Literature DB >> 20102614

Molecular evidence for the occurrence of a new sibling species within the Anopheles (Kerteszia) cruzii complex in south-east Brazil.

Luísa D P Rona1, Carlos J Carvalho-Pinto, Alexandre A Peixoto.   

Abstract

BACKGROUND: Anopheles cruzii (Diptera: Culicidae) has long been known as a vector of human and simian malaria parasites in southern and south-eastern Brazil. Previous studies have provided evidence that An. cruzii is a species complex, but the status of the different populations and the number of sibling species remains unclear. A recent analysis of the genetic differentiation of the timeless gene among An. cruzii populations from south and south-east Brazil has suggested that the population from Itatiaia, Rio de Janeiro State (south-east Brazil), is in a process of incipient speciation.
METHODS: A ~180 bp fragment of cpr, a gene encoding the NADPH-cytochrome P450 reductase, an enzyme involved in metabolic insecticide resistance and odorant clearance in insects, was used in this study as a molecular marker to analyse the divergence between five An. cruzii populations from south and south-east Brazil.
RESULTS: Analysis of the genetic differentiation in the cpr gene revealed very high FST values and fixed differences between Itatiaia and the other four populations studied (Florianópolis, Cananéia, Juquitiba and Santa Teresa). In addition, the data also provided preliminary evidence that seems to indicate the occurrence of two sympatric sibling species in Itatiaia.
CONCLUSIONS: Population genetics analysis of An. cruzii samples from different localities using a fragment of the cpr gene suggests that the Itatiaia sample represents at least one new sibling species in this complex.

Entities:  

Mesh:

Substances:

Year:  2010        PMID: 20102614      PMCID: PMC2825240          DOI: 10.1186/1475-2875-9-33

Source DB:  PubMed          Journal:  Malar J        ISSN: 1475-2875            Impact factor:   2.979


Background

Anopheles cruzii has long been known as a vector of human and simian malaria parasites in southern and south-eastern Brazil [1,2]. This species, which belongs to the subgenus Kerteszia, is found from the coast of Rio Grande do Sul State in southern Brazil to Sergipe State in north-eastern Brazil [3,4], all along the Brazilian Atlantic forest. This forest provides an excellent environment for An. cruzii, since it is an ecosystem abundant in bromeliads, the larval habitat for this anopheline [2,5,6]. The possibility that An. cruzii could represent more than a single species was first supported by morphological differences observed among populations from the states of Santa Catarina and Rio de Janeiro [3]. Later it was revealed that An. cruzii is polymorphic for chromosome rearrangements [7,8]. Differences in inversion frequencies and X chromosome banding patterns from populations in south-eastern and southern Brazil have suggested a process of incipient speciation [9,10]. Malafronte et al [11] compared sequences of ITS2 (Internal Spacer Region 2) from several An. cruzii populations from south and south-east Brazil and found differences between sequences from different localities, although they considered premature to conclude based on their results that there are distinct sibling species in the areas investigated. Similar results were observed by Calado et al [12], using PCR-RAPD and PCR-RFLP of the ITS2 region. Finally, isoenzyme analysis indicated two genetically isolated groups, one from Bahia State (north-eastern Brazil), and the other from south-eastern and southern Brazil (Rio de Janeiro, São Paulo and Santa Catarina States) [13]. Supporting the isoenzyme results, analysis of the molecular polymorphism and genetic differentiation of the timeless gene among Brazilian populations of An. cruzii also indicated two cryptic species, one occurring in the north-east (Bahia State) and another in south and south-east Brazil (Espírito Santo, Rio de Janeiro, São Paulo and Santa Catarina States). In addition, the timeless gene sequences also suggested that populations from the south and south-east regions might also constitute different incipient species within this complex in Brazil [14]. Since previous X chromosome analyses suggested the existence of sibling species in these Brazilian regions [9,10], it would be interesting to analyse the same populations with an X-linked molecular marker to see whether a higher level of differentiation is found. The gene encoding the NADPH-cytochrome P450 reductase (CPR) has been cloned from several insect species [15-17]. In Anopheles gambiae, this protein is encoded by a single copy gene located on the X chromosome [17,18]. Previous studies have shown that the cytochrome P450 gene family, which is involved in metabolic insecticide resistance, requires CPR to function [19,20]. Additionally, knockdown of CPR expression increases An. gambiae sensitivity to the insecticide permethrin [21]. Another putative function associated with CPR in insects is odorant clearance, since the cpr gene is highly expressed in the antennae of the fruit fly Drosophila melanogaster and more specifically at the base of olfactory sensilla in the moth Mamestra brassicae [16,22]. Olfactory cues are important environmental stimuli affecting mosquito behaviour, playing significant roles in the location of food sources, mates and oviposition sites [23]. Therefore, genes involved in the regulation of antennal response to pheromones can be potentially important in maintaining sexual isolation between closely related species, and in this case, the CPR would be an interesting molecular marker for population studies of the An. cruzii complex. In this study, an analysis of intraspecific variability and genetic divergence among five Brazilian populations of An. cruzii was carried out using a fragment of the cpr gene.

Methods

The mosquitoes used in this study were females captured at different localities along the Brazilian Atlantic forest and identified on the basis of their morphology according to Consoli and Lourenço-de-Oliveira [4]. A total of 56 individuals were used for the molecular analysis: 14 from Florianópolis, Santa Catarina State (SC) (27°31'S/48°30'W), 12 from Cananéia, São Paulo State (SP) (25°01'S/47°55'W), 12 from Juquitiba, São Paulo State (SP) (23°57'S/47°03'W), 11 from Itatiaia, Rio de Janeiro State (RJ) (22°27'S/44°36'W) and 7 from Santa Teresa, Espírito Santo State (ES) (19°56'S/40°35'W) (Figure 1).
Figure 1

. Localities where the five Brazilian An. cruzii populations were collected (Source: IBGE).

. Localities where the five Brazilian An. cruzii populations were collected (Source: IBGE). For the isolation of a fragment of the An. cruzii cpr gene, initially a pair of degenerated primers was designed based on conserved regions of the CPR proteins from Drosophila melanogaster, Drosophila pseudoobscura, Musca domestica, Aedes aegypti and An. gambiae (Table 1 and Additional file 1). These primers, named here 5'Cpr01deg and 3'Cpr01deg, were used in PCR with An. cruzii genomic DNA extracted according to Jowett [24]. PCR was carried out with an Eppendorf Mastercycler® thermocycler using the following conditions: 15 cycles at 94°C for 60 s, 50°C (decreasing 1°C/cycle) for 90 s and 72°C for 60 s, followed by 20 cycles of 94°C for 60 s, 50°C for 90 s and 72°C for 60 s. PCR products were then purified and cloned using Zero Blunt TOPO PCR cloning kit (Invitrogen).
Table 1

Sequence of primers used to amplify the cpr gene fragments

Primer namesSequence of primers (5' → 3')
5'Cpr01degATGAARGGNATGGTNGCNGA (forward)
3'Cpr01degATCCARTCRTARAAYTCCAT (reverse)
5'cpr01ancruziiAGTGTAATATGGTAAGCG (forward)
3'cpr01ancruziiGATTTCTCGATGTCTTTCAG (reverse)

Degenerate and specific primers used to amplify the cpr gene fragments in all Anopheles cruzii populations.

Sequence of primers used to amplify the cpr gene fragments Degenerate and specific primers used to amplify the cpr gene fragments in all Anopheles cruzii populations. Sequencing of positive clones was carried out in an ABI Prism 3730 DNA sequencer (PDTIS-FIOCRUZ DNA sequencing facility) using the ABI Prism Big Dye Terminator Cycle Sequencing Ready Reaction kit (Applied Biosystems). The identity of the cloned fragments was confirmed by BlastX analysis using the GenBank [25]. Based on these initial sequences, two new specific primers named 5'cpr01ancruzii and 3'cpr01ancruzii (Table 1 and Additional file 1) were designed to amplify a ~180 bp fragment of the An. cruzii cpr gene from individual mosquitoes of the different localities listed above. This short fragment includes an intron of variable size (see below) and two small segments of the flanking exons (Additional file 1). PCR amplification using the specific primers was carried out for 35 cycles at 94°C for 30 s, 50°C for 60 s and 72°C for 90 s using the proofreading Pfu DNA polymerase (Biotools). PCR fragments were cloned using either Zero Blunt TOPO PCR cloning kit (Invitrogen) or pMOS Blue vector blunt-ended cloning kit (GE Healthcare) and at least eight clones of each mosquito were sequenced. Sequences were edited and in most cases consensus sequences representing the two alleles were generated. In a number of individuals only one haplotype was observed among the eight sequences and in these cases the mosquitoes were classified as homozygotes. The probability of incorrectly classifying a heterozygote as a homozygote individual with this procedure is less than 1%. Eight homozygotes were found in Florianópolis, four in Cananéia, seven in Juquitiba, three in Itatiaia and two in Santa Teresa. The sequences from homozygote mosquitoes were duplicated prior to analysis. However, the analysis was also carried out without duplicating the homozygote sequences with similar results. The cpr sequences were aligned using ClustalX software [26] and the population genetics analysis was carried out using DNASP4.0 [27], PROSEQv 2.91 [28] and Arlequin 3.0 [29] softwares. The haplotype network was estimated using TCS1.21 [30].

Results

Polymorphism and divergence among An. cruzii populations

A total of 112 sequences were obtained (28 from Florianópolis, 24 from Cananéia, 24 from Juquitiba, 22 from Itatiaia and 14 from Santa Teresa). The sequences were submitted to the GenBank (accession numbers: GU072619 - GU072730). An alignment of the variable sites in shown in Figure 2 (an alignment of the whole sequences is presented in Additional file 2). The small segments of the flanking exons in this cpr fragment are totally conserved among the five populations analysed. Therefore, all base substitutions occurred in the intron which also shows a number of indels, including three polymorphic dinucleotide repetitions (Figure 2 and Additional file 2). Table 2 shows the number of copies of each dinucleotide repeat in all An. cruzii populations. In Itatiaia only one repeat of CG dinucleotide was found, while in the other four populations there are two or three repeats. Similar pattern was observed for the CT repeat which shows four copies in Itatiaia while there are six to nine in the other populations (Table 2).
Figure 2

Alignment of the variable sites in the . Alignment of the variable positions in the DNA sequences from the cpr gene fragment from all populations of An. cruzii analysed. The sequences of homozygote individuals were grouped and are represented as a/b. Dots represent the identity of the first nucleotide sequence and asterisks represent the identity of all sequences. Flo: individuals from Florianópolis; Can: Cananéia; Juq: Juquitiba; Ita: Itatiaia; San: Santa Teresa.

Table 2

Number of each dinucleotide repeats in An. cruzii populations.

N° of alleles in each population
FlorianópolisCananéiaJuquitibaSanta TeresaItatiaia

CG01 repeat----22
02 repeats28242408-
03 repeats---06-

AG02 repeats---07-
03 repeats2415210509
04 repeats-0102-01
05 repeats----07
06 repeats---0105
07 repeats010501--
08 repeats02----
09 repeats0103-01-

CT04 repeats----22
06 repeats01----
07 repeats04132307-
08 repeats21100107-
09 repeats0201---

Location of each type of dinucleotide repeat (see Additional file 2): CG repeats at positions 22 to 27, uninterrupted AG repeats (excluding flanking repeats with point mutations) at positions 32 to 49 and CT repeats at positions 120 to 137.

Alignment of the variable sites in the . Alignment of the variable positions in the DNA sequences from the cpr gene fragment from all populations of An. cruzii analysed. The sequences of homozygote individuals were grouped and are represented as a/b. Dots represent the identity of the first nucleotide sequence and asterisks represent the identity of all sequences. Flo: individuals from Florianópolis; Can: Cananéia; Juq: Juquitiba; Ita: Itatiaia; San: Santa Teresa. Number of each dinucleotide repeats in An. cruzii populations. Location of each type of dinucleotide repeat (see Additional file 2): CG repeats at positions 22 to 27, uninterrupted AG repeats (excluding flanking repeats with point mutations) at positions 32 to 49 and CT repeats at positions 120 to 137. Table 3 shows the pair-wise estimates of population differentiation between the An. cruzii populations. Because this cpr fragment contains a number of indels, the Fvalues were calculated in two different ways. In the first one (F) the gaps were treated as single mutations in the analysis performed with the PROSEQv 2.91 software. In the second one (F), the Arlequin 3.0 software was used to calculate the differentiation values considering the three types of dinucleotide repeats as microsatellite loci. In all cases the Fvalues were significant and the two types of estimates showed similar results in most cases. Very high Fvalues (ranging from ~0.6 to 0.8) were found between Itatiaia and the other populations. Albeit significant, the pair-wise Fvalues in the comparisons among the samples of Florianópolis, Cananéia and Santa Teresa are usually under 0.2, while those between Juquitiba and the other three populations are moderately high.
Table 3

Genetic differentiation between An. cruzii populations

PopulationsFST(1)P-valueFST(2)P-valueDxyDaSsSfS1S2
1. Florianópolis × Cananéia0.08450.0130.14450.0040.02200.002907000302
2. Cananéia × Santa Teresa0.18110.0000.18270.0070.03390.006104000507
3. Florianópolis × Santa Teresa0.15750.0000.31960.0000.03070.007504000607
4. Cananéia × Juquitiba0.26730.0000.20080.0000.02160.006406000302
5. Santa Teresa × Juquitiba0.26610.0000.42670.0000.02960.010404000704
6. Florianópolis × Juquitiba0.36160.0000.52380.0000.02310.012605000503
7. Cananéia × Itatiaia0.61050.0000.66270.0000.05970.036203040607
8. Santa Teresa × Itatiaia0.65570.0000.59800.0000.06300.035502030908
9. Florianópolis × Itatiaia0.68120.0000.73550.0000.05640.037502040808
10. Juquitiba × Itatiaia0.77100.0000.80780.0000.06180.047002040608

F, pair-wise estimates of population differentiation (see text for more details); P-value, significance of Fvalues (evaluated by 1,000 random permutations). D, average number of nucleotide substitutions per site between populations [39]; D, number of net nucleotide substitutions per site between populations [39]. S1, number of polymorphic sites exclusive to the first population shown in the first column. S2, number of polymorphic sites exclusive to the second population shown in the first column. S, number of shared polymorphisms between the two populations. Sf, number of fixed differences between the two populations. These values were calculated with PROSEQ v 2.91 [28] using the alignment shown in Additional file 2 and considering the gaps as single mutations.

Genetic differentiation between An. cruzii populations F, pair-wise estimates of population differentiation (see text for more details); P-value, significance of Fvalues (evaluated by 1,000 random permutations). D, average number of nucleotide substitutions per site between populations [39]; D, number of net nucleotide substitutions per site between populations [39]. S1, number of polymorphic sites exclusive to the first population shown in the first column. S2, number of polymorphic sites exclusive to the second population shown in the first column. S, number of shared polymorphisms between the two populations. Sf, number of fixed differences between the two populations. These values were calculated with PROSEQ v 2.91 [28] using the alignment shown in Additional file 2 and considering the gaps as single mutations. Table 3 also shows the average number of nucleotide substitutions per site (D), the number of net nucleotide substitutions per site between populations (D) and the distribution of the four mutually exclusive categories of segregating sites observed in each comparison: the number of exclusive polymorphisms for each population (Sand S), the number of shared polymorphisms (S) and the number of fixed differences (S). As in the case of the F, the highest Dand Dvalues are those involving the Itatiaia population. In addition, this sample shows few shared polymorphisms and it is the only one presenting fixed differences in comparisons with the other populations.

Genealogy of the An. cruzii cpr sequences

A network of genealogical relationships of An. cruzii haplotypes was estimated using the method of Templeton et al [31] available in the TCS programme (Figure 3). Gaps were treated as a 5th state. A network was also estimated ignoring the gaps, but in this case much of the divergence among the sequences was lost and the network was not informative. The haplotype network shows that the Itatiaia population is clearly separated in an isolated group. A less clear separation was found among the sequences of the other populations.
Figure 3

Haplotype network of . Each colour represents one population of An. cruzii. Each circle represents a different haplotype with size proportional to its relative frequency. Haplotype numbers are given in Roman and the number of sequences of each haplotype is given in brackets. The small white circles represent missing intermediates and the lines connecting the haplotypes represent one mutational step between two observed haplotypes. Each individual of Itatiaia population is discriminated next to the respective haplotype.

Haplotype network of . Each colour represents one population of An. cruzii. Each circle represents a different haplotype with size proportional to its relative frequency. Haplotype numbers are given in Roman and the number of sequences of each haplotype is given in brackets. The small white circles represent missing intermediates and the lines connecting the haplotypes represent one mutational step between two observed haplotypes. Each individual of Itatiaia population is discriminated next to the respective haplotype.

Divergence between Itatiaia A and Itatiaia B

Inspection of the cpr sequences presented in Figure 2 and Additional file 2 suggests that the Itatiaia sample might include two different sets of individuals. Based on the number of uninterrupted AG repeats between positions 32 to 49 (Figure 2) the Itatiaia population was divided in two groups: the first one, called henceforth Itatiaia A, has more than three AG repeats (04 to 06 repeats) and the second, called henceforth Itatiaia B, has exactly three AG repeats (Table 2). According to this classification the individuals Ita2, Ita3, Ita4, Ita8, Ita10 and Ita11 belong to Itatiaia A (genotype "4-6/4-6"), the mosquitoes Ita5, Ita6, Ita7 and Ita9 belong to Itatiaia B (genotype "3/3") and individual Ita12 is the only "hybrid" between the two groups (genotype "3/4-6"). Therefore, the Itatiaia sample is not in Hardy-Weinberg equilibrium (X2 = 7.24; d.f. = 1; P < 0.01) suggesting the possibility that two sympatric sibling species might exist in this locality. The separation between the two groups is also evident in Figure 3. Besides, the Fvalue (considering gaps as single mutations) between Itatiaia A and B is quite large (0.6678) and highly significant (P < 0.001) despite the small sample sizes. Finally, to test the hypothesis that the Itatiaia population might include two different sympatric sibling species, the recently published timeless data [14] from the same sample were reanalysed. As for the cpr data, the timeless sequences were divided into Itatiaia A (Ita2, Ita3, Ita4, Ita8, Ita10 and Ita11) and Itatiaia B (Ita5, Ita6, Ita7 and Ita9). The timeless gene also suggests that the sequences might belong to two different sibling species with a Fvalue (0.3418) that is highly significant (P < 0.001) and the occurrence of two fixed differences. There is also a clear separation between the Itatiaia A and B timeless sequences in a haplotype network (Additional file 3).

Discussion

The X chromosome seems to be enriched in genes that cause reproductive isolation between species in the genus Drosophila [32]. In addition, many sibling species including the An. gambiae complex are outcomes of recent speciation processes associated with paracentric inversions involving this chromosome [33]. The X chromosome banding patterns and inversion frequencies studies of Brazilian south and south-east An. cruzii populations, showed three X chromosomal forms (A, B and C), suggesting a process of incipient speciation [9,10]. The authors observed that the majority of mosquitoes from Juquitiba population had form A, while form B predominated in Cananéia [9,10]. In the current study, although there are no fixed differences in the cpr gene between Juquitiba and Cananéia, a moderately high Fvalue was observed. In An. gambiae, cpr is located on the X chromosome. Therefore, if this molecular marker has a similar chromosomal location in An. cruzii, it might be associated with the chromosomal forms described by Ramirez & Dessen [9,10]. Comparisons of the Fvalues observed with cpr and timeless in all pair-wise comparisons involving the five populations analysed in the current study and in Rona et al [14] show only a partial consistence but this is expected. Wang-Sattler et al [34] demonstrated that the phylogenetic relationships in the An. gambiae complex could vary widely between different genomic regions, thus indicating the mosaic nature of the genome of these species [34]. As mentioned above the cpr gene in An. gambiae is X-linked, while timeless is autosomal. Assuming these two markers have similar locations in An. cruzii, cpr is expected to be under more efficient selection than the timeless, since in species with X/Y sex determination, as An. cruzii, rare recessive mutations are fully expressed in the heterogametic sex, which could lead to 'faster-X evolution' if a large proportion of mutations are fixed by positive selection [35]. If positive selection is more efficient on the X chromosome, one expects it to harbour less variability than the autosomes [36]. The X chromosome is indeed less variable than the autosomes in non-African populations of Drosophila simulans [37]. Comparing timeless and cpr, the first is more polymorphic than the latter, but the latter shows higher differentiation among the southern populations of An. cruzii. Since An. cruzii is polymorphic for chromosomal inversions and Ramirez & Dessem [9,10] found evidence for sibling species carrying different X chromosomal forms, another hypothesis that might explain the differences between the two markers is the suppressed-recombination model of speciation proposed by Coluzzi [33,38]. Analysis of the molecular polymorphism and genetic differentiation of the timeless gene among Brazilian populations of An. cruzii suggested that the population from Itatiaia (Rio de Janeiro State) is in a process of differentiation and incipient speciation [14]. High Fvalues between Itatiaia (Rio de Janeiro State) and the other populations from south and south-east Brazil was reported here. In addition, comparison of Itatiaia with other populations revealed some fixed differences and only a few shared polymorphisms. Moreover, the haplotype network shows that Itatiaia is clearly separated in an isolated group (Figure 3). These results, therefore, suggest that this population represents a different species in the An. cruzii complex. Preliminary evidence was also presented here that raised the possibility of the existence of two different sympatric incipient species in Itatiaia. This is based on the analysis of the genetic differentiation of the cpr gene and a reanalysis of the recently published timeless data [14]. Although a putative heterozygote was found in cpr analysis considering the AG repeats and shared polymorphisms were observed in timeless, high Fvalues were detected between Itatiaia A and Itatiaia B in these two molecular markers, as well as fixed differences which seem to indicate that these two groups might represent different incipient species. Inspection of the neighbour-joining tree presented in the timeless study [14] reveals that the individuals classified here as Itatiaia A are clearly isolated in a separated branch. However, the individuals classified as Itatiaia B are mixed with the other individuals from south and south-east populations. In that study, only one putative heterozygote was found (Ita01) carrying alleles of the two Itatiaia groups. Unfortunately this DNA sample was lost and therefore it was not possible to analyse the cpr gene of this individual mosquito. The sample sizes available for the two Itatiaia groups are quite small and further work is clearly needed to determined beyond any doubt that two sympatric incipient sibling species exist in this locality but the results presented here seems to indicate that might be the case. Analysis of a number of other molecular markers will allow a more precise estimate of the Itatiaia population differentiation and might provide a more complete representation of the divergence history of this species complex.

Conclusions

Evidence was presented here suggesting the existence of at least one new sibling species within the Anopheles (Kerteszia) cruzii complex in Itatiaia, south-east Brazil, a finding that supports a previous timeless gene study. In addition, according to cpr and timeless gene analyses, the Itatiaia sample might be in fact composed by two sympatric incipient species, named here Itatiaia A and Itatiaia B.

Competing interests

The authors declare that they have no competing interests.

Authors' contributions

LDPR participated in data generation and analysis, and drafted the manuscript. She also helped capture mosquitoes in Florianópolis. CJCP carried out the capture and morphological identification of mosquitoes collected in Florianópolis. AAP is the principal investigator, participated in its design and coordination, and helped to write the manuscript. All authors read and approved the final manuscript.

Additional file 1

CPR protein multiple alignment and primer positions. The putative fragment of An. cruzii CPR deduced protein is aligned with D. melanogaster, D. pseudoobscura, M. domestica, An. gambiae and Ae. aegypti homologues. Arrows point to the approximated positions of the primers used in this study. The inverted triangle represents the position of the intron. Click here for file

Additional file 2

Alignment of the . Alignment of the DNA sequences from the cpr gene fragment from all populations of An. cruzii analysed. The translated amino acid sequence is shown above the alignment and the intron is highlighted in grey. Dots represent identity and dashed represent gaps. The asterisks in the bottom line represent identity of all sequences. Flo: individuals from Florianópolis; Can: Cananéia; Juq: Juquitiba; Ita: Itatiaia; San: Santa Teresa. Click here for file

Additional file 3

Haplotype network using . Each circle represents a different haplotype with size proportional to its relative frequency. Haplotype numbers are given in Roman and the number of sequences of each haplotype is given in brackets. The small white circles represent missing intermediates and the lines connecting the haplotypes represent one mutational step between two observed haplotypes. Each individual of Itatiaia population is discriminated next to respective haplotype. Click here for file
  29 in total

1.  Chromosomal evidence for sibling species of the malaria vector Anopheles cruzii.

Authors:  C C Ramírez; E M Dessen
Journal:  Genome       Date:  2000-02       Impact factor: 2.166

2.  [Ecological limitation of Anopheles of the Subgenus Kerteszia in the coastal region of Southern Brazil].

Authors:  H P VELOSO; J V DE MOURA; R M KLEIN
Journal:  Mem Inst Oswaldo Cruz       Date:  1956-12       Impact factor: 2.743

Review 3.  Evolution on the X chromosome: unusual patterns and processes.

Authors:  Beatriz Vicoso; Brian Charlesworth
Journal:  Nat Rev Genet       Date:  2006-08       Impact factor: 53.242

4.  DNA polymorphism, haplotype structure and balancing selection in the Leavenworthia PgiC locus.

Authors:  D A Filatov; D Charlesworth
Journal:  Genetics       Date:  1999-11       Impact factor: 4.562

5.  Dissection of NADPH-cytochrome P450 oxidoreductase into distinct functional domains.

Authors:  G C Smith; D G Tew; C R Wolf
Journal:  Proc Natl Acad Sci U S A       Date:  1994-08-30       Impact factor: 11.205

6.  Anopheles (Kerteszia) cruzi, a natural vector of the monkey malaria parasites, Plasmodium simium and Plasmodium brasilianum.

Authors:  L M Deane; J A Ferreira Neto; S P Deane; I P Silveira
Journal:  Trans R Soc Trop Med Hyg       Date:  1970       Impact factor: 2.184

7.  Drosophila melanogaster NADPH-cytochrome P450 oxidoreductase: pronounced expression in antennae may be related to odorant clearance.

Authors:  B T Hovemann; F Sehlmeyer; J Malz
Journal:  Gene       Date:  1997-04-21       Impact factor: 3.688

Review 8.  Odor-mediated behavior of Afrotropical malaria mosquitoes.

Authors:  W Takken; B G Knols
Journal:  Annu Rev Entomol       Date:  1999       Impact factor: 19.686

9.  Isoenzimatic analysis of four Anopheles (Kerteszia) cruzii (Diptera: Culicidae) populations of Brazil.

Authors:  Carlos José de Carvalho-Pinto; Ricardo Lourenço-de-Oliveira
Journal:  Mem Inst Oswaldo Cruz       Date:  2004-11-03       Impact factor: 2.743

10.  Mosaic genome architecture of the Anopheles gambiae species complex.

Authors:  Rui Wang-Sattler; Stephanie Blandin; Ye Ning; Claudia Blass; Guimogo Dolo; Yeya T Touré; Alessandra delle Torre; Gregory C Lanzaro; Lars M Steinmetz; Fotis C Kafatos; Liangbiao Zheng
Journal:  PLoS One       Date:  2007-11-28       Impact factor: 3.240

View more
  10 in total

1.  Comparative analysis of the circadian rhythm genes period and timeless in Culex pipiens Linnaeus, 1758 (Diptera, Culicidae).

Authors:  Elena V Shaikevich; Ludmila S Karan; Marina V Fyodorova
Journal:  Comp Cytogenet       Date:  2016-10-10       Impact factor: 1.800

2.  Anopheles (Kerteszia) lepidotus (Diptera: Culicidae), not the malaria vector we thought it was: Revised male and female morphology; larva, pupa, and male genitalia characters; and molecular verification.

Authors:  Bruce A Harrison; Freddy Ruiz-Lopez; Guillermo Calderon Falero; Harry M Savage; James E Pecor; Richard C Wilkerson
Journal:  Zootaxa       Date:  2012-03-01       Impact factor: 1.091

3.  Molecular population genetics of the NADPH cytochrome P450 reductase (CPR) gene in Anopheles minimus.

Authors:  Hemlata Srivastava; Ngo Thi Huong; Uraiwan Arunyawat; Aparup Das
Journal:  Genetica       Date:  2014-07-20       Impact factor: 1.082

4.  Phylogeography of the neotropical Anopheles triannulatus complex (Diptera: Culicidae) supports deep structure and complex patterns.

Authors:  Marta Moreno; Sara Bickersmith; Wesley Harlow; Jessica Hildebrandt; Sascha N McKeon; Teresa Fernandes Silva-do-Nascimento; Jose R Loaiza; Freddy Ruiz; Ricardo Lourenço-de-Oliveira; Maria A M Sallum; Eduardo S Bergo; Gary N Fritz; Richard C Wilkerson; Yvonne M Linton; Maria J Dantur Juri; Yadira Rangel; Marinete M Póvoa; Lina A Gutiérrez-Builes; Margarita M Correa; Jan E Conn
Journal:  Parasit Vectors       Date:  2013-02-22       Impact factor: 3.876

5.  Brazilian Anopheles darlingi Root (Diptera: Culicidae) Clusters by Major Biogeographical Region.

Authors:  Kevin J Emerson; Jan E Conn; Eduardo S Bergo; Melissa A Randel; Maria Anice M Sallum
Journal:  PLoS One       Date:  2015-07-14       Impact factor: 3.240

Review 6.  Sex and rhythms in sandflies and mosquitoes: an appreciation of the work of Alexandre Afranio Peixoto (1963-2013).

Authors:  Charalambos P Kyriacou
Journal:  Infect Genet Evol       Date:  2014-07-19       Impact factor: 3.342

7.  Phylogeny of Anopheles (Kerteszia) (Diptera: Culicidae) Using Mitochondrial Genes.

Authors:  Karin Kirchgatter; Lilian de Oliveira Guimarães; Henrry Hugo Yañez Trujillano; Fernando Rafael Arias; Abraham Germán Cáceres; Ana Maria Ribeiro de Castro Duarte; Rosely Dos Santos Malafronte; Rosa Maria Tubaki; Maria Anice Mureb Sallum
Journal:  Insects       Date:  2020-05-24       Impact factor: 2.769

Review 8.  Atlantic Forest Malaria: A Review of More than 20 Years of Epidemiological Investigation.

Authors:  Julyana Cerqueira Buery; Filomena Euridice Carvalho de Alencar; Ana Maria Ribeiro de Castro Duarte; Ana Carolina Loss; Creuza Rachel Vicente; Lucas Mendes Ferreira; Blima Fux; Márcia Melo Medeiros; Pedro Cravo; Ana Paula Arez; Crispim Cerutti Junior
Journal:  Microorganisms       Date:  2021-01-08

9.  Evidence for the occurrence of two sympatric sibling species within the Anopheles (Kerteszia) cruzii complex in southeast Brazil and the detection of asymmetric introgression between them using a multilocus analysis.

Authors:  Luísa D P Rona; Carlos J Carvalho-Pinto; Alexandre A Peixoto
Journal:  BMC Evol Biol       Date:  2013-09-24       Impact factor: 3.260

10.  Cryptic diversity in an Atlantic Forest malaria vector from the mountains of South-East Brazil.

Authors:  Guilherme de Rezende Dias; Thais Tenorio Soares Fujii; Bernardo Fernandes Fogel; Ricardo Lourenço-de-Oliveira; Teresa Fernandes Silva-do-Nascimento; André Nóbrega Pitaluga; Carlos José Carvalho-Pinto; Antonio Bernardo Carvalho; Alexandre Afrânio Peixoto; Luísa Damazio Pitaluga Rona
Journal:  Parasit Vectors       Date:  2018-01-15       Impact factor: 3.876

  10 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.