| Literature DB >> 19586934 |
Nathalie Berthet1, Caroline Crey-Desbiolles, Mitsuharu Kotera, Pascal Dumy.
Abstract
The phototriggered cleavage of chemical bonds has found numerous applications in biology, particularly in the field of gene sequencing through photoinduced DNA strand scission. However, only a small number of modifiedEntities:
Mesh:
Substances:
Year: 2009 PMID: 19586934 PMCID: PMC2760783 DOI: 10.1093/nar/gkp562
Source DB: PubMed Journal: Nucleic Acids Res ISSN: 0305-1048 Impact factor: 16.971
Figure 1.Structure of the deoxynucleosides derived from 7-nitroindole (d(7-Ni)) and 3-nitro-3-deaza-2′-deoxyadenosine (d(3-NiA)).
Figure 2.Illumination of DNA containing the 3-nitro-3-deaza-2′-deoxyadenosine nucleoside results in the formation of the alkali labile deoxyribonolactone lesion followed by backbone cleavage in alkaline conditions via β and δ-elimination reactions.
Oligonucleotide sequences
| No. | Sequence (5′→3′) |
|---|---|
| 1 | CGCAC |
| 2 | GCGTGAGTGCG |
| 3 | GCGTGTGTGCG |
| 4 | GCGTGGGTGCG |
| 5 | GCGTGCGTGCG |
| 6 | CGCACACACGC |
| 7 | CGCACGCACGC |
| 8 | CATGCTGATGAATTCAGGCCT |
| 9 | CGGTACCAGCGATTCCTC |
| 10 | CATGCTGATGAATTCAGGCCTTGAGGAATCGCTGGTACCG |
| 11 | CATGCTGATGAATTCAGGCCTCGAGGAATCGCTGGTACCG |
| 12 | CATGCTGATGAATTCAGGCCTGGAGGAATCGCTGGTACCG |
| 13 | CATGCTGATGAATTCAGGCCTAGAGGAATCGCTGGTACCG |
| 14 | CATGCTGATGAATTCAGGCCATGAGGAATCGCTGGTACCG |
| 15 | CATGCTGATGAATTCAGGCCCTGAGGAATCGCTGGTACCG |
| 16 | CATGCTGATGAATTCAGGCCGTGAGGAATCGCTGGTACCG |
| 17 | CGGTACCAGCGATTCCTCA |
Figure 3.Synthesis of the unnatural triphosphate (d(3-NiA)TP).
Melting temperatures and thermodynamics parameters of 11-mer duplexes containing natural or unnatural base pairs (X:Y) in the middle of the sequence
| Duplex | Tm (°C) | ΔS° (cal/mol/K) | ΔH° (kcal/mol) | ΔG° (kcal/mol) | ||
|---|---|---|---|---|---|---|
| 3′ CGCAC | ||||||
| 5′ GCGTG | ||||||
| 3-NiA | A | 49 | 85 | 36 | 10 | |
| 3-NiA | T | 60 | 236 | 86 | 16 | |
| 3-NiA | G | 53 | 182 | 67 | 13 | |
| 3-NiA | C | 46 | 154 | 57 | 11 | |
| A | T | 59 | 231 | 85 | 16 | |
| G | C | 61 | 240 | 89 | 17 | |
| A | C | 46 | 185 | 67 | 12 | |
| Experiments were run in triplicate. See ‘Materials and Methods’ section for details. | ||||||
Figure 4.Single nucleotide incorporation opposite 3-NiA. Reactions were performed on 40-mer templates containing the unnatural base: 3-NiA, sequence 8 (lanes 1–5; 100 nM) primed with 32P-labeled 18-mer (sequence 9, 50 nM) in the presence of one single dNTP (20 μM) and KF exo- (0,1 U). Reactions were incubated for 20 min at 30°C before processing as described in ‘Materials and Methods’ section.
Steady-state kinetic parameters (kcat/Km) for incorporation by KF exo- of single nucleotides opposite the natural or unnatural bases present in the template (X = A or 3-NiA, respectively)
|
|
Figure 5.Full-length extension of primer hybridized to modified or unmodified templates. Reactions were carried out at 30°C for 20 min using either a natural template (X = A, sequence 13, lanes 1, 2) or a modified template containing 3-NiA (X = 3-NiA, sequence 8, lanes 3 and 4) at a 100-nM concentration, primed with 32P-labelled 18-mer, sequence 9 (50 nM) in the presence of the four dNTPs (at a final concentration of 20 μM each). Reactions were catalysed by KF exo- (0.1 U).
Efficiency of KF exo- incorporation of unnatural triphospate (d(3-NiA)TP) opposite natural bases N in the template
Figure 6.Chain extension reaction catalysed by KF exo- in the presence of the modified triphosphate d(3-NiA)TP. Experiments were performed with different natural templates (100 nM) varying by the nature of the base N19 (N = T, sequence 3; N = C, sequence 4; N = G, sequence 5; N = A, sequence 6) hybridized to 18-mer primer, sequence 9 (50 nM). In a first step, chain extension reactions were conducted in the presence of d(3-NiA)TP (1 mM) and KF exo- (0.1 U) for 5 min at 30°C (lanes 2, 7, 12 and 17). In the second step, reactions were carried out using KF exo- (0.1 U) in the presence of dATP (lanes 3, 8, 13, 18) or in the presence of a mixture of the four dNTPs (lanes 4, 9, 14, 19) for 20 min at 30°C. One part of products of reactions corresponding to lanes 3, 8, 13 and 18 were illuminated at λ > 320 nm for 20 min and then treated with NaOH 1 M for 20 min at 70°C (lanes 5, 10, 15 and 20).
Figure 7.Effect of the downstream template base N20 on chain extension reaction catalysed by KF exo-. (i) 3-NiA Incorporation opposite T in the template. (ii) Incorporation of the complementary correct nucleotide opposite varying nucleotide in the template. Experiments were performed with different templates (100 nM) varying by the nature of the base N20 (N = T, sequence 10; N = A, sequence 14; N = C, sequence 15; N = G, sequence 16) hybridized to 18-mer primer (sequence 2, 50 nM). Addition of one d(3-NiA) to the primer was carried out using KF exo- (0.1 U) in presence of d(3-NiA)TP (500 μM) for 5 min at 30°C (lanes 2, 6, 10 and 14). The second step of reaction was performed using KF exo- (0.1 U) in the presence of one single dNTP (lanes 3, 7, 11 and 15) or in the presence of the mixture of the four dNTPs (lanes 4, 8, 12 and 16) for 20 min at 30°C.