Literature DB >> 20016673

Comprehensive and rapid real-time PCR analysis of 21 foodborne outbreaks.

Hiroshi Fukushima1, Kazunori Katsube, Yoshie Tsunomori, Ryoko Kishi, Junko Atsuta, Yuko Akiba.   

Abstract

A set of four duplex SYBR Green I PCR (SG-PCR) assay combined with DNA extraction using QIAamp DNA Stool Mini kit was evaluated for the detection of foodborne bacteria from 21 foodborne outbreaks. The causative pathogens were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne pathogens in 5 stool specimens within 2 hours and the second run was for the detection of other unusual suspect pathogens within a further 45 minutes. After 2 to 4 days, the causative agents were isolated and identified. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, Duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative pathogens in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreaks.

Entities:  

Year:  2009        PMID: 20016673      PMCID: PMC2775201          DOI: 10.1155/2009/917623

Source DB:  PubMed          Journal:  Int J Microbiol


1. Introduction

The introduction of real-time PCR in foodborne outbreak investigations provides an opportunity for rapid detection of pathogens in food and clinical settings [1]. The benefits to public health administration from rapid real-time PCR assays are most notable after comprehensive and rapid detection of bacteria. The results can quickly inform a public health administrator about the causative pathogens of foodborne outbreak, allowing a more accurate, effective, and timely response. Abubakar et al. [2] implied in the Health Technology Assessment program (now part of the National Institute for Health Research, UK) that the feasibility of conversion to rapid methods such as multiplex PCR and DNA microarrays is dependent on localized considerations, including the community prevalence rates for specific pathogens, the skill base, and subsequent training costs for laboratory staff and spare capacity available to ensure adequate laboratory space for new equipment. Although these tests look promising, further studies are necessary to assess their usefulness [2]. Apart from saving time, real-time PCR is sensitive, highly specific and offers the potential for quantification [3]. The risk of cross-contamination is significantly reduced, and high-throughput performance and automation are possible since no post-PCR manipulations are required [4]. In principle, two different chemistries are available for real-time detection of PCR products: fluorescent probes that bind specifically to certain DNA sequences and fluorescent dyes that intercalate into any double-stranded DNA. Fluorescent-probe based real-time PCR (TaqMan PCR) studies to detect causative pathogens from foodborne outbreaks in feces using TaqMan probes have been carried out [3-6]. TaqMan PCR assays require the availability of primers and probes that must be selected according to very rigid criteria. Use of simple, cheaper double-stranded DNA-binding dye SYBR green I for detection of PCR amplicons (SG-PCR) overcomes this limitation. Therefore, real-time PCR could be applied without the need for fluorescent probes [7]. In the absence of probes, the specificityof the reaction is determined on the basis of the melting temperature (T ). The advantages of SG-PCR over TaqMan PCR include the relative simplicity and reduced cost of SYBR Green I compared to TaqMan probes [8]. Recently, the application of SG-PCR for the detection of foodborne bacteria in different samples has been increased [1, 9–12]. Duplex SG-PCR assays have been carried out to detect causative bacteria in feces from foodborne outbreaks [4, 10, 13]. We previously reported a set of four duplex SG-PCR assays for one-step differentiation of 8 genes of foodborne pathogens in DNA extracted from 5 feces using 32 capillary tubes of LightCycler (Roche). The first run was for the detection of 8 main foodborne pathogens and the second run was for the other pathogens. We reported here that improved diagnostic duplex SG-PCR assays were upgraded with new highly sensitive primer pairs for 11 foodborne pathogens. These assays successfully identified the causative pathogens of foodborne outbreaks caused by enteropathogenic Escherichia coli, enterohemorrhagic E. coli, astA-positive E. coli, Plesiomonas shigelloides, Vibrio parahaemolyticus, Campylobacter jejuni, Clostridium perfringens, Bacillus cereus, or Staphylococcus aureus in 21 cases from 2002 to 2007. This assay is simple, rapid, inexpensive, reliable as well as suitable for comprehensive, rapid detection of causative pathogens in foodborne outbreaks.

2. Material and Methods

2.1. Bacterial Strains

The 27 foodborne bacteria used in this study are E. coli (enteroinvasive E. coli (EIEC), enteropathogenic E. coli (EPEC), enterohemorrhagic E. coli (EHEC), enterotoxigenic E. coli (ETEC), and enteroaggregative E. coli (EAEC)), Shigella sonnei, Salmonella Enteritidis, Yersinia enterocolitica, Yersinia pseudotuberculosis, Providencia alcalifaciens, Plesiomonas shigelloides, Campylobacter jejuni, C. coli, Vibrio cholerae, TDH-positive V. parahaemolyticus, TRH-positive V. parahaemolyticus, Aeromonas hydrophila, Staphylococcus aureus, emetic Bacillus cereus, enterotoxigenic B. cereus, and Clostridium perfringens (Table 1). Bacterial cultures and viable-cell counting were described in a previous report [10]. For template DNA of each foodborne pathogen as a PCR control, 200 μL of each bacterial culture (108 CFU/mL) was treated with a QIAamp DNA Stool Mini kit (Qiagen) in the same procedure as the following stool treatments.
Table 1

Bacterial strains assayed by SYBR Green I PCR.

Bacterial strainsSourcese PCR results with each primer set (see Table 2)
eaeJMS1JMS2LTSTaEAST-1aggR-ZvirAStyinvayadA-XPAGPSGABCC ceuEhlyAtdhtrhAHH1FemBces-TMSGGAP
Escherichia coli -EPECO55(eaeA)EC-2736b +
E. coli -EPEC O153 (eaeA and astA)EC-2649b ++
E. coli -EHEC O26:H11(Stx1)SE-02005++
E. coli -EHEC O157:H7 (Stx2)SE020025++
E. coli -EHEC O157:H7 (Stx1 and Stx2)SE-02027+++
E. coli -ETEC O148 (LT, ST and astA)EC-3515b +++
E. coli -ETEC O169 (ST and astA)EC-4725b ++
E. coli- EAEC O111 (aggR and astA)EC-4131b ++
E. coli -EIEC O124:HNM (virA)EA32a +
Shigella sonnei I00031+
Salmonella EnteritidisSal-2339+
Yersinia enterocolitica O3/B4Pa241+
Y. pseudotuberculosis O4bSP988+
Providencia alcalifaciens NIID124C +
Plesiomonas shigelloides NIID123C +
Campylobacter jejuni SC 009+
Campylobacter coli SC 011+
Vibrio cholerae O1ATCC14035+
V. cholerae O139NIID63-93C +
V. cholerae non- O1SVP84+
V. parahaemoliticus O3:K6 (tdh)SVP02+
V. parahaemoliticus O3:K6 (trh)NIIDK4C +
Aeromonas hydrophila O1ATCC7966+
Staphylococcus aureus SS 05e +
Emetic Bacillus cereus No.127e ++
Enterotoxigenic B. cereus No.1e +
Clostridium perfringens H2d +

Strain kindly donated by K. Sugiyamaa, Shizuoka Prefectural Institute of Public Health, Shizuoka; J. Yatsuyanagib, Akita Prefectural Institute of Public Health, Akita; M. Tamura and E. Arakawac, fOther strains except for ATCC numbers are our own collections.

2.2. Primer Design

The 22 primer pairs used in this study for the detection of E. coli (EIEC, EPEC, EHEC, ETEC, and EAEC), Salmonella enterica, Shigella spp., Y. enterocolitica, Y. pseudotuberculosis, P. alcalifaciens, C. jejuni, C. coli, V. cholerae, V. parahaemolyticus, A. hydrophila, P. shigelloides, S. aureus, C. perfringens, and B. cereus were described in our previous reports [10, 13] for cases 1 to 19. The newly designed 22 primer pairs listed in Table 2 were used for cases 19 to 21. In this study, 10 primer pairs (marked with * in Table 2) were newly designed or selected from earlier publications (see Table 2 references). The 4 primer pairs (ces, yadA-X, CCceuE, and aggR-Z) were newly designed. The ces primer was constructed from cereulide synthetase gene of emetic B. cereus [4], the yadA-X primer from yadA gene on the plasmid present in virulent Yersinia spp. [24], the CCceuE primer from ceuE gene encoding of a lipoprotein component of a binding-protein-dependent transport system for the siderophore enterochelin of C. coli [25], and the aggR-Z primer from aggR gene encoding of a transcriptional activator for EAEC aggregative adherence fimbria I expression [26]. To determine the specific primers ces, yadA-X, CCceuE, and aggR-Z, the genes of ces, yadA, ceuE, and aggR that were expected to be unique were selected with the Basic Local Alignment Search Tool (BLAST) program within GenBank and were designed by Biosearch Technologies Inc. (USA). Other primer pairs were those used in earlier publications (see Table 2 references). All oligonucleotide primers were synthesized by Invitrogen (Yokohama, Japan) or Biosearch Technologies Inc. (USA).
Table 2

22 pairs of specific primers for SYBR Green I PCR.

Primer set for duplex PCRSpecies and subgroupsTarget genePCR primersGenBank accession no.locationProduct size (bp) T m valuesa References
NameForward or reversprimers' sequences (5′ - 3′)
First run1 Escherichia coli eaeA b eae F2 CATTGATCAGGATTTTTCTGGTGATA Z11541899-92410683.2 ± 0.2[14]
EPEC and EHECR CTCATGCGGAAATAGCCGTTA 1000-979
Staphylococcus aureus femB FemBfw AATTAACGAAATGGGCAGAAACA AF106850277-2999380.8 ± 0.3[15]
rv TGCGCAACACCCTGAACTT 370-351
2 Campylobacter jejuni C. jejuni- specific DNAABF CTGAATTTGATACCTTAAGTGCAGC AL1111683811358679.1 ± 0.4[8]
DNAR AGGCACGCCTAAACCTATAGCT 381185
EAEC astA EAST-1S GCCATCAACACAGTATATCC L1124163-8210684.9 ± 0.6[16]
AS GAGTGACGGCTTTGTAGTCC 168-148
3 Vibrio parahaemoliticus tdh Tdh199F GGTACTAAATGGCTGACATC X54341601-58225181.6 ± 0.3[17]
R CCACTACCACTCTCATATGC 351-370
Emetic Bacillus cereus ces ces-TM F GATGTTTGCGACGATGCAA DQ3608258689-87076580.4 ± 0.1This study
R CTTTCGGCGTGATACCCATT 8793-8734
4 Salmonella spp. invA Styinva JHO-2-right TCGTCATTCCATTACCTACC M90846167-18611981.3 ± 0.4[5]
JHO-3-left AAACGTTGAAAAACTGAGGA 285-234
Clostridium perfringens cpe GAP11 GGTTCATTAATTGAAACTGGTG X81849583-60415478.3 ± 0.4[18]
12 AACGCCAATCATATAAATTACAGC 712-736

Second and third runs5 ETEC (ST)STSTaF GCTAATGTTGGCAATTTTTATTTCTGTA M25607294-32119078.5 ± 0.2[19]
R AGGATTACAACAAAGTTCACAGCAGTAA 483-456
Plesiomonas shigelloides gyrB PSG237-F TTCCAGTACGAGATCCTGGCTAA AJ300545237-2596883.1 ± 0.2[13]
304-R TGAATCGACACGCCAGAGTTC 304-284
6 EAggEC aggR aggR-Z F CAGAATCGTCAGCATCAGCTACA Z18751432-4549779.5 ± 0.3This study
R GATGCCCTGATGATAATATACGGAA 358-382
EIEC & Shigella spp. virA virAF CTGCATTCTGGCAATCTCTTCACA D264681589-162221582.4 ± 0.3[20]
R TGATGAGCTAACTTCGTAAGCCCTCC 1813-1788
7 Aeromonas hydrophila ahh1 AHH1F GCCGAGCGCCCAGAAGGTGAGTT CP0004621653360-8213389.8 ± 0.4[21]
R GAGCGGCTGGATGCGGTTGT 1653492-73
ETEC (LT)LTLT1 AGCAGGTTTCCCACCGGATCACCA S60731613-63613282.0 ± 0.3[22]
2 GTGCTCAGATTCTGGGTCTC 744-725
8 Providencia alcalifaciens gyrB PAG38F TCTGCACGGTGTGGGTGTT AJ30054738-567381.0 ± 0.2[13]
110R ACCGTCACGGCGGATTACT 110-92
Enterotoxigenic B. cereus nheB SGF3 GCACTTATGGCAGTATTTGCAGC DQ1532572101-212315282.7 ± 0.4[23]
R3 GCATCTTTTAAGCCTTCTGGTC 2252-2231
9 Yersinia enterocolitica yadA yadA-X F CCAGAACCAATTGCAATGCCT X138821564-154310081.6 ± 0.2This study
Y. pseudotuberculosis R CTTTAAACAGCTTGTTCCAGCCA 1465-148781.1 ± 0.3
Campylobacter coli ceuE CCceuE 825F ACGCGCACAAGGCATACTT X888493513-35319177.6 ± 0.3This study
915R CCAGTATTCAGGATCAAGATAAATGATTT 3603-3575
10 Vibrio cholerae hlyA hlyA2272-F AGCAGCGTGTGGGACAAGA X517462272-22917182.4 ± 0.1[13]
2272-F GCGGACCCTAATGCATCAAT 2342-2323
Vibrio parahaemoliticus trh Trh250-F GGCTCAAAATGGTTAAGCG DQ359748256-27425081.1 ± 0.1[17]
251-R CATTTCCGCTCTCATATGC 505-487
Singl PCREHEC (Stx 1) Stx1 JMS1F GTCACAGTAACAAACCGTAACA EF441598509-4889581.1 ± 1.0[12]
R TCGTTGACTACTTCTTATCTGGA 415-437
Singl PCREHEC (Stx 2) Stx2 JMS2F CGACCCCTCTTGAACATA EF441616140-15710881.7 ± 0.3[12]
R GATAGACATCAAGCCCTCGT 247-228

a: Average ± standard deviation of Tm values of 10 tests: b: ∗:new selected or designed primer

2.3. Duplex SG-PCR with Feces

Feces (1 g) from 5 patients were weighed aseptically from the mass sample collected for virological inspection, placed into sterile tubes, and homogenized with 9 mL of distilled water. Then, 200 μL of stool suspension was treated with a QIAamp DNA Stool Mini kit. For real-time PCR, we used SYBR Premix EX Taq (Takara, Japan), 32 glass capillary tubes, and a LightCycler instrument (Roche Diagnostics, Mannheim, Germany) as described by the manufacturer. Duplex SG-PCR was performed using 32 glass capillary tubes with 4 groups of 2 primer sets on the LC instrument for each run. Analysis of each group of primer pairs was made in 8 glass capillary tubes; each of which included 1 negative DNA control consisting of PCR-grade water, 2 positive controls, and template DNA from 5 feces. The first run of duplex SG-PCR was analyzed using 4 primer sets selected from 11 primer sets described in our previous reports [10, 13]. The newly first run primer set including eae plus FemB, AB plus EAST1, Tdh plus Ces-TM, and Styinva plus GAP (see Table 2) was used for analysis of cases 19 to 21. The second run was analyzed using 4 primer sets selected from the following primer sets: LT plus AHH1, STa plus PSG, aggR-Z plus virA, SG plus PAG and the third run using yadA-X plus CCceuE, and hlyA plus Trh. The eaeA-positive samples were analyzed by simple PCR using primers JMS1 and JMS2. Each reaction tube contained 10 μL of SYBR Premix EX Taq, 6.8 μL of PCR-grade H2O, 0.4 μL of both forward and reverse primers (10 μM) for the target gene of two foodborne pathogens, and 2 μL of template DNA in a 20 μL PCR mixture. The assay cycling profile was 95°C for 10 minutes, followed by 30 cycles of denaturation at 95°C for 5 seconds and then annealing at 60°C for 20 seconds. Fluorescence signals were measured once per cycle at the end of the extension step. After PCR amplification, a melting temperature curve analysis was done. Next, the LightCycler PCR products were cooled to 65°C and then heated to 95°C at a rate of 0.1°C per second. The fluorescence signals obtained were continuously monitored to confirm amplification specificity during 1 hour of analysis. The products' melting temperature peaks were calculated by performing 10 or more assays per sample and were based on the initial fluorescence curve found by plotting the negative derivative of fluorescence over temperature versus temperature. To quantify target bacteria in feces, DNA samples extracted with the QIAamp DNA Stool Mini kit from target bacteria were used to form a standard curve. Two microliters of a serial 10-fold dilution of DNA (Easy Dilution from Takara, Japan) were prepared and analyzed under the conditions specified above.

2.4. Duplex SG-PCR Analysis in 21 Foodborne Outbreaks

21 foodborne outbreak cases examined by duplex SG-PCR in Shimane Prefecture, Japan from 2002 to 2007 are shown in Table 3.
Table 3

Epidemiological investigations in 21 food—borne outbreaks examined by SG-PCR and bacteriological cultures in Shimane Prefecture, Japan.

Case No.Date ocurred (day/mo/yr)Days for examination after occurrenceInfected groupSource of infection (suspected source)No. of patients/totalNo. of examined patientsCausative pathogensStool samples (No. of positive/ examined samples)
SG-PCRIsolation
1st test2nd test3rd testFinal testTotal
14-Oct-026School excursion in a mountain areaStream watera 23/3322*EPEC O:125, O:166, O:UT *astA-positive E. coli O:1, O:UT1/74/227/225/22
203-Sep-033Protective care schoolCatering box lunch22/4610 astA-positive E. coli O:18, 1/56/10 6/103/10
O:20, O:114, O:159, O:UT
[Norovirus6/7]
301-Oct-032Celebration in a companyCatering box lunch437/135412*C. perfringens O:13, O:165/5 7/127/1210/12
411-Jun-046Camping group of high schoolGrilled meat (beef, bovine intestinal meat)4/84 C. jejuni 1/41/81/85/8
512,13-Jun-046 ~ 79 citizen groups in ChophouseGrilled meat (beef, bovine intestinal meat)30/UN12 C. jejuni 4/58/128/1210/12
617-Jun-045Cooking practise in a high schoolShelf-cooked lunch (salada mixed chicken)31/4120*C. jejuni 4/5 12/1412/1417/20
707-Jul-041Citizen in Chinese restaurantFried riceb 6/66*B. cereus 1/1 2/62/62/6
811-Oct-043Sport club in a high schoolShelf-cooked lunch26/476*C. perfringens O:16, OUT1/5 3/63/64/6
95 ~ 7-Nov-045 ~ 7RestaurantUnknown55 C. jejuni 2/52/52/5
10UnknownSeveral days (19-Jur-05)NurseryUnknown24/7322*EHEC O268/22 8/228/22
[Norovirus20/22]
1128 ~ 30-Sep-051 ~ 3Prisoners in a prisonShelf-cooked mealc 113/60061 astA -positive E. coli 14/1414/1441/46
C. perfringens (sporadic case)1/51/46
122 ~ 6-Oct-051 ~ 5Elementary and high school childrenUnknown (School lunch)39/9439 astA -positve E. coli 5/55/5IMf
EPEC 2/5IM
A. hidrophila 1/51/16
C. jejuni (sporadic case)1/5IM
1328 ~ 30-May-060 ~ 2Citizens at restaurantLunch (pilaf and scrambled aggd)27/3427*S. aureus 2/5 2/54/8
astA-positve E. coli 1/5
144-Jul-060Boarder of high schoolCatering box lunch34/5134*C. perfringens 5/5 8/88/819/50
1516-Aug-061Citizens at restaurantFried rice15/3415*B. cereus 1/4 1/42/4
1623 ~ 29-Aug-062 ~ 8Boarder of training high schoolSupper (contaminated sliced cabbagee)19/4318*C. jejuni 3/5 6/9 8/99/14
astA -positve E. coli 4/55/9IM
172-Sep-063Citizens in Buddhist serviceCatering box lunch14/494 V. parahaemolyticus 4/54/64/63/6
1822-Dec-065Citizens at restaurantSupper (chiken)12/128*C. jejuni 3/5 4/94/94/10
194-Jul-076Citizens at restaurantSupper (chiken)7/117*C. jejuni 1/2 1/22/3
2021-Oct-071Citizens at restaurantSupper7/137*EPEC 2/5 4/5IM
P. shigelloides 2/52/5
2129-Nov-071Citizens at restaurantSupper (raw chiken liver)8/87*C. jejuni 3/5 4/75/74/7
astA -positve E. coli 1/51/7

Total54/93 111/191 160/276
58.1%58.1%58.0%

a: EPEC O : 166, O : UT and astA -positive E. coli O : 27, O : UT strains were isolated from stream water drunk by patients in case 1., b: B cereus was isolated from cooked pork in case 7. c: astA genes were detected from 5 food samples in case 11., d: S. aureus was isolated from pilaf and scrambled egg in case 13., e: C. jejuni specific gene was detected from 5 food samples in case 17. f: Impossible isolation. *: 14 cases examined by SG-qPCR and viable cell count.

3. Results and Discussion

3.1. Duplex SG-PCR Procedures

We previously reported duplex SG-PCR assays for detection of 19 species of foodborne pathogens using 22 primer pairs [10, 13]. After that, more accurate duplex SG-PCR assays were designed by 10 more sensitive and specific primers including 6 primers (FemB, AB, ces-TM, Styinva, SG, and AHH1) selected from earlier publications (see references in Table 2) and 5 new primers (eae, aggR-Z, yadA-X, and CCceuE) constructed in this study. The new primer set was used for cases 19 to 21. Real-time SG-PCR procedures using 22 primer pairs for the detection of 15 bacterial species, including 5 E coli subgroups, were developed for the duplex assay. The primer sequence, target, SG-PCR product size, T values (mean plus standard deviation from a range of 10 assays), specificities, and references are summarized and listed in Tables 1 and 2. The primer virA detects virA gene of Shigella spp. and EIEC; the primer eae detects eaeA gene of EPEC and EHEC, and the primer EAST-1 detects astA gene of EAEC and ETEC. Primer hlyA detected hlyA gene of V. cholerae strains O1 and O139 as well as non-O1 strains. The primer SG for the detection of nheB (nonhemolytic enterotoxin B) gene of B. cereus cross-reacts with enterotoxigenic and emetic strains and the primer ces-TM detects cereulide synthetase gene of emetic strain of B. cereus. The nheB and ces gene positive strains were identified with emetic strains and the nheB gene positive and ces gene negative strains with enterotoxigenic strains. A new primer yadA-X for Yersinia adhesion reacts with virulent Y. enterocolitica and Y. pseudotuberculosis, but not with nonpathogenic strains of Yersinia spp. (data not shown). Other primers, including new primers aggR-Z and CCceuE, specifically detect each gene of EAEC and C. coli. Food-borne Outbreak Investigation Report (http://www.mhlw.go.jp/topics/syokuchu/), Ministry of Health, Labor and Welfare, Japan during 2005 to 2007 shows that 97% of foodborne outbreaks were caused by the following 7 species of foodborne pathogens: S. enterica (58.3%), C. jejuni (15.2%), TDH-producing V. parahaemolyticus (8.3%), S. aureus (7.2%), C. perfringens (3.6%), emetic B. cereus (1.6%), EHEC (2.9%), and other virulent E. coli (2.1%) which include astA-positive E. coli which is a strain of E. coli that does not possess any diarrheagenic characteristics except the EAEC heat-stable toxin 1 (EAST1) gene and is frequently isolated in diarrhea outbreaks [27]. Using of 4 primer sets of 2 primer pairs, including newly selected or designed 6 primer pairs, for the detection of 7 main foodborne pathogens and astA-positive E. coli in the first run of duplex SG-PCR brought out the comprehensive, rapid, and sensitive detection of causative pathogens in foodborne pathogens to cases 19 to 21 (Table 2 and Figures 1 and 2). The second run of duplex SG-PCR used 4 primer sets and the final run utilized 2 primer sets selected from the remaining 4 primer pairs. The primers JMS1 and JMS2 were used for the single PCR detection of stx1 and/or stx2 genes from the eaeA gene-positive samples for the confirmation of EHEC. Figures 1 and 2 show the T curves of the duplex SG-PCR products of the template DNA samples in each run. In duplex SG-PCR assay with two primer pairs, each PCR product was generated with a different T curve. These could be resolved in a LightCycler by using T curve analysis when a target bacterium was present in the reaction tube.
Figure 1

Melting curve analysis of duplex SYBR Green I PCR products in the first run using four primer sets: FemB plus eaeA, AB plus EAST1, ces plus tdh, and GAP plus Styinva.

Figure 2

Melting curve analysis of duplex SYBR Green I PCR products in the second run using four primer sets: ST plus PSG, aggR plus virA, LT plus AHH1, and PAG plus SG; the third run using two primer sets: CCcesE plus yadA and trh plus hlyA; simple PCR with primers JMS 1 and JMS2.

3.2. Using Duplex SG-PCR for Identification of the Causative Agent in 21 Foodborne Outbreaks

Table 3 shows epidemiological and clinical investigations in 21 foodborne outbreaks examined by duplex SG-PCR analysis in Shimane Prefecture, Japan from 2002 to 2007. From samples of feces, we used a combination of duplex SG-PCR assay with DNA extraction using a QIAamp DNA Stool Mini kit. The SG-PCR assay is rapid, specific, and sensitive as a detection technique. The DNA extraction of 5 stool specimens with the QIAamp DNA Stool Mini kit was carried out within 1 hour and it effectively removed inhibitors present in feces. The duplex SG-PCR assay was also carried out within 1 hour. The 7 species (listed previously) of foodborne bacteria, which included 3 groups of E. coli, were detected from 111 (58.1%) of 191 feces in 21 cases by duplex SG-PCR. Then these causative agents were isolated and identified after 2 to 4 days. With the exception of two cases (cases 10 and 11), the first run of duplex SG-PCR confirmed the presence of a pathogen in 54 (58.1%) of 93 feces in 19 (90.5%) cases within 2 hours. The exceptions were case 10 where a confirmation test was necessary to detect the eaeA gene of EHEC O26 and case 11 where astA-positive E. coli was detected on the third run. In the first run, DNA samples extracted from 5 feces (1, 3, 4, or 7 feces in 6 cases) of symptomatic patients were used and the causative pathogens were detected from 1 to 5 samples: 1 (in 8 cases: 1, 2, 4, 7, 8, 15, 19, and 21), 2 (in 3 cases: 9, 13, and 20), 3 (in 3 cases: 16, 18, and 21), 4 (in 3 cases: 5, 6, and 17), and 5 samples (in 3 cases: 3, 12, and 14). Then the causative pathogens were later isolated in a routine laboratory. In cases 11 and 12, C. perfringens or C. jejuni was detected by duplex SG-qPCR with more than 105 CFU/g feces from only 1 sample and C. perfringens was then also isolated from only 1 of 46 samples and C. jejuni from only 1 of 16 samples by culture method. Therefore, the infections with both these pathogens were determined to be sporadic cases and they were immediately eliminated as causative pathogens in cases 11 and 12. It was confirmed that duplex SG-PCR analysis of 5 feces collected from symptomatic patients was ultimately the most effective screening method for foodborne pathogens in foodborne outbreaks [10, 13]. Duplex SG-PCR rapidly and accurately demonstrated that 12 (57.1%) of 21 cases were caused with a single foodborne pathogen such as C. jejuni (6 cases), C. perfringens (3 cases), B. cereus (2 cases), and TDH-producing V. parahaemolyticus (one case). There were also 7 (33.3%) cases with plural foodborne bacterial pathogens (such as astA-positive E. coli, EPEC, C. jejuni, C. perfringens, A. hydrophila, and P. shigelloides) and 2 (9.5%) cases with foodborne bacterial pathogens (astA-positive E. coli or EHEC O:26) and norovirus. In cases 2 and 10, although detection of norovirus is out of the scope of our work, norovirus and foodborne bacterial pathogens were concomitantly detected by conventional PCR analysis in our virological laboratory. In case 2 in which norovirus was detected in 6 of 7 feces, the astA gene of EAEC was detected from 7 of 10 feces and then astA-positive E. coli strains were isolated from 6 samples. In case 10 in which norovirus was detected from 20 of 22 feces, the eae gene of EPEC or EHEC was detected from 8 of 22 feces and EHEC O26 strains were isolated from 8 of 22 feces. In 7 cases (cases 1, 11, 12, 13, 16, 20, and 21), the pathogenic E. coli strains belonging to astA-positive E. coli and/or EPEC were concomitantly detected with other foodborne bacterial pathogens. In case 1, the eae gene of EPEC or EHEC was detected from 4 of 22 feces and the astA gene of EAEC was detected in 3 other feces. However, duplex SG-PCR could not detect other virulent genes, including the stx1 and stx2 genes of EHEC. Then EPEC strains were later isolated from 5 feces and astA-positive E. coli from 4 other feces. In case 12, the astA gene of EAEC was detected in all 5 feces and the eae gene of EPEC or EHEC in 2 feces, but duplex SG-PCR could not detect other E. coli virulent genes. The subsequent bacteriological examination could not isolate pathogenic E. coli among nonpathogenic E. coli flora. In case 16, the C. jejuni specific gene was detected in 6 of 9 feces and the astA gene of EAEC was detected in 5 feces (both genes from 3 feces). C. jejuni strains were then isolated from 9 of 14 feces, but we were not able to isolate the pathogenic E. coli strain among nonpathogenic E. coli flora. In cases 19 to 21 analyzed improved real-time PCR using 8 primers for the detection of 7 main foodborne bacteria and astA-positive E. coli, C. jejuni, EPEC, or astA-positive E. coli were detected from 1 to 3 fecal samples on the first run and the absence of the other main foodborne bacteria in the analyzed samples was readily confirmed. In case 20, the eae gene of EPEC or EHEC was detected from 2 of 5 fecal samples on the first run and the gyrB gene of P. shigelloides was detected separately from other 2 fecal samples on the second run. Then P. shigelloides strains were isolated from 2 feces, but isolation of the EPEC strain was very difficult due to the presence of large nonpathogenic E. coli flora in the feces. In almost all cases, the duplex SG-PCR assay first run detected these causative agents from more than one of the five feces. Then, in almost all cases, the presence of a causative agent (presumed from duplex SG-PCR assay) was confirmed by the results of the final SG-PCR assay run and the bacteriological cultivation of additional feces. These findings confirmed that for foodborne outbreaks duplex SG-PCR is a useful tool for the rapid detection of both single and multiple pathogens.

3.3. Quantification of the Causative Agent in 14 Foodborne Outbreak Cases

Figure 2 shows the relationship between CFU and DNA copy of foodborne pathogens using SG-quantitative PCR (qPCR) assay in 71 feces from 14 cases examined by viable cell counting. There was no correlation (r 2 = 0.1183) between CFU and DNA copy of foodborne pathogens in feces, although almost all pathogens were detected by SG-PCR from feces registering more than 103 CFU/g by viable cell counting. By using SG- qPCR assay combined with DNA extraction using the QIAamp DNA Stool Mini kit, Bibbal et al. [28] reported a significant correlation between CFU and DNA copy of ampicillin-resistant Enterobacteriaceae in swine feces. Fu et al. [29] reported a significant correlation between CFU and DNA copy of Lactobacillus and total anaerobic bacteria in dog feces but found no correlation between CFU and DNA copy of C. perfringens. Although accurate quantifications of foodborne pathogens, including C. jejuni and C. perfringens, in feces were not completely performed by SG-qPCR in this study, the presence of any foodborne pathogens at more than 103 CFU/g feces was certainly confirmed by melting curve analysis. There are two major problems for these differences. One cause is different sample preparation that was used for CFU from the feces stored in the transport medium and for qPCR using the mass sample collected for virological inspection. Another cause is the approach used to construct the standard curves that were prepared from pure bacterial cultures. These curves do not relate with the “real” situation of a bacterial quantification in a faecal sample and can in part explain the absence of correlation between CFU and DNA copy of foodborne pathogens in faeces. In our routine bacteriological diagnostic laboratory, we used duplex SYBR Green I PCR assay combined with DNA extraction via QIAamp DNA Stool Mini kit for the detection of foodborne bacteria from 21 foodborne outbreak cases. The causative bacteria were detected in almost all cases in 2 hours or less. The first run was for the detection of 8 main foodborne bacteria and the second run was for the detection of other unusual suspect bacteria. The results proved that for comprehensive and rapid molecular diagnosis in foodborne outbreaks, duplex SG-PCR assay is not only very useful, but is also economically viable for one-step differentiation of causative bacteria in fecal specimens obtained from symptomatic patients. This then allows for effective diagnosis and management of foodborne outbreak.
  29 in total

1.  Rapid detection of Escherichia coli O157:H7 with multiplex real-time PCR assays.

Authors:  Narayanan Jothikumar; Mansel W Griffiths
Journal:  Appl Environ Microbiol       Date:  2002-06       Impact factor: 4.792

Review 2.  [Methods to detect the thermostable direct hemolysin gene and a related hemolysin gene of Vibrio parahaemolyticus by PCR].

Authors:  M Nishibuchi; Y Takeda; J Tada; T Ohashi; N Nishimura; H Ozaki; S Fukushima
Journal:  Nihon Rinsho       Date:  1992-07

Review 3.  [Differentiation and detection of pathogenic determinants among diarrheogenic Escherichia coli by polymerase chain reaction using mixed primers].

Authors:  F Itoh; T Ogino; K Itoh; H Watanabe
Journal:  Nihon Rinsho       Date:  1992-07

4.  Comparison of agar plate and real-time PCR on enumeration of Lactobacillus, Clostridium perfringens and total anaerobic bacteria in dog faeces.

Authors:  C J Fu; J N Carter; Y Li; J H Porter; M S Kerley
Journal:  Lett Appl Microbiol       Date:  2006-05       Impact factor: 2.858

5.  Detection and characterization of the hemolysin genes in Aeromonas hydrophila and Aeromonas sobria by multiplex PCR.

Authors:  Gehua Wang; Clifford G Clark; Chenyi Liu; Chad Pucknell; Cindy K Munro; Tamara M A C Kruk; Richard Caldeira; David L Woodward; Frank G Rodgers
Journal:  J Clin Microbiol       Date:  2003-03       Impact factor: 5.948

6.  Application of the 5'-nuclease PCR assay in evaluation and development of methods for quantitative detection of Campylobacter jejuni.

Authors:  H K Nogva; A Bergh; A Holck; K Rudi
Journal:  Appl Environ Microbiol       Date:  2000-09       Impact factor: 4.792

7.  Detection and characterization of verocytotoxin-producing Escherichia coli by automated 5' nuclease PCR assay.

Authors:  Eva Møller Nielsen; Marianne Thorup Andersen
Journal:  J Clin Microbiol       Date:  2003-07       Impact factor: 5.948

8.  Duplex real-time SYBR green PCR assays for detection of 17 species of food- or waterborne pathogens in stools.

Authors:  Hiroshi Fukushima; Yoshie Tsunomori; Ryotaro Seki
Journal:  J Clin Microbiol       Date:  2003-11       Impact factor: 5.948

9.  Improvement in the detection rate of diarrhoeagenic bacteria in human stool specimens by a rapid real-time PCR assay.

Authors:  Yoshio Iijima; Nahoko T Asako; Masanori Aihara; Kozaburo Hayashi
Journal:  J Med Microbiol       Date:  2004-07       Impact factor: 2.472

10.  An outbreak of gastroenteritis in Japan due to Escherichia coli O166.

Authors:  Y Nishikawa; J Ogasawara; A Helander; K Haruki
Journal:  Emerg Infect Dis       Date:  1999 Mar-Apr       Impact factor: 6.883

View more
  5 in total

Review 1.  Plesiomonas shigelloides Revisited.

Authors:  J Michael Janda; Sharon L Abbott; Christopher J McIver
Journal:  Clin Microbiol Rev       Date:  2016-04       Impact factor: 26.132

2.  Simultaneous Screening of 24 Target Genes of Foodborne Pathogens in 35 Foodborne Outbreaks Using Multiplex Real-Time SYBR Green PCR Analysis.

Authors:  Hiroshi Fukushima; Jun Kawase; Yoshiki Etoh; Kumiko Sugama; Shunshuke Yashiro; Natsuko Iida; Keiji Yamaguchi
Journal:  Int J Microbiol       Date:  2010-09-28

3.  SYBR®Green qPCR Salmonella detection system allowing discrimination at the genus, species and subspecies levels.

Authors:  Elodie Barbau-Piednoir; Sophie Bertrand; Jacques Mahillon; Nancy H Roosens; Nadine Botteldoorn
Journal:  Appl Microbiol Biotechnol       Date:  2013-10-11       Impact factor: 4.813

4.  Exploiting Bacterial Whole-Genome Sequencing Data for Evaluation of Diagnostic Assays: Campylobacter Species Identification as a Case Study.

Authors:  Melissa J Jansen van Rensburg; Craig Swift; Alison J Cody; Claire Jenkins; Martin C J Maiden
Journal:  J Clin Microbiol       Date:  2016-10-12       Impact factor: 5.948

5.  Detection and discrimination of five E. coli pathotypes using a combinatory SYBR® Green qPCR screening system.

Authors:  Elodie Barbau-Piednoir; Sarah Denayer; Nadine Botteldoorn; Katelijne Dierick; Sigrid C J De Keersmaecker; Nancy H Roosens
Journal:  Appl Microbiol Biotechnol       Date:  2018-02-20       Impact factor: 4.813

  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.