| Literature DB >> 20302640 |
Ming Tong1, Lisa Longato, Suzanne M de la Monte.
Abstract
BACKGROUND: Type 2 diabetes mellitus (T2DM) and several types of neurodegeneration, including Alzheimer's, are linked to insulin-resistance, and chronic high dietary fat intake causes T2DM with mild neurodegeneration. Intra-cerebral Streptozotocin, a nitrosamine-related compound, causes neurodegeneration, whereas peripheral treatment causes DM. HYPOTHESIS: Limited early exposures to nitrosamines that are widely present in the environment, enhance the deleterious effects of high fat intake in promoting T2DM and neurodegeneration.Entities:
Year: 2010 PMID: 20302640 PMCID: PMC3161394 DOI: 10.1186/1472-6823-10-4
Source DB: PubMed Journal: BMC Endocr Disord ISSN: 1472-6823 Impact factor: 2.763
Primer Pairs Used for Quantitative Reverse Transcriptase Polymerase Chain Reaction Assays
| Primer | Direction | Sequence (5' → 3') | Position (mRNA) | Amplicon Size (bp) |
|---|---|---|---|---|
| Insulin | For | TTC TAC ACA CCC AAG TCC CGT C | 145 | 135 |
| Insulin | Rev | ATC CAC AAT GCC ACG CTT CTG C | 279 | |
| Insulin Receptor | For | TGA CAA TGA GGA ATG TGG GGA C | 875 | 129 |
| Insulin Receptor | Rev | GGG CAA ACT TTC TGA CAA TGA CTG | 1003 | |
| IGF-I | For | GAC CAA GGG GCT TTT ACT TCA AC | 65 | 127 |
| IGF-I | Rev | TTT GTA GGC TTC AGC GGA GCA C | 191 | |
| IGF-I Receptor | For | GAA GTC TGC GGT GGT GAT AAA GG | 2138 | 113 |
| IGF-I Receptor | Rev | TCT GGG CAC AAA GAT GGA GTT G | 2250 | |
| IGF-II | For | CCA AGA AGA AAG GAA GGG GAC C | 763 | 95 |
| IGF-II | Rev | GGC GGC TAT TGT TGT TCA CAG C | 857 | |
| IGF-II Receptor | For | TTG CTA TTG ACC TTA GTC CCT TGG | 1066 | 91 |
| IGF-II Receptor | Rev | AGA GTG AGA CCT TTG TGT CCC CAC | 1156 | |
| IRS-1 | For | GAT ACC GAT GGC TTC TCA GAC G | 604 | 134 |
| IRS-1 | Rev | TCG TTC TCA TAA TAC TCC AGG CG | 737 | |
| IRS-2 | For | CAA CAT TGA CTT TGG TGA AGG GG | 255 | 109 |
| IRS-2 | Rev | TGA AGC AGG ACT ACT GGC TGA GAG | 263 | |
| IRS-4 | For | ACC TGA AGA TAA GGG GTC GTC TGC | 2409 | 132 |
| IRS-4 | Rev | TGT GTG GGG TTT AGT GGT CTG G | 2540 | |
| ChAT | For | TCA CAG ATG CGT TTC ACA ACT ACC | 478 | 106 |
| ChAT | Rev | TGG GAC ACA ACA GCA ACC TTG | 583 | |
| AChE | For | TTC TCC CAC ACC TGT CCT CAT C | 420 | 123 |
| AChE | Rev | TTC ATA GAT ACC AAC ACG GTT CCC | 542 | |
| APP | For | GCA GAA TGG AAA ATG GGA GTC AG | 278 | 199 |
| APP | Rev | AAT CAC GAT GTG GGT GTG CGT C | 476 | |
| Tau | For | CGC CAG GAG TTT GAC ACA ATG | 244 | 65 |
| Tau | Rev | CCT TCT TGG TCT TGG AGC ATA GTG | 308 | |
| SPTLC-1 | For | CTAACCTTGGGCAAATCGAA | 2581 | 96 |
| SPTLC-1 | Rev | TGAGCAGGGAGAAGGGACTA | 2676 | |
| SPTLC-2 | For | GGA CAG TGT GTG GCC TTT CT | 1823 | 50 |
| SPTLC-2 | Rev | TCA CTG AAG TGT GGC TCC TG | 1872 | |
| CERS-1 | For | TGC GTG AAC TGG AAG ACT TG | 947 | 98 |
| CERS-1 | Rev | CTT CAC CAG GCC ATT CCT TA | 1044 | |
| CERS-2 | For | CTC TGC TTC TCC TGG TTT GC | 698 | 82 |
| CERS-2 | Rev | CCA GCA GGT AGT CGG AAG AG | 779 | |
| CERS-4 | For | CGA GGC AGT TTC TGA AGG TC | 1240 | 72 |
| CERS-4 | Rev | CCA TTG GTA ATG GCT GCT CT | 1311 | |
| CERS-5 | For | GAC AGT CCC ATC CTC TGC AT | 1254 | 92 |
| CERS-5 | Rev | GAG GTT GTT CGT GTG TGT GG | 1345 | |
| UGCG | For | GAT GCT TGC TGT TCA CTC CA | 2682 | 67 |
| UGCG | Rev | GCT GAG ATG GAA GCC ATA GG | 2748 | |
| SMPD-1 | For | CAG TTC TTT GGC CAC ACT CA | 1443 | 65 |
| SMPD-1 | Rev | CGG CTC AGA GTT TCC TCA TC | 1507 | |
| SMPD-3 | For | TCT GCT GCC AAT GTT GTC TC | 2704 | 98 |
| SMPD-3 | Rev | CCG AGC AAG GAG TCT AGG TG | 2801 |
*Abbreviations: IGF = insulin-like growth factor; IRS = insulin receptor substrate; ChAT = choline acetyltransferase; AChE = acetylcholinesterase; APP = amyloid precursor protein; SPTLC = serine palmitoyltransferase; CERS = ceramide synthase; UGCG = UDP-glucose ceramide glucosyltransferae; SMPD = sphingomyelin phosphodiesterase; bp = base pair.
Figure 1Cerebellar Degeneration in NDEA, HFD-Fed and NDEA+HFD Treated Rats. Long Evans rats were treated with 3 i.p. injections of vehicle or NDEA (N = 12/group) on alternate days beginning on P3. From P21 (weaning), rats were fed with high fat (60% of calories) or low fat (5% of calories) diets for 8 weeks, after which they were sacrificed to harvest cerebella for histopathological and immunohistochemical staining studies. Cerebella were preserved in Histofix and paraffin-embedded sections (8 microns) were stained with (A1-A4) Luxol fast blue, H&E. Adjacent sections were immunostained to detect (B1-B4) GFAP, (C1-C4) HNE, or (D1-D4) ubiquitin. Representative photomicrographs of cerebellar cortex from (A1-D1) LFD+vehicle treated controls, (A2-D2) LFD+NDEA treated, (A3-D3) HFD+vehicle treated, and (A4-D4) HFD+NDEA treated rats are shown. Immunohistochemical staining was performed using the ABC method, and revealed with DAB (brown precipitate)-see Experimental Procedures. Sections were lightly counterstained with Hematoxylin (blue) to help reveal the tissue architecture. Cerebellar layers: ml = molecular layer; pc = Purkinje cell layer; gc = granule cell layer; wm = white matter. Note focal pc loss in A2, and large zones of pc loss in A3 and A4. (Original Magnifications = 400×).
Effects of High Fat Diet and NDEA Exposure on Biomarkers of Insulin and IGF Resistance in the Cerebellum
| mRNA | LFD+VEH | LFD+NDEA | HFD+VEH | HFD+NDEA | F-Ratio | P-Value |
|---|---|---|---|---|---|---|
| AβPP | 7.007 | 3.129*ξ | 8.960 | 6.796 | 4.918 | 0.006 |
| ± 0.828 | ± 0.309 | ± 1.542 | ± 1.287 | |||
| Tau | 12.230 | 6.586**ξ | 11.230 | 7.284**ξ | 6.612 | 0.001 |
| ± 1.098 | ± 1.329 | ± 1.248 | ± 0.500 | |||
| AChE | 2.829 | 4.171 | 3.719 | 3.562 | ||
| ± 0.178 | ± 0.698 | ± 0.618 | ± 0.412 | |||
| ChAT | 0.701 | 0.780 | 0.519* | 0.485* | 3.524 | 0.020 |
| ± 0.045 | ± 0.122 | ± 0.039 | ± 0.037 | |||
| Insulin | 0.754 | 0.617 | 0.691 | 0.584* | 3.065 | 0.040 |
| ± 0.048 | ± 0.047 | ± 0.040 | ± 0.038 | |||
| IGF-1 | 0.957 | 0.717 | 0.558 | 0.630 | ||
| ± 0.119 | ± 0.179 | ± 0.063 | ± 0.060 | |||
| IGF-2 | 12.000 | 15.460 | 17.930 | 11.140 | ||
| ± 1.800 | ± 4.684 | ± 6.163 | ± 2.453 | |||
| Insulin R | 17.090 | 7.59***ξ | 16.590 | 16.170 | 9.824 | < 0.001 |
| ± 1.547 | ± 0.808 | ± 1.572 | ± 1.685 | |||
| IGF-1R | 5.031 | 4.331 | 3.052 | 4.511 | ||
| ± 0.525 | ± 0.982 | ± 0.297 | ± 0.392 | |||
| IGF-2R | 5.677 | 2.641** ξ | 5.289 | 4.797 | 6.201 | 0.002 |
| ± 0.548 | ± 0.432 | ± 0.693 | ± 0.466 | |||
| IRS-1 | 5.559 | 4.167 | 3.254** | 5.276 | 4.532 | 0.009 |
| ± 0.411 | ± 0.725 | ± 0.207 | ± 0.505 | |||
| IRS-2 | 7.701 | 4.834* | 5.278 | 7.571 | 3.403 | 0.028 |
| ± 0.509 | ± 0.934 | ± 0.286 | ± 1.198 | |||
| IRS-4 | 0.135 | 0.104 | 0.119 | 0.091 | ||
| ± 0.022 | ± 0.024 | ± 0.019 | ± 0.017 |
Gene expression was measured by qRT-PCR with results normalized to 18S rRNA (see Methods). Values correspond to mRNA/18S × 10-6. Inter-group comparisons were made using ANOVA and the post-hoc Bonferroni multiple comparison test. For all measurements, df = 3/36. Asterisks (*P < 0.05; **P < 0.01; ***P < 0.001) reflect significant differences relative to LFD controls. ξ = significant differences as follows: AβPP: P < 0.05 vs HFD+VEH and HFD+NDEA; Tau: P < 0.01 vs HFD+VEH; ChAT: P < 0.05 vs LFD+NDEA; Insulin R: P < 0.001 vs HFD+VEH and HFD+NDEA; IGF-2R: P < 0.001 vs HFD+VEH and HFD vs NDEA; IRS-1: P < 0.01 vs HFD+NDEA and P < 0.05 vs LFD+NDEA.
Figure 3Effect of HFD feeding on molecular indices of oxidative stress and neurodegeneration. Cerebellar protein homogenates were used to measure (A) GSK-3β; (B) phospho (p)-GSK-3β; (C) GFAP; (D) GAPDH; (E) HNE; (F) malondialdehyde, MDA; (G) Nitrotyrosine, N-TYR; or (H) β-Actin; by direct binding ELISA. Immunoreactivity was detected with HRP-conjugated secondary antibody and Amplex Red soluble fluorophor. Fluorescence light units (FLU) were measured (Ex 579 nm/Em 595 nm) in a Spectromax M5, and results were normalized to sample protein content in the wells. Box plots depict mean, range ± S.D. of results (N = 8-10/group). Inter-group comparisons were made using ANOVA with the post-hoc Bonferroni multiple comparisons test of significance. Significant P-values are indicated within the panels.
Figure 4Effect of HFD feeding on pro-ceramide gene expression in brain. Total RNA extracted from cerebellar tissue was reverse transcribed using random oligodeoxynucleotide primers, and the resulting cDNA templates were used in qRT-PCR assays to measure (A) Ceramide synthase (CER)1, (B) CER2, (C) CER4, (D) CER5, (E) UDP-glucose ceramide glycoysltransferase (UGCG), (F) sphingomyelin phosphodiesterase 1 (SMPD1), (G) SMPD3, (H) Serine palmitoyltransferase 1 (SPTLC1), and (I) SPTLC2. The mRNA levels were normalized to 18S rRNA measured in the same templates. Graphs depict the mean, range ± S.D. of gene expression levels (N = 8 per group). Inter-group comparisons were made using ANOVA with the post-hoc Bonferroni multiple comparisons test of significance. Significant P-values are indicated within the panels.
High Fat Diet Feeding and NDEA Treatment Cause Type 2 Diabetes Mellitus
| Assay | LFD+VEH | LFD+NDEA | HFD+VEH | HFD+NDEA | F-Ratio | P-Value |
|---|---|---|---|---|---|---|
| Body Wt (g) | 265.100 | 266.600 | 315.300 | 308.400 | 3.42 | 0.04 |
| ± 14.050 | ± 19.970 | ± 5.794 | ± 15.110 | |||
| Glucose (mg/dL) | 111.5 | 128.8* | 137.6*** | 150.8*** ξ | 18.2 | < 0.0001 |
| ± 1.66 | ± 4.31 | ± 2.39 | ± 4.69 | |||
| Insulin (ng/ml) | 0.0611 | 0.163* | 0.324** | 0.581*** ξ | 22.69 | < 0.0001 |
| ± 0.017 | ± 0.038 | ± 0.074 | ± 0.060 | |||
| Leptin | 4.649 | 4.775 | 11.49***ξ | 15.73***ξ | 37.22 | < 0.0001 |
| ± 0.789 | ± 0.386 | ± 0.678 | ± 1.473 | |||
| Adiponectin | 20864 | 25195 | 16819 ξ | 26635 | 3.36 | 0.048 |
| ± 1454 | ± 3019 | ± 1254 | ± 1962 | |||
| Triglyceride (mg/ml) | 0.399 | 0.424 | 0.173*** ξ | 0.231*** ξ | 38.2 | < 0.0001 |
| ± 0.028 | ± 0.005 | ± 0.011 | ± 0.032 | |||
| Free Fatty Acids (mM/mg prot) | 0.150 | 0.114* | 0.081*** ξ | 0.063*** ξ | 21.9 | < 0.0001 |
| ± 0.003 | ± 0.018 | ± 0.002 | ± 0.010 | |||
| Cholesterol (mg/ml) | 0.943 | 0.986 | 0.552***ξ | 0.748***ξ | 6.53 | 0.004 |
| ± 0.024 | ± 0.112 | ± 0.051 | ± 0.093 |
Serum samples obtained at sacrifice and after an over-night fast were studied. Inter-group comparisons were made using ANOVA with Bonferroni's Multiple Comparison Tests. For all measurements, df = 3/36. Asterisks reflect significant differences relative to the LFD+ Vehicle-treated (VEH) control group (*P < 0.05; **P < 0.01; ***P < 0.001 relative to LFD+VEH). ξ = significant differences as follows: Glucose: P < 0.05 vs LFD+NDEA; Insulin: P < 0.001 vs LFD+NDEA; Adiponectin: P < 0.05 vs HFD+NDEA; Triglyceride: P < 0.001 vs LFD+NDEA; FFA: P < 0.001 vs LFD+NDEA; Cholesterol: P < 0.001 vs LFD+NDEA.