| Literature DB >> 19954731 |
Bodil Marie Kristensen1, Dorte Frees, Anders Miki Bojesen.
Abstract
Gallibacterium anatis is a pathogen in chickens and other avian species where it is a significant cause of salpingitis and peritonitis. We found that bacterial cells and cell-free, filter-sterilised culture supernatant from the haemolytic G. anatis biovar haemolytica were highly cytotoxic towards avian-derived macrophage-like cells (HD11). We obtained the genome sequence of G. anatis 12656-12 and used a rational approach to identify a gene predicted to encode a 2026 amino acid RTX-toxin, which we named GtxA (Gallibacterium toxin). The construction of a gtxA knock-out mutant showed gtxA to be responsible for G. anatis' haemolytic and leukotoxic activity. In addition, Escherichia coli expressing gtxA and an adjacent acyltransferase, gtxC, became cytolytic. GtxA was expressed during in vitro growth and was localised in the extracellular protein fraction in a growth phase dependent manner. GtxA had an unusual modular structure; the C-terminal 1000 amino acids of GtxA were homologous to the classical pore-forming RTX-toxins in other members of Pasteurellaceae. In contrast, the N-terminal approximately 950 amino acids had few significant matches in sequence databases. Expression of truncated GtxA proteins demonstrated that the C-terminal RTX-domain had a lower haemolytic activity than the full-length toxin, indicating that the N-terminal domain was required for maximal haemolytic activity. Cytotoxicity towards HD11 cells was not detected with the C-terminal alone, suggesting that the N-terminal domain plays a critical role for the leukotoxicity. INRA, EDP Sciences, 2010.Entities:
Mesh:
Substances:
Year: 2009 PMID: 19954731 PMCID: PMC2820230 DOI: 10.1051/vetres/2009073
Source DB: PubMed Journal: Vet Res ISSN: 0928-4249 Impact factor: 3.683
Primer list. Primers used for construction and verification of gtxA mutants. Restriction sites are underlined.
| Primer name | Primer sequence (5′-3′) |
|---|---|
| 4240 | TATC |
| 4242 | AGCT |
| 4243 | AGCT |
| 4245 | TATG |
| kanR | CGATAGATTGTCGCACCTGA |
| kanF | TATGGAACTGCCTCGGTGA |
| 39F | TGATGCAATCAAAGATAAAGTCG |
| 5734R | AATCGGCATTGGAGCTTTC |
| 2871F | AACCAAACCAATCCAAGGT |
| 3270R | ATTGCCGTCTTTGCCTACTG |
Primer list. Primers used for constructs for expression in E. coli. Restriction sites are underlined. Bold indicates overlapping regions for splicing by overlap extension.
| Primer name | Primer sequence (5′-3′) | Construct | Primers used |
|---|---|---|---|
| GtxUP-NcoI | AGTC | GtxUP-NcoI & | |
| CAGT | GtxUP-NcoI & | ||
| AGTC | RTX+C | ||
| CAGT | RTX | ||
| CAGT | Nterm+C | GtxUP-NcoI & SOErev1 | |
| SOErev1 | SOEfor2 & | ||
| SOEfor2 | Nterm | GtxUP-NcoI & |