globally. The determinants of pathogenicity of E. albertii in birds remain to be clarified, but its isolation from diseased and healthy birds suggests that its epizoology in songbirds may resemble that of S. enterica subsp. enterica serotype Typhimurium, which is maintained by subclinical carriers and causes outbreaks of disease under conditions of increased stress or high bacterial doses (,,). The E. albertii isolates from birds in this study differed from those from humans in several notable ways, although the lack of phylogenetic clustering based on host of origin suggests that it would be premature to conclude that these differences are truly host related. First, all bird isolates produced indole from tryptophan, resulting in weak (43% level of confidence) identification as E. coli in contrast to indole-negative isolates from humans, which are identified as H. alvei (45% level of confidence) according to API 20E databases. However, when the positive indole result is combined with the positive reaction for d-sorbitol found for some bird isolates, the identification as E. coli is more robust (84%) and thus more likely to lead to misidentification. Second, we demonstrated the presence of 2 different cdtB genes. Whether the presence of multiple cdtB genes in the human or other bird E. albertii isolates was missed for technical reasons, or whether these other isolates contain a single gene, requires further investigation. In conclusion, E. albertii appears to be a pathogen of animals and humans and may be carried subclinically by some birds. E. albertii is a member of a more heterogeneous group than was previously appreciated, and additional variation will likely become apparent as additional isolates from other animal hosts and geographic regions are characterized. Whether E. albertii can be transmitted from animals to humans is unknown, although the eae, cdtB, MLST, and PFGE data indicating that the bird isolates cluster among isolates from humans suggest that zoonoses or anthroponoses are possible. Regardless, identification of E. albertii in the clinical laboratory remains a challenge, and it is likely that this pathogen is often unidentified or misidentified in human and veterinary medicine.
  30 in total

1.  Application of phylogenetic networks in evolutionary studies.

Authors:  Daniel H Huson; David Bryant
Journal:  Mol Biol Evol       Date:  2005-10-12       Impact factor: 16.240

2.  Isolation of Escherichia coli O86:K61 producing cyto-lethal distending toxin from wild birds of the finch family.

Authors:  G Foster; H M Ross; T W Pennycott; G F Hopkins; I M McLaren
Journal:  Lett Appl Microbiol       Date:  1998-06       Impact factor: 2.858

3.  Causes of death of wild birds of the family Fringillidae in Britain.

Authors:  T W Pennycott; H M Ross; I M McLaren; A Park; G F Hopkins; G Foster
Journal:  Vet Rec       Date:  1998-08-08       Impact factor: 2.695

Review 4.  Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.

Authors:  S F Altschul; T L Madden; A A Schäffer; J Zhang; Z Zhang; W Miller; D J Lipman
Journal:  Nucleic Acids Res       Date:  1997-09-01       Impact factor: 16.971

5.  Epidemic mycoplasmal conjunctivitis in house finches from eastern North America.

Authors:  A A Dhondt; D L Tessaglia; R L Slothower
Journal:  J Wildl Dis       Date:  1998-04       Impact factor: 1.535

6.  Natural antimicrobial susceptibility patterns and biochemical identification of Escherichia albertii and Hafnia alvei strains.

Authors:  Ingo Stock; Motiur Rahman; Kimberley Jane Sherwood; Bernd Wiedemann
Journal:  Diagn Microbiol Infect Dis       Date:  2005-03       Impact factor: 2.803

7.  Prototypal diarrheagenic strains of Hafnia alvei are actually members of the genus Escherichia.

Authors:  J M Janda; S L Abbott; M J Albert
Journal:  J Clin Microbiol       Date:  1999-08       Impact factor: 5.948

8.  Standardization of pulsed-field gel electrophoresis protocols for the subtyping of Escherichia coli O157:H7, Salmonella, and Shigella for PulseNet.

Authors:  Efrain M Ribot; M A Fair; R Gautom; D N Cameron; S B Hunter; B Swaminathan; Timothy J Barrett
Journal:  Foodborne Pathog Dis       Date:  2006       Impact factor: 3.171

9.  Evolutionary genetics of a new pathogenic Escherichia species: Escherichia albertii and related Shigella boydii strains.

Authors:  Katie E Hyma; David W Lacher; Adam M Nelson; Alyssa C Bumbaugh; J Michael Janda; Nancy A Strockbine; Vincent B Young; Thomas S Whittam
Journal:  J Bacteriol       Date:  2005-01       Impact factor: 3.490

10.  Multiplex PCR for enterotoxigenic, attaching and effacing, and Shiga toxin-producing Escherichia coli strains from calves.

Authors:  S M Franck; B T Bosworth; H W Moon
Journal:  J Clin Microbiol       Date:  1998-06       Impact factor: 5.948

View more
  27 in total

1.  Epidemiological investigation of eaeA-positive Escherichia coli and Escherichia albertii strains isolated from healthy wild birds.

Authors:  Jae-Young Oh; Min-Su Kang; Hee-Tae Hwang; Byung-Ki An; Jun-Hun Kwon; Yong-Kuk Kwon
Journal:  J Microbiol       Date:  2011-11-09       Impact factor: 3.422

2.  Biofilm formation by and thermal niche and virulence characteristics of Escherichia spp.

Authors:  Danielle J Ingle; Olivier Clermont; David Skurnik; Erick Denamur; Seth T Walk; David M Gordon
Journal:  Appl Environ Microbiol       Date:  2011-02-18       Impact factor: 4.792

3.  Evaluating the occurrence of Escherichia albertii in chicken carcass rinses by PCR, Vitek analysis, and sequencing of the rpoB gene.

Authors:  Rebecca L Lindsey; Paula J Fedorka-Cray; Melanie Abley; Jennifer B Turpin; Richard J Meinersmann
Journal:  Appl Environ Microbiol       Date:  2014-12-29       Impact factor: 4.792

Review 4.  The Evasive Enemy: Insights into the Virulence and Epidemiology of the Emerging Attaching and Effacing Pathogen Escherichia albertii.

Authors:  Shantanu Bhatt; Marisa Egan; Brian Critelli; Andrew Kouse; Daniel Kalman; Chirag Upreti
Journal:  Infect Immun       Date:  2018-12-19       Impact factor: 3.441

Review 5.  The Changing Face of the Family Enterobacteriaceae (Order: "Enterobacterales"): New Members, Taxonomic Issues, Geographic Expansion, and New Diseases and Disease Syndromes.

Authors:  J Michael Janda; Sharon L Abbott
Journal:  Clin Microbiol Rev       Date:  2021-02-24       Impact factor: 26.132

6.  Prevalence of eae-positive, lactose non-fermenting Escherichia albertii from retail raw meat in China.

Authors:  H Wang; Q Li; X Bai; Y Xu; A Zhao; H Sun; J Deng; B Xiao; X Liu; S Sun; Y Zhou; B Wang; Z Fan; X Chen; Z Zhang; J Xu; Y Xiong
Journal:  Epidemiol Infect       Date:  2015-05-25       Impact factor: 4.434

7.  Clinical significance of Escherichia albertii.

Authors:  Tadasuke Ooka; Kazuko Seto; Kimiko Kawano; Hideki Kobayashi; Yoshiki Etoh; Sachiko Ichihara; Akiko Kaneko; Junko Isobe; Keiji Yamaguchi; Kazumi Horikawa; Tânia A T Gomes; Annick Linden; Marjorie Bardiau; Jacques G Mainil; Lothar Beutin; Yoshitoshi Ogura; Tetsuya Hayashi
Journal:  Emerg Infect Dis       Date:  2012-03       Impact factor: 6.883

8.  Detection of Escherichia albertii from chicken meat and giblets.

Authors:  Eriko Maeda; Koichi Murakami; Nobuyuki Sera; Kenitiro Ito; Shuji Fujimoto
Journal:  J Vet Med Sci       Date:  2015-03-08       Impact factor: 1.267

9.  Human gastroenteritis outbreak associated with Escherichia albertii, Japan.

Authors:  Tadasuke Ooka; Eisuke Tokuoka; Masato Furukawa; Tetsuya Nagamura; Yoshitoshi Ogura; Kokichi Arisawa; Seiya Harada; Tetsuya Hayashi
Journal:  Emerg Infect Dis       Date:  2013-01       Impact factor: 6.883

10.  Isolation and characteristics of Shiga toxin 2f-producing Escherichia coli among pigeons in Kyushu, Japan.

Authors:  Koichi Murakami; Yoshiki Etoh; Sachiko Ichihara; Eriko Maeda; Shigeyuki Takenaka; Kazumi Horikawa; Hiroshi Narimatsu; Kimiko Kawano; Yoshiaki Kawamura; Kenitiro Ito
Journal:  PLoS One       Date:  2014-01-23       Impact factor: 3.240

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.