Direct damage to the backbone of DNA oligomers is influenced by the OH moiety at strand ends, by the type of base, and by context.

Previous studies on high molecular weight DNA found that backbone damage, as monitored by free base release, is relatively independent of the type of base; i.e., the yields of all four bases were nearly equal. This could be due to a lack of influence of any given base over damage to its own deoxyribose or it could be a consequence of averaging out disparities due to each base sampling a wide range of base contexts. This study is aimed at distinguishing between these two possibilities. Transparent films, prepared from palindromic oligodeoxynucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATAATTATAATTATTAAGAGAG), and d(CTCTCTTAATATTAAGAGAG), were used for this investigation. The DNA films, hydrated to approximately 2.5 waters per nucleotide, were irradiated at RT under air using X-rays generated by a tungsten tube, immediately dissolved in nuclease-free water, and stored at 277 K for 24 h, and then unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion+2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each of the above sequences. The observed yields lead to the following conclusions: (i) base release at the oligomer ends is favored over release at internal positions (called the end effect), (ii) phosphorylation of the OH moiety at the oligomer ends quenches the end effect, (iii) the magnitude of the end effect is influenced by the base at the end and the bases proximal to it, and (iv) the release of base is influenced by the base and its context.