BACKGROUND: The DAZ family genes boule, daz and dazl encode RNA binding proteins essential for fertility of diverse animals including human. dazl has bisexual expression in both mitotic and meiotic germ cells, whereas daz has male premeiotic expression, and boule is largely a unisexual meiotic regulator. Although boule has been proposed as the ancestor for dazl/daz by gene duplication, it has been identified only in invertebrates and mammals. It has, however, remained unclear when and how the DAZ family has evolved in vertebrates. METHODOLOGY AND PRINCIPAL FINDINGS: This study was aimed at identifying and characterizing the DAZ family genes in fish as the basal vertebrate. We show that boule and dazl coexist in medaka and stickleback. Similar to the medaka dazl (Odazl), the medaka boule (Obol) is maternally supplied and segregates with primordial germ cells. Surprisingly, Obol is expressed in adult germ cells at pre-meiotic and meiotic stages of spermatogenesis and oogenesis. However, the maximal meiotic Obol expression in spermatocytes contrasts with the predominant pre-meiotic Odazl expression in spermatogonia, and the diffuse cytoplasmic Obol distribution in early oocytes contrasts with the Odazl concentration in the Balbinani's body. CONCLUSIONS: The identification of fish boule and dazl genes provides direct evidence for the early gene duplication during vertebrate evolution. Our finding that Obol exhibits bisexual expression in both embryonic and adult germ cells considerably extends the diversity of boule expression patterns and offers a new insight into the evolutions of DAZ family members, expression patterns and functions in animal fertility.
BACKGROUND: The DAZ family genes boule, daz and dazl encode RNA binding proteins essential for fertility of diverse animals including human. dazl has bisexual expression in both mitotic and meiotic germ cells, whereas daz has male premeiotic expression, and boule is largely a unisexual meiotic regulator. Although boule has been proposed as the ancestor for dazl/daz by gene duplication, it has been identified only in invertebrates and mammals. It has, however, remained unclear when and how the DAZ family has evolved in vertebrates. METHODOLOGY AND PRINCIPAL FINDINGS: This study was aimed at identifying and characterizing the DAZ family genes in fish as the basal vertebrate. We show that boule and dazl coexist in medaka and stickleback. Similar to the medakadazl (Odazl), the medakaboule (Obol) is maternally supplied and segregates with primordial germ cells. Surprisingly, Obol is expressed in adult germ cells at pre-meiotic and meiotic stages of spermatogenesis and oogenesis. However, the maximal meiotic Obol expression in spermatocytes contrasts with the predominant pre-meiotic Odazl expression in spermatogonia, and the diffuse cytoplasmic Obol distribution in early oocytes contrasts with the Odazl concentration in the Balbinani's body. CONCLUSIONS: The identification of fish boule and dazl genes provides direct evidence for the early gene duplication during vertebrate evolution. Our finding that Obol exhibits bisexual expression in both embryonic and adult germ cells considerably extends the diversity of boule expression patterns and offers a new insight into the evolutions of DAZ family members, expression patterns and functions in animal fertility.
Germline development and gametogenesis proceed in multiple processes that are complex and apparently divergent among metazoans. Understanding of the mechanisms underlying these processes is crucial for fertility and reproductive medicine in human as well as for germline engineering in animals. The DAZ (Deleted in Azoospermia) gene family offers one of the few lines of evidence that argue for evolutionary conservation of these processes at the molecular level. The DAZ family comprises daz, dazl and boule. DAZ family proteins are characterized by a conserved ribonucleoprotein (RNP)-type RNA recognition motif (RRM) and one (Boule and Dazl) or multiple repeats (Daz) of the DAZ motif. Historically, the DAZ family was established with the identification of the founder member Daz. In human, multiple copies of Daz genes cluster on the Y chromosome [1], [2]. Deletion of the Daz cluster is associated with azoospermia and oligospermia, making Daz a strong candidate for the Azoospermia factor. In addition, the human has an autosomal Daz-like gene, termed Dazla
[3], [4]. The Y-chromosomal Daz is limited to catarrhine primates, whereas the autosomal Dazl homologue has been found in mouse [5]. Accordingly, the autosomal Dazla has been proposed to be the ancestor of the Daz cluster, with its duplication followed by transposition to the Y chromosome having occurred during the evolution of primates [2]. Dazl homologues have been identified also in all major groups of non-mammalian vertebrates including chicken [6], Xenopus [7], axolotl [8], zebrafish [9], medaka [10] and gibel carp [11]. The third family member boule was found in Drosophila as a gene essential for the germline development [12]. Similarly, in the nematode Caenorhabditis elegans, a gene named as daz-1 was identified as the boule/dazl counterpart [13]. In all organisms examined, the DAZ family genes are exclusively expressed in, and required for, the germline development. The notion that daz, dazl and boule are evolutionary homologues is supported by observation that the humanDazl can rescue the Drosophilaboule mutant to some extent [14]. Because vertebrates have both boule and dazl, and invertebrates merely have boule, it has been proposed that boule is the ancestor of the DAZ gene family. During the vertebrate evolution, boule underwent gene duplication, producing the autosomal dazl, which duplicated further, leading to additional copies that were translocated to the Y-chromosome in catarrhine primates and amplified to multiple daz genes [15]. Indeed, boule has recently been described in few mammals including human [15], mouse [15], sheep [16] and cattle [17].In spite of germline expression, different DAZ family genes have considerable diversity in sex- and stage-specific expression. HumanDaz and Drosophilaboule are transcribed specifically in the male germline [1], [2], [18]. HumanDazla and its mouse, zebrafish, and Xenopus homologues are expressed in the germline of both sexes [7], [9], [19], [20], [21]. In the nematode daz-1 (boule/dazl homologue) mRNA is expressed in germ cells mostly in female [22], albeit its protein is detectable in germ cells in male as well [23]. In sheep, boule is also highly expressed in both male and female gonads undergoing meiosis as analyzed by RT-PCR [16].The role of the DAZ family genes in the production of gametes is still largely unknown, partly due to the apparent diversity of phenotypes caused by their defects. A human male missing the DAZ cluster shows a varying range of defects in spermatogenesis, from no germ cells at all to less severe spermatogenic arrest generating some mature spermatids [1], indicating that the DAZ cluster is not absolutely necessary for the entry into meiosis and sperm production. Targeted disruption of mouseDazla results in the complete absence of gamete production in both sexes, with Dazla-defective mice having female germ cells arrested at prophase of meiosis I and male germ cells being affected at the proliferating stage [19]. In contrast, the Drosophilaboule is essential for the meiotic progression in spermatogenesis but not oogenesis, as mutant flies have male germ cells arresting at the G2/M transition in meiosis I, exhibiting limited postmeiotic differentiation [12]. In the nematode, mutations of the boule homologue daz-1 completely abolishes fertility in hermaphrodites due to arrest at meiotic prophase in oogenesis, while daz-1-defective males exhibit no significant defect and are fully fertile [13], [22], [23]. Thus, although the DAZ family genes encode regulators of gametogenesis, their sex specificity varies considerably depending on the family member and species.With the identification of human and mouseboule in addition to dazl and daz, Xu et al [15] proposed a model for the DAZ gene family evolution. According to this model, boule was the ancestor gene that underwent the first gene duplication, generating autosomal dazl; dazl during primate evolution underwent the second gene duplication and chromosomal translocation to the Y chromosome, resulting in Daz; and two more Daz gene duplication produced the present-day Daz clusters in human. There are two puzzles in understanding of the DAZ family evolution. First, boule usually has unisexual meiotic expression in both invertebtates and mammals, whereas dazl has bisexual expression in both premeiotic and meiotic germ cells, raising an interesting question as to whether the first vertebrate boule homologue has unisexual or bisexual germline expression. The second puzzle is concerned with the timing of the first boule gene duplication leading to dazl. If this gene duplication indeed occurred early in vertebrate evolution as hypothesized [15], all vertebrate species must have both boule and dazl. However, boule in vertebrates has so far been identified only in mammals, raising the question as to whether boule is restricted to mammals by lineage-specific gene duplication. Since the separation between the fish and tetrapod lineages ultimately leading to mammals occurred at the beginning of vertebrate evolution approximately 450 million years ago, fish represent an ideal system to explore the DAZ family evolution in the basal vertebrates.Previously, we have identified dazl in the fish medaka and revealed its expression in embryonic and adult germ cells of both sexes [10]. This study was aimed at the identification of boule in medaka (Oryzias latipes), and both boule and dazl in a second fish species, namely the three spined stickleback (Gasteroteus aculeatus). Furthermore, we examined the medakaboule RNA expression in developing embryos and adult gonads. Medaka is an excellent model for investigating germline development and gametogenesis in vivo and in vitro. It has a completely sequenced genome facilitating gene identification and reverse genetics, male germ stem cell line capable of sperm production in vitro
[24], the ease of observation of germline development and robust genetic manipulations in embryos [25] and stem cell cultures [26]. We showed that the medakaboule has a previously unidentified expression pattern, which may provide important implications on the DAZ gene family evolution and boule gene function.
Results and Discussion
Fish Possess both boule and dazl
The DAZ family proteins show apparent sequence variations in diverse organisms except for the RRM and DAZ motif. To determine whether boule was present in the fish lineage, we exploited molecular cloning and bioinformatics approach and chose the medaka as the first model to identify boule and dazl homologues in fish. Since Odazl, the medakadazl, has previously been cloned [10], here we focused on cloning boule gene in the strain i3 medaka. We cloned the boule gene before the medaka genome sequence became available. A multiple sequence alignment of invertebrate and mammalianBoule proteins led to the identification of two conserved sequences for degenerate primers (see below). RT-PCR with the degenerate primers resulted in a partial sequence that was found to be most similar to the humanBOULE. Rapid amplification of cDNA ends (RACEs) by using gene-specific primers led to the composition of a full length cDNA that was cloned by using terminal primers and verified by sequencing. This cDNA appears to be the medakaboule, termed Obol. Obol is 2,097 nt in length, contains a 74-nt 5′ untranslated region (UTR), a 1,134-nt 3′ UTR and a 885-nt open reading frame (ORF) encoding a protein of 295 amino acid residues (aa) (Fig. 1). The predicted protein OBol possesses a conserved RRM and a DAZ repeat (Fig. 1). OBol is 41% and 42% identical in sequence to the mouse and humanBOULE, respectively, and 28% to the humanDAZL (data not shown), indicating it is more similar to Boule than to Dazl. The conserved positions usually reside within the RRM (Fig. 2A).
Figure 1
Nucleotide sequence of the medaka boule cDNA.
Obol and its deduced protein OBol: shown in bold are the translation start codon, stop codon and putative poly-adenylation signal. Highlighted are RRM motif (Turquoise) and DAZ motif (light grey). Underlined are primer sequences for 5′ RACE (dash) and RT-PCR (solid, fragment for RNA probe) with arrows depicting their extension directions.
Figure 2
Identification of fish boule and its expression in medaka.
(A) Multiple sequence alignment of the RRM. Boule and Dazl proteins share 27 invariant residues (asterisks) and seven conserved positions (%). There are 20 invariant or conserved residues characteristic of Boule (&) or 21 of Dazl (#) proteins each. Ol, Oryzias latipes (medaka); Ga, Gasterosteus aculeatus (stickleback); Gg, Gallus gallus (chicken); Oa, Ornithorhynchus anatinus (platypus); Bt, Bos taurus (cattle); Mm, Mus musculus (mouse); Xl, Xenopus laevis (African clawed frog); Cp, Cynops pyrrhogaster (newt); Hs, Homo sapiens (human). (B) Phylogenetic tree of DAZ family proteins. Notably, the branching between Boule and Dazl clades coincides with the branching between the fish and tetrapod lineages, and molecular trees on the basis of either Boule or Dazl sequences are well in accordance with organism relationships, indicating that generation of boule and Dazl took place in early vertebrate evolution. Followed species are gene accession numbers. (C) The phenogenic relationship of major bony fish with other vertebrates and their divergence time: Bony fish groups in blue; Mammal groups in green and other transit groups in dark; drawings are based on references [27], [42] and data from http://en.wikipedia.org/wiki/Timeline_of_human_evolution#Primates.
Nucleotide sequence of the medaka boule cDNA.
Obol and its deduced protein OBol: shown in bold are the translation start codon, stop codon and putative poly-adenylation signal. Highlighted are RRM motif (Turquoise) and DAZ motif (light grey). Underlined are primer sequences for 5′ RACE (dash) and RT-PCR (solid, fragment for RNA probe) with arrows depicting their extension directions.
Identification of fish boule and its expression in medaka.
(A) Multiple sequence alignment of the RRM. Boule and Dazl proteins share 27 invariant residues (asterisks) and seven conserved positions (%). There are 20 invariant or conserved residues characteristic of Boule (&) or 21 of Dazl (#) proteins each. Ol, Oryzias latipes (medaka); Ga, Gasterosteus aculeatus (stickleback); Gg, Gallus gallus (chicken); Oa, Ornithorhynchus anatinus (platypus); Bt, Bos taurus (cattle); Mm, Mus musculus (mouse); Xl, Xenopus laevis (African clawed frog); Cp, Cynops pyrrhogaster (newt); Hs, Homo sapiens (human). (B) Phylogenetic tree of DAZ family proteins. Notably, the branching between Boule and Dazl clades coincides with the branching between the fish and tetrapod lineages, and molecular trees on the basis of either Boule or Dazl sequences are well in accordance with organism relationships, indicating that generation of boule and Dazl took place in early vertebrate evolution. Followed species are gene accession numbers. (C) The phenogenic relationship of major bony fish with other vertebrates and their divergence time: Bony fish groups in blue; Mammal groups in green and other transit groups in dark; drawings are based on references [27], [42] and data from http://en.wikipedia.org/wiki/Timeline_of_human_evolution#Primates.The cloning of Obol in this study and Odazl in our previous work enabled us to search for boule and dazl homologues in other fish species. Blast search against sequenced fish genomes (www.ensembl.org) resulted in the identification of single boule (ENSGACP00000019047) and dazl (ENSGACP00000009272) genes also in stickleback (Gasterosteus aculeatus). A multiple sequence alignment of the RRM reveals that Boule differ from Dazl proteins in 20 invariant and/or conserved positions, besides 27 invariant and/or conserved positions common to both Boule and Dazl (Fig. 2A). On a phylogenetic tree, fish and mammalianBoule proteins are clustered together, whereas all Dazl forms a separate clade (Fig. 2B). As illustrated in Fig. 2C, the stickleback belongs to the Percomorpha, separating about 100 million years ago from the Beloniformes to which the medaka belongs. Together, Percomorpha and Beloniformes are within the lineage Acanthopterygii and separated approximately 180 million years ago from the Ostariophysii to which the zebrafish belongs[27]. Interestingly, the branching into the Boule and Dazl clades coincides with separation between fish and tetrapod lineages. This, together with the fact that fish Boule is more similar to mammalianBoule than to fish Dazl, strongly suggests the early appearance of vertebrate boule before fish-tetrapod separation about 450 million years ago.Fish boule and dazl resemble their mammalian counterparts in gene structure consisting of 12 and 11 exons, respectively (Fig. 3). To further determine whether fish boule and dazl were the evolutionary orthologues of humanBoule and Dazl respectively, we analyzed the chromosomal syntenic relationships. Obol is adjacent to stoml2 gene on Ultracontig 140 that is syntenic to a small region of stickleback chromosome/group 1. This region contains eight genes including boule and is fully syntenic to the Boule-bearing region on human chromosome 2 (Fig. 4A). On the other hand, the dazl-bearing regions on different fish chromosomes (medaka Chr11, stickleback group X and zebrafish Chr19) exhibit a conserved synteny to the Dazl-containing human chromosome 3 (Fig. 4B). Taken together, fish have both boule and dazl genes, demonstrating that the gene duplication leading to boule and dazl must have taken place before the separation between the fish and tetrapod lineages. Furthermore, the DAZ gene family in fish very probably has only two members, namely boule and dazl, because blast searches by using boule and dazl queries failed to detect any additional DAZ family genes in fish cDNA databases and all of the five sequenced genomes (data not shown). This situation is reminiscent of non-primate mammals and indicates that either boule or dazl has undergone no or rare additional gene duplication after fish-tetrapod separation. In accordance with this notion is the presence of a putative boule also in chicken (XP_421917), in addition to a described chickendazl
[6]
Figure 3
Comparisons of genomic organizations between fish and mammal.
A. boule. B.dazl. Exons are shown in scale. The sizes of primary transcripts are indicated. The 5′ and 3′ untranslated regions (UTR) are not known for the stickleback boule and dazl. The fish genes are generally smaller than the human genes except the medaka dazl that is the largest. Notably, both medaka boule and dazl have introns in the region coding for 3′-UTRs. There is a gap (*) in the intron between the medaka boule exons.
Figure 4
Chromosome synteny of fish boule and dazl genes.
(A) Chromosomal synteny of boule gene. (B) Chromosomal synteny of dazl gene. Chr, chromosome; grp, linkage group; UC, ultracontig. Numericals in parentheses are chromosomal positions.
Comparisons of genomic organizations between fish and mammal.
A. boule. B.dazl. Exons are shown in scale. The sizes of primary transcripts are indicated. The 5′ and 3′ untranslated regions (UTR) are not known for the stickleback boule and dazl. The fish genes are generally smaller than the human genes except the medakadazl that is the largest. Notably, both medakaboule and dazl have introns in the region coding for 3′-UTRs. There is a gap (*) in the intron between the medakaboule exons.
Chromosome synteny of fish boule and dazl genes.
(A) Chromosomal synteny of boule gene. (B) Chromosomal synteny of dazl gene. Chr, chromosome; grp, linkage group; UC, ultracontig. Numericals in parentheses are chromosomal positions.
Boule has a Novel Expression Pattern in Medaka
In all species examined so far, dazl has bisexual germline expression, while boule usually has unisexual expression. Moreover, boule also shows sex specificity in different organisms, namely male fly [12] and mammals [15], but female worm [22]. RT-PCR analyses revealed that the adult Obol RNA expression is absent in somatic tissues but high in adult gonads of both sexes (Fig. 5A), suggesting that adult Obol expression may be restricted to germ cells. Amazingly, the Obol RNA is easily detectable in early developing embryos (Fig. 5B) before the midblastula stage when bulk zygotic gene transcription takes place [28], demonstrating that Obol RNA is maternally supplied.
Figure 5
Embryonic, adult and spermatogenic RNA expression.
(A-B) Adult (A) and embryonic expression (B) by RT-PCR. (C-I) Spermatogenic expression by in situ hybridization. Adult testicular cryosections were hybridized to antisense RNA probes and the signals were visualized by chemical (C-E) and fluorescent staining (F-I). Nuclei were stained with DAPI (blue). (C-E) Chemical SISH. (C) Obol probe. (D) Odazl probe. (E) Olvas probe. (F-I) Dual color FISH. (F and G) Obol and Odazl FISH. (H and I) Obol and Olvas FISH. Obol, Odazl and Olvas show distinct stage-preferential expression patterns. The Obol signal peaks in primary spermatocytes and reduces in secondary spermatocytes and spermatids. Notably, spermatogonia exhibit a low and detectable Obol signal. In contrast, the Odazl signal peaks in spermatogonia and sharply reduces in spermatocytes, whereas the Olvas signal peaks in spermatogonia and persists at reduced levels from spermatocytes to spermatids. sg, spermatogonium; sc 1 and sc2, primary and secondary spermatocyte; st, spermatid; sm, sperm.
Embryonic, adult and spermatogenic RNA expression.
(A-B) Adult (A) and embryonic expression (B) by RT-PCR. (C-I) Spermatogenic expression by in situ hybridization. Adult testicular cryosections were hybridized to antisense RNA probes and the signals were visualized by chemical (C-E) and fluorescent staining (F-I). Nuclei were stained with DAPI (blue). (C-E) Chemical SISH. (C) Obol probe. (D) Odazl probe. (E) Olvas probe. (F-I) Dual color FISH. (F and G) Obol and Odazl FISH. (H and I) Obol and Olvas FISH. Obol, Odazl and Olvas show distinct stage-preferential expression patterns. The Obol signal peaks in primary spermatocytes and reduces in secondary spermatocytes and spermatids. Notably, spermatogonia exhibit a low and detectable Obol signal. In contrast, the Odazl signal peaks in spermatogonia and sharply reduces in spermatocytes, whereas the Olvas signal peaks in spermatogonia and persists at reduced levels from spermatocytes to spermatids. sg, spermatogonium; sc 1 and sc2, primary and secondary spermatocyte; st, spermatid; sm, sperm.In both fly and mammals, boule expression occurs in male meiotic germ cells, and its deficiency causes male sterility by meiotic arrest in Drosophila. We performed section in situ hybridization (SISH) to examine Obol expression during spermatogenesis and compared with Odazl and Olvas, the well-studied germ cell markers in diverse animals [8], [10], [29], [30], [31]. The adult medaka testis is composed of seminiferous lobules, each comprising cysts of germ cells synchronously at various stages of spermatogenesis. Cysts of spermatogonia are located at the most peripheral region. Spermatogenesis proceeds synchronously within each cyst, and cysts of germ cells at progressively advanced stages of development reside closer to the efferent duct, which is in the central region. This allows unambiguous definition of individual spermatogenesis stages. SISH by using an antisense RNA probe revealed that the Obol transcript was most abundant in meiotic cells, namely spermatocytes. A faint signal was observed also in the meiotic products spermatids. Interestingly, spermatogonia at the testicular periphery also exhibit a weak but detectable signal (Fig. 5C). In contrast, the Odazl signal peaks in spermatogonia and reduces in spermatocytes and disappears in post meiotic stages (Fig. 5D). On the other hand, Olvas displays an expression pattern overlapping with, but distinctive from, Obol and Odazl (Fig. 5E). Sense probes did not detect reproducible staining (data not shown). To precisely compare the spatial expression pattern between Obol and Odazl or Olvas, we performed sensitive fluorescent in situ hybridization (FISH). As shown in Fig. 5F-I, Obol is clearly detectable in certain spermatogonia, and its maximal meiotic expression in spermatocytes alternates with the preferential premeiotic expression of Odazl and Olvas in spermatogoina. These results demonstrate that Obol owns a distinct expression pattern from Odazl and Olvas, and its expression occurs in both premeiotic and meiotic stages of medaka spermatogenesis.We then examined Obol expression in the ovary. In medaka, the adult ovary comprises a small number of oogonia and oocytes, and oogenesis proceeds in 10 stages [32]. By chemical SISH, Obol expression persists throughout oogenesis, in both premeiotic and meiotic stages (Fig. 6A), with the strongest signal being found in early meiotic cells, namely stage II-V oocytes, and a weak but detectable signal being seen in oogonia. This stage-preferential Obol expression is similar to Odazl (Fig. 6B) and Olvas (Fig. 6C), except that Olvas also has high expression in oogonia.
Figure 6
Oogenic RNA expression.
Adult ovarian cryosections were hybridized to antisense RNA probes and the signals were visualized by chemical (A-C) and fluorescent staining (D-I). Nuclei were stained with DAPI (blue). (A-C) Chemical SISH. (A) Obol probe. (B) Odazl probe. (C) Olvas probe. (D-F) Dual color FISH. (D) Obol signal (E) Odazl signal. (F) Merge of Obol and Odazl signals. The transcripts of Obol, Odazl and Olvas all are not detectable in somatic cells, and their germline expression persists throughout oogenenesis that proceeds in 10 stages (I – X). However, there are distinct differences. Notably, Obol and Odazl exhibit detectable expression in oogonia, albeit at a lower level than Olvas. (G-I) Colocalization of the Odazl RNA with mitochondrial cloud in the Balbiani's body of oocytes. (G) Odazl probe. (H) MitoTracker Red580 staining for mitochondrial cloud, the characteristic component of BB (arrows). (I) Merge of Odazl signal and MitoTracker staining. Intriguingly, Odazl concentrates in the Balbinani's body (asterisks), whereas Obol is diffuse in the ooplasm and essentially absent in Balbinani's body. Both Obol and Odazl are absent in the nuclei (nu). It is noteworthy that fluorescent dyes DAPI and propidium iodide do stain nuclei of oogonia but do not stain nuclei of oocytes in medaka, a similar situation has been described also in zebrafish [43].
Oogenic RNA expression.
Adult ovarian cryosections were hybridized to antisense RNA probes and the signals were visualized by chemical (A-C) and fluorescent staining (D-I). Nuclei were stained with DAPI (blue). (A-C) Chemical SISH. (A) Obol probe. (B) Odazl probe. (C) Olvas probe. (D-F) Dual color FISH. (D) Obol signal (E) Odazl signal. (F) Merge of Obol and Odazl signals. The transcripts of Obol, Odazl and Olvas all are not detectable in somatic cells, and their germline expression persists throughout oogenenesis that proceeds in 10 stages (I – X). However, there are distinct differences. Notably, Obol and Odazl exhibit detectable expression in oogonia, albeit at a lower level than Olvas. (G-I) Colocalization of the Odazl RNA with mitochondrial cloud in the Balbiani's body of oocytes. (G) Odazl probe. (H) MitoTracker Red580 staining for mitochondrial cloud, the characteristic component of BB (arrows). (I) Merge of Odazl signal and MitoTracker staining. Intriguingly, Odazl concentrates in the Balbinani's body (asterisks), whereas Obol is diffuse in the ooplasm and essentially absent in Balbinani's body. Both Obol and Odazl are absent in the nuclei (nu). It is noteworthy that fluorescent dyes DAPI and propidium iodide do stain nuclei of oogonia but do not stain nuclei of oocytes in medaka, a similar situation has been described also in zebrafish [43].A salient difference in RNA localization between Obol and Odazl was found in stage III-V oocytes. In these oocytes, Obol is diffuse in the ooplasm (Fig. 6A and D), whereas Odazl predominantly concentrates in a cytoplasmic structure, the so-called Balbiani's body (BB; Fig. 6B, D-F). Diffuse distribution was seen also for Olvas (Fig. 6C) and medaka dead end
[33]. Double color co-localization by FISH reinforced and further strengthened this distinction between Obol and Odazl in subcellular localization into the BB. Specifically, Obol is undetectable in the BB but abundant in the remaining ooplasm, whereas Odazl is highly abundant in the BB but rare in the remaining ooplasm. In addition, premeiotic expression in oogonia is clearly detectable for both Obol and Odazl. Taken together, Obol resembles Odazl and Olvas in premeiotic and meiotic expression during oogenesis, but differs from Odazl in the absence of distribution into the BB.The BB is a membraneless spherical structure in close contact with the nuclei of early developing oocytes [32], [34] and contains mitochondria, endoplasmic reticulum and several germ plasm components including the dazl RNA during early oogenesis in Xenopus and zebrafish [11], [34], [35], [36]. Specifically, the BB is characterized by highly concentrated mitochondia called mitochondrial cloud, and mitochondrial staining by e.g. the MitoTracker reagent represents a standard procedure to validate the BB identity in the early oocytes of several organisms including zebrafish [11], [34], [35], [36]. FISH and mitochondrial staining clearly revealed that the spherical structure with localized Odazl RNA was indeed within mitochondrial cloud, namely the BB (Fig. 6G-I).In Xenopus [7], [21] and fish [9], [10], [37], dazl is maternally supplied and expressed in primordial germ cells (PGCs). In contrast, boule expression in invertebrates and mammals is restricted to adult germ cells, but absent or unknown in early embryos or PGCs [15]. Our experiments described so far demonstrated that the Obol shows an expression pattern distinct from what reported for invertebrate and mammalianboule, in that Obol has bisexual premeiotic and meiotic expression. These observations, together with early embryonic expression analyzed by RT-PCR (Fig. 5B), provoked us to examine the Obol temporospatial expression during embryogenesis. By chemical whole mount in situ hybridization, Obol was easily detectable in early developing embryos such as the 4-cell stage (Fig. 7A), conforming to its maternal supply as revealed by RT-PCR (Fig. 5B). When embryogenesis proceeds, Obol becomes restricted to putative migrating PGCs at stage 18 and post-migratory PGCs at stage 27 (Fig. 7D and G). This Obol expression pattern is similar to Odazl (Fig. 7B, E and H) [10] and Olvas (Fig. 7C, F and I) [29], [38]. To verify that Obol-expressing cells were truely PGCs, we performed double color FISH to see whether Obol-positive cells were positive also for Odazl and Olvas. As illustrated in Fig. 7J-P, Obol indeed co-localizes with Odazl and Olvas in the genital PGCs at stage 27. Therefore, we conclude that Obol expression occurs in medaka PGCs.
Figure 7
Obol is maternally supplied and expressed in PGCs.
(A-I) Chemical WISH, showing maternal inheritance (A and C) and PGC expression (D-I) of Obol, Odazl and Olvas. PGCs are seen in two clusters bilateral to the body axis. (J-M) Dual color fluorescent SISH of Obol and Odazl. (N-P) Dual color fluorescent SISH of Obol and Olvas. At stage 27, Obol, Odazl and Olvas RNAs colocalize in gondal PGCs in two clusters. so, somites; no, notochord. (A-C) Top view. (D-P) Lateral view. The anterior is to the left.
Obol is maternally supplied and expressed in PGCs.
(A-I) Chemical WISH, showing maternal inheritance (A and C) and PGC expression (D-I) of Obol, Odazl and Olvas. PGCs are seen in two clusters bilateral to the body axis. (J-M) Dual color fluorescent SISH of Obol and Odazl. (N-P) Dual color fluorescent SISH of Obol and Olvas. At stage 27, Obol, Odazl and Olvas RNAs colocalize in gondal PGCs in two clusters. so, somites; no, notochord. (A-C) Top view. (D-P) Lateral view. The anterior is to the left.
Conclusions
In the present study, we report the identification of both boule and dazl in fish as an ancient vertebrate and the analysis of their expression in medakaembryonic and adult development. Several lines of evidence, including phylogenetic sequence comparisons, protein structure, genomic organization and most convincingly, chromosome synteny, support the notion that the fish boule and dazl are the orthologues of mammalianboule and dazl, respectively. With the identification of boule in mouse and human, Xu et al. [15] proposed that the DAZ gene family has evolved from boule by gene duplication and translocation. Our work corroborates and extends this report by demonstrating direct evidence for ancient gene duplication during early vertebrate evolution, prior to the separation between fish and tetrapod lineages approximately 450 million years ago (Fig. 8). The identification of fish boule indicates that boule and dazl coexist widely in the ancient vertebrate. Meanwhile, they become paralogs of each other since the Daz gene family underwent the first duplication.
Figure 8
Phylogeny and ontogeny of DAZ family genes.
Left, Phylogeny and sex-specificity. The ancient member boule exists in all metazoans, whereas dazl is in vertebrates and daz is restricted to human and certain primates. Evolutionary branching and two gene duplication events (R1 and R2) are indicated. Sex specificity of expression is indicated in different colors. Right, Ontogenic expression. Expression pattern of each member is indicated by extent of horizontal lines. Drawings are originals by author or redrawn based the references [7], [10], [12], [15], [19], [21], [23], [40], [44], [45], [46]. Genes (in italics) refer to RNA expression while Proteins represent the protein expression profiles. Major stages of germline development are diagramed as a timeline for DAZ family gene expression. Expression of dazl is detected in many or all stages of germline development in both sexes. Daz has premeiotic male expression. Meiotic expression of Boule occurs in male fly, mouse and human (most abundantly in primary spermatocytes) and mitotic and meiotic in female worm. Data obtained in this study from medaka clearly demonstrate that boule is also expressed in embryos at the earliest stage, in primordial germ cells (PGCs) and adult premeiotic and meiotic germ cells of both sexes. The expression of medaka boule is similar to that of dazl in medaka and other organisms, despite of clear differences as detailed in the text.
Phylogeny and ontogeny of DAZ family genes.
Left, Phylogeny and sex-specificity. The ancient member boule exists in all metazoans, whereas dazl is in vertebrates and daz is restricted to human and certain primates. Evolutionary branching and two gene duplication events (R1 and R2) are indicated. Sex specificity of expression is indicated in different colors. Right, Ontogenic expression. Expression pattern of each member is indicated by extent of horizontal lines. Drawings are originals by author or redrawn based the references [7], [10], [12], [15], [19], [21], [23], [40], [44], [45], [46]. Genes (in italics) refer to RNA expression while Proteins represent the protein expression profiles. Major stages of germline development are diagramed as a timeline for DAZ family gene expression. Expression of dazl is detected in many or all stages of germline development in both sexes. Daz has premeiotic male expression. Meiotic expression of Boule occurs in male fly, mouse and human (most abundantly in primary spermatocytes) and mitotic and meiotic in female worm. Data obtained in this study from medaka clearly demonstrate that boule is also expressed in embryos at the earliest stage, in primordial germ cells (PGCs) and adult premeiotic and meiotic germ cells of both sexes. The expression of medakaboule is similar to that of dazl in medaka and other organisms, despite of clear differences as detailed in the text.We have made four striking observations that convincingly demonstrate a totally novel expression pattern for boule in medaka. The boule RNA expression has been reportedly restricted to meiotic germ cells of male flies and mammals or mainly in female worms but rarely in both sexes, and boule deficiency causes sterility by meiotic arrest rather than by abolishing other processes of germline development. Consequently, boule is best known as an ancient meiotic gene conserved in metazoans [15]. Here we firstly demonstrate that boule in medaka also exhibits a maximal meiotic expression, but this occurs in both sexes, in contrast to its unisexual expression in all other organisms well examined so far. Second, we show that the medakaboule also has premeiotic and post-meiotic expression in the adult ovary and testis. Third, we have revealed that medakaboule is a maternal message and expressed throughout embryonic germ cell development. Finally, we present evidence that in medaka, boule differs from dazl in subcellular distribution to the Balbiani's body of early developing oocytes. Taken together, our investigations have revealed a previously unidentified bisexual boule expression in embryonic and adult mitotic and meiotic germ cells, further underscoring the expression diversity of DAZ family genes (Fig. 8). Interestingly, boule expression in medaka is in a sharp contrast to its unisexual meiotic expression reported in mammals and invertebrates, but is similar to that of medakadazl
[10], despite clear differences in preferential expression and stage-specific subcellular localization in the oocytes. The striking finding that boule and dazl have overlapping but distinct expression patterns provides a new insight into the evolution of DAZ family genes and their expressions as well as functions. Since fish separated from tetrapods at the earliest stage of vertebrate evolution, it is tempting to speculate that the medakaboule expression may represent the prototype of an ancient vertebrate boule. This notion is supported by the identification of putative boule and dazl genes in a marine fish, and more importantly by similar expression patterns to their medaka counterparts (data not shown). The identification of both boule and dazl in medaka and stickleback in this study will facilitate the further investigations in other fish species. Further, examination of boule and dazl expression patterns in other vertebrate species including ancient fishes will help to elaborate the evolution, expression and function of the conserved DAZ family genes in (in)fertility of vertebrates including the human.This study has focused on the RNA expression patterns of both boule and dazl. It deserved to note that RNA expression pattern may differ from that of the protein products [19], [22], [23], [39], [40]. Therefore, future work is needed to produce antibody against the medakaBoule protein for analyzing its expression and subcellular localization by immunohistochemistry.
Materials and Methods
Fish
The medaka was maintained under an artificial photoperiod of 14-h light to 10-h darkness at 26°C. All procedures carried out with medaka fish are conformed to animal care guidelines (Guidelines on the Care and Use of Animals for Scientific Purposes) as outlined by the National Advisory Committee For Laboratory Animal Research in Singapore. Embryogenesis was staged according to Iwamatsu [41]. Oogenesis was according to the 10-stage series of Iwamatsu [32].
Isolation of cDNA Sequence
Total RNA was isolated from embryos and adult tissues of strain i3 medaka by using the Trizol Reagent (Invitrogen). To eliminate genomic DNA contamination, RNA samples were treated with RNase-free DNase (Promega). SMART cDNA libraries were synthesized by using the RACE cDNA Amplification Kit according to the manufacturers' instructions (BD BioSciences). To clone a fragment of the medakaboule cDNA, RT-PCR was performed with degenerate primers inferred from conserved amino acid sequences (Fig. 2A). After sequencing, this cloned fragment was used to design gene-specific primers for 5′ and 3′ RACEs as described previously [30]. A full length cDNA sequence was obtained by using terminal primers (ggatccTTCGCGGGCGGGGGAAATGAAGTG and aaaaccgcggACCCTTGACGTTTAAC CACAG; lower case letters, introduced restriction sites for cloning).
Sequence Analysis
Blast searches were run against public databases by using BLASTN for nucleotide sequences and BLASTP for protein sequences. Multiple sequence alignment was conducted by using the Vector NTI suite 11 (Invitrogen). Phylogenetic tree was constructed by using the DNAMAN package (lynmon Biosoft). Genomic organization and chromosomal locations were investigated by comparing the cDNA and corresponding genomic sequence (http://genome.ucsc.edu/).
RT-PCR Analysis
The synthesis of cDNA was described [10]. PCR was performed by using two Obol-specific primers (bouleF2, aaaactcgagGCAGGCCGATGGCGCCTCC; bouleR2, aaaaccgcggACCC TTGACGTTTAACCACAG). As a control, β-actin was amplified from the same set of cDNA samples using MA1 (TTCAACAGCCCTGCCATGTAC) and MA2 (CCTCCAATCCAG ACAGAGTATT). PCR was run for 30 cycles (β-actin) 35 cycles (boule) of 20 s at 94°C, 20 s at 58°C and 60 s at 72°C. The PCR products were separated on 1.2% agarose gels and documented with a bioimaging system (Synoptics).
RNA in situ Hybridization
RNA in situ hybridization by chemical staining with BCIP/NBT substrates on whole mount samples (WISH) and sections (SISH) were performed as described previously with minor modifications [30]. Briefly, pGEM vectors containing the 1.3 kb partial regions of Obol ORF and 3′ UTR (see Fig. 1), 1.8-kb Olvas ORF [38] or 984-bp Odazl
[10] were linearized with Xho I and Sac II and used for the synthesis of sense and anti-sense RNA probes from Sp6 or T7 promoter by using the digoxigenin (DIG) or FITC RNA Labeling Kit (Roche); the RNA probes were treated with RNase-free TURBO DNase and purified (cat# AM1340, Ambion). Multiple color fluorescent in situ hybridization (FISH) was performed by using the TSA™ Plus Fluorescence Systems according to the product manual (NEL756, NEN Life Science). Nuclear staining was done by using 4′–6-Diamidino-2-phenylindole (DAPI) in the Gold Antifade reagent (Invitrogen).
Mitochondrial Staining
The sections were stained for mitochondria by using the MitoTracker reagent at 100 nM according to the supplier's instruction (M22425, Invitrogen), followed by FISH with the Odazl antisense RNA probe as described above and DAPI staining for nuclei before visualization.
Microscopy and Photography
Observation and photography on Leica MZFIII stereo microscope, Zeiss Axiovertinvert and Axiovert upright microscopes with a Zeiss AxioCam M5Rc digital camera (Zeiss Corp) were as described previously [10]. Confocal images were photographed on Olympus FV500 microscope with the Olympus confocal image system (Olympus). Multiple color fluorescent WISH samples were scanned in a series of 0.5-µm slices and the 3-dimensional images were reconstructed by Z-stacking 150–170 slices on the Huygens (Bitplane AG; Germany).
Authors: R Reijo; T Y Lee; P Salo; R Alagappan; L G Brown; M Rosenberg; S Rozen; T Jaffe; D Straus; O Hovatta Journal: Nat Genet Date: 1995-08 Impact factor: 38.330