| Literature DB >> 19646827 |
E N Barker1, S Tasker, M J Day, S M Warman, K Woolley, R Birtles, K C Georges, C D Ezeokoli, A Newaj-Fyzul, M D Campbell, O A E Sparagano, S Cleaveland, C R Helps.
Abstract
Two canine haemoplasma species have been recognised to date; Mycoplasma haemocanis (Mhc), which has been associated with anaemia in splenectomised or immunocompromised dogs, and "Candidatus Mycoplasma haematoparvum" (CMhp), recently described in an anaemic splenectomised dog undergoing chemotherapy. The study aim was to develop quantitative real-time PCR assays (qPCRs) incorporating an endogenous internal control to detect Mhc and CMhp and to apply these assays to DNA samples extracted from canine blood collected in Northern Tanzania (n=100) and from dogs presented to a Trinidadian veterinary hospital (n=185). QPCRs specific for Mhc and CMhp were designed using 16S rRNA gene sequence data, and each was duplexed with an assay specific for canine glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The assays detected < or =10 copies of a sequence-specific haemoplasma plasmid per reaction and neither assay showed cross-reactivity with 10(6) copies of the sequence-specific plasmid from the non-target canine haemoplasma species. Nineteen of the 100 Tanzanian samples (19%) were positive for Mhc alone and one (1%) was dually infected. One Trinidadian sample was negative for canine GAPDH DNA and was excluded from the study. Of the 184 remaining Trinidadian samples, nine (4.9%) were positive for Mhc alone, five (2.7%) for CMhp alone, and two (1.1%) dually infected. This is the first report of canine haemoplasma qPCR assays that use an internal control to confirm the presence of amplifiable sample DNA, and their application to prevalence studies. Mhc was the most commonly detected canine haemoplasma species.Entities:
Mesh:
Substances:
Year: 2009 PMID: 19646827 PMCID: PMC2805721 DOI: 10.1016/j.vetmic.2009.07.006
Source DB: PubMed Journal: Vet Microbiol ISSN: 0378-1135 Impact factor: 3.293
Details of the qPCR assays used for the detection of haemoplasma species (16S rRNA gene) and canine DNA (glyceraldehyde-3-phosphate dehydrogenase gene). Mhc: Mycoplasma haemocanis; CMhp: “Candidatus Mycoplasma haematoparvum”. FAM: 6-carboxyfluorescein; TXR: Texas Red; BHQ1/2: Black Hole Quencher® 1/2.
| Target | Forward primer (5′–3′) | Reverse primer (5′–3′) | Probe (5′–3′) |
|---|---|---|---|
| GTGCTACAATGGCGAACACA | TCCTATCCGAACTGAGACGAA | FAM-TGTGTTGCAAACCAGCGATGGT-BHQ1 | |
| GGAGAATAGCAATCCGAAAGG | GCATTTACCCCACCAACAAC | FAM-CTTCGGGAGCCCCGCGC-BHQ1 | |
| Canine | TCAACGGATTTGGCCGTATTGG | TGAAGGGGTCATTGATGGCG | TXR-CAGGGCTGCTTTTAACTCTGGCAAAGTGGA-BHQ2 |
Coefficients of variation for canine haemoplasma qPCR assays—based on calculated copy number (and threshold cycle). Mhc: Mycoplasma haemocanis; CMhp: “Candidatus Mycoplasma haematoparvum”.
| Assay | ||
|---|---|---|
| Intra-assay—high [plasmid] | 9.2% (0.87%) | 9.2% (0.79%) |
| Intra-assay—low [plasmid] | 19.8% (0.98%) | 17.6% (0.86%) |
| Inter-assay—high [plasmid] | 4.7% (0.43%) | 5.1% (0.40%) |
| Inter-assay—low [plasmid] | 2.8% (0.13%) | 13.5% (0.66%) |