DNA polymorphism analysis of Brucella lipopolysaccharide genes reveals marked differences in O-polysaccharide biosynthetic genes between smooth and rough Brucella species and novel species-specific markers.

BACKGROUND: The lipopolysaccharide is a major antigen and virulence factor of Brucella, an important bacterial pathogen. In smooth brucellae, lipopolysaccharide is made of lipid A-core oligosaccharide and N-formylperosamine O-polysaccharide. B. ovis and B. canis (rough species) lack the O-polysaccharide.
RESULTS: The polymorphism of O-polysaccharide genes wbkE, manA(O-Ag), manB(O-Ag), manC(O-Ag), wbkF and wbkD) and wbo (wboA and wboB), and core genes manB(core) and wa** was analyzed. Although most genes were highly conserved, species- and biovar-specific restriction patterns were found. There were no significant differences in putative N-formylperosamyl transferase genes, suggesting that Brucella A and M serotypes are not related to specific genes. In B. pinnipedialis and B. ceti (both smooth), manB(O-Ag) carried an IS711, confirming its dispensability for perosamine synthesis. Significant differences between smooth and rough species were found in wbkF and wbkD, two adjacent genes putatively related to bactoprenol priming for O-polysaccharide polymerization. B. ovis wbkF carried a frame-shift and B. canis had a long deletion partially encompassing both genes. In smooth brucellae, this region contains two direct repeats suggesting the deletion mechanism.
CONCLUSION: The results define species and biovar markers, confirm the dispensability of manB(O-Ag) for O-polysaccharide synthesis and contribute to explain the lipopolysaccharide structure of rough and smooth Brucella species.

Background

The members of the genus Brucella are gram-negative bacteria that cause brucellosis, a zoonotic disease of great importance worldwide. Currently, several Brucella species are recognized [1]. B. abortus, B. melitensis, B. suis, B. neotomae, B. ovis, and B. canis have been known for a long time and are traditionally distinguished according to their preferential host, biochemical tests and cell surface characteristics [2]. In addition, Brucella strains isolated from cetaceans and pinnipeds during the last fifteen years have been grouped into B. ceti and B. pinnipedialis, [3]. Very recently, some Brucella strains have been isolated from the common vole and a new species, B. microti, proposed [4]. B. abortus, B. melitensis and B. suis have been classically subdivided into biovars according to H2S production, CO2-dependence, dye sensitivity and distribution of the A and M epitopes (see below) [2]. However, because these tests are difficult to standardize, molecular markers have been investigated [5-9].

Wild type B. melitensis, B. abortus, B. suis, B. neotomae, B. ceti, B. pinnipedialis and B. microti express a smooth (S)-type lipopolysaccharide (LPS) formed by an O-polysaccharide connected to a core oligosaccharide which, in turn, is linked to lipid A, the section embedded into the outer membrane. However, both B. ovis and B. canis lack the O-polysaccharide and, accordingly, their LPS is termed rough (R) (R-LPS). Brucella LPS is of great interest not only because of these species differences but also because it is the foremost diagnostic antigen and a major virulence factor [10]. Despite this, the structure and genetics of Brucella LPS is only partially understood. The O-polysaccharide is a homopolymer of N-formyl-perosamine in α (1–2) or in α (1–2) plus α (1–3) linkages [11], and these variations relate to the main serovars in Brucella S species (A dominant, related to the α (1–2) linkage; M dominant [α (1–2) plus α (1–3) in a 4:1 proportion]; or A = M [α (1–2) plus α (1–3) in a > 4:1 proportion]). Previous studies in B. melitensis 16 M and H38 (both biovar 1) have identified two genetic regions involved in O-polysaccharide synthesis and translocation (Figure 1)(reviewed in [12]). Region wbo encodes two putative glycosyltransferases (wboA and wboB) and region wbk contains the genes putatively involved in perosamine synthesis (gmd [GDP-mannose 4, 6 dehydratase] and per [perosamine synthetase]), its formylation (wbkC) and polymerization (glycosyltransferases) (wbkA and wbkE), as well as those for bactoprenol priming (wbkD and wbkF) and O-PS translocation (wzm and wzt). In addition, wbk contains genes (manA, manB, manC) which may code for the enzymes that furnish mannose, the perosamine precursor. Intriguingly, wbkB and manBdo not generate R phenotypes upon disruption [12,13], and B. ovis and B. canis carry wbk genes despite the absence of the O-polysaccharide [14]. Much less is known on the Brucella core oligosaccharide. Reportedly, it contains 2-keto, 3-deoxyoctulosonic acid, mannose, glucose, glucosamine and quinovosamine [12,15] but the structure is unknown. Thus far, only three genes have been proved to be involved in core synthesis: pgm (phosphoglucomutase, a general biosynthetic function), manB(mannose synthesis) and wa** (putative glycosyltransferase) [12]. Obviously, genetic analysis encompassing a variety of strains could shed light on the differences behind the phenotypes of S and R species, confirm or rule out a role for known genes, and identify differences that could serve as serovar or biovar markers. With these aims, wbkE, manA, manB, manC, wbkF, wkdD, wboA, wboB, wa** and manBwere analyzed for polymorphism in the classical Brucella spp., B. ceti, and B. pinnipedialis.

Figure 1

Regions and genes encoding LPS biosynthetic enzymes in . Genes manA, manB, manCcould be involved in the synthesis of mannose, the perosamine precursor. Restriction sites: A, AluI; AvI, AvaI; Av, AvaII; B, BglI; Bg, BglII; C, ClaI; E, EcoRI; EV, EcoRV; H, HindIII; Ha, HaeII; Hf, HinfI; P, PstI; Pv, PvuII; S, Sau3A; Sa, SaII; St, StyI.

Results

LPS genes in Brucella spp. and biovars

Figure 1 shows the organization of LPS genes in B. melitensis 16 M [12]. PCR amplification of wbkE, manB, manA, manC, wkdD, wbkF, wboA and wboB, wa** and manBwas conducted on representative strains of each of the Brucella species included in this study and their biovars with attention to the LPS characteristics (i.e. S versus R; and A dominant, M dominant, or A = M for the S-LPS). Except for wboA and wboB in B. ovis, all genes were successfully amplified in the strains of all Brucella species and biovars tested. These results confirm the absence of the wbo region in B. ovis [16,17]. They also suggest that conservation of wbk extends beyond those genes (wbkA to wbkC) examined in a previous work [14] and that wa** and manBwere are also conserved in the genus. Further analyses were then conducted to examine these possibilities.

Gene polymorphism in wbk

wbkE

For all strains, the wbkE PCR-amplified product displayed the same EcoRV, HinfI, PstI and PvuII RFLP patterns. Although B. melitensis 63/9 biovar 2 showed a different StyI pattern, only one of eight additional B. melitensis biovar 2 strains tested showed this StyI pattern (data not shown).

manA

B. neotomae had a distinct manArestriction pattern consisting of an additional AvaII site (Figures 2 and 3, Table 1). Moreover, in silico analysis showed a specific profile for B. ovis consisting of a nucleotide substitution (GAA to GGA) at position 497 which modified the ManA C-terminal sequence at amino acid 165 (not shown). Also, a single nucleotide deletion (CAAT to CA-T) was detected at position 738; this frame shift leads to a change in amino acid sequence after position 246. Nucleotide sequence of PCR products from several strains confirmed the deletion in manAas characteristic of B. ovis (not shown).

Figure 2

Restriction maps of the core- and O-polysaccharide genes with the restriction enzymes used. For each gene, restriction map A corresponds to that deduced from the nucleotide sequence of B. melitensis 16 M. Only differences compared to the nucleotide sequences of B. melitensis 16 M are indicated in restriction maps B, C, D, E, F and G. The restriction patterns A, B, C, D, E, F and G are further indicated in Table 1 for each gene and for each Brucella strain studied. Additional sites and their most probable location according to restriction patterns are indicated by the restriction name (e.g. Hf) and by the position name and an asterisk.

Figure 3

PCR-RFLP analysis of . Panel A. Lanes: 1, molecular size markers; 2, manAfrom B. melitensis 16 M uncut; 3, manAfrom B. melitensis 16 M cut by AvaII; 4, manAfrom B. neotomae cut by AvaII; 5, wbkF from B. melitensis 16 M uncut; 6, wbkF from B. melitensis 16 M cut by AluI; 7, wbkF from B. melitensis bv2 cut by AluI; 8, wbkF from B. abortus bv2 cut by AluI; 9, wbkF2* from B. melitensis 16 M uncut; 10, wbkF2* from B. canis uncut; 11, wbkF2* from B. melitensis 16 M cut by EcoRV; 12, wbkF2* from B. canis cut by EcoRV; 13, wboA from B. melitensis 16 M uncut; 14, wboA from B. melitensis 16 M cut by AluI; 15, wboA from B. abortus cut by AluI; 16, wa** from B. melitensis 16 M uncut; 17, wa** from B. melitensis 16 M cut by AvaII; 18, wa** from B. suis bv2 cut by AvaII; 19, wa** from B. melitensis 16 M cut by HinfI; 20, wa** from B. ovis cut by HinfI. Panel B. Lanes: 1, molecular size markers; 2, manBfrom B. melitensis 16 M uncut; 3, manBfrom B. pinnipedialis uncut; 4, manBfrom B. melitensis 16 M cut by Sau3A; 5, manBfrom B. melitensis bv2 cut by Sau3A; 6, manBfrom B. abortus cut by Sau3A; 7, manBfrom B. suis cut by Sau3A; 8, manBfrom B. suis bv2 cut by Sau3A; 9, manBfrom B. ovis cut by Sau3A; 10, manBfrom B. pinnipedialis cut by Sau3A; 11, manBfrom B. ceti cut by Sau3A; 12, manBfrom B. melitensis 16 M cut by EcoRV; 13, manBfrom B. abortus cut by EcoRV. Panel C. Lanes: 1, molecular size markers; 2, wbkD from B. melitensis 16 M uncut; 3, wbkD from B. abortus uncut; 4, wbkD from B. canis uncut; 5, wbkD from B. melitensis 16 M cut by Sau3A; 6, wbkD from B. abortus cut by Sau3A; 7, wbkD from B. canis cut by Sau3A.

Table 1

Brucella strains used in this study.

								O-chain biosynthetic gene restriction patterns:
								wbk region				wb region
Species	Biovar	Serotype	Strain	Host/source	Geographic origin	wbkE	manAO-Ag	manCO-Ag	manBO-Ag	wbkF	wbkD	wboA	wboB	manBcore	wa**
Terrestrial mammal:
B. melitensis	1	M	16 M (ATCC 23456; BCCN R1)	Goat	United States	A	A	A	A	A	A	A	A	A	A
	2	A	63/9 (ATCC 23457; BCCN R2)	Goat	Turkey	A	A	A	B	B	A	A	A	A	A
	3	AM	Ether (ATCC 23458; BCCN R3)	Goat	Italy	A	A	A	B	A	A	A	A	A	A
B. abortus	1	A	544 (ATCC 23448; BCCN R4)	Cattle	England	A	A	A	C	A	B	B	A	A	A
	2	A	86/8/59 (ATCC 23449; BCCN R5)	Cattle	England	A	A	A	C	C	B	B	A	A	A
	3	A	Tulya (ATCC 23450; BCCN R6)	Human	Uganda	A	A	A	A	A	B	B	A	A	A
	4	M	292 (ATCC 23451; BCCN R7)	Cattle	England	A	A	A	C	A	B	B	A	A	A
	5	M	B3196 (ATCC 23452; BCCN R8)	Cattle	England	A	A	A	C	A	B	B	A	A	A
	6	A	870 (ATCC 23453; BCCN R9)	Cattle	Africa	A	A	A	C	A	B	B	A	A	A
	9	M	C68 (ATCC 23455; BCCN R11)	Cattle	England	A	A	A	C	A	B	B	A	A	A
		R	45/20 (BCCN V2)	Cattle	England	A	A	A	C	C	B	B	A	A	A
B. suis	1	A	1330 (ATCC 23444; BCCN R12)	Swine	United States	A	A	A	D	A	B	A	A	A	A
	2	A	Thomsen (ATCC 23445; BCCN R13)	Swine	Denmark	A	A	A	E	A	B	A	A	A	B
	3	A	686 (ATCC 23446; BCCN R14)	Swine	United States	A	A	A	D	A	B	A	A	A	A
	4	AM	40 (ATCC 23447; BCCN R15)	Reindeer	Russia	A	A	A	D	A	B	A	A	A	A
	5	M	513 (BCCN R21)	Wild rodent	Russia	A	A	A	D	A	B	A	A	A	A
B. ovis			63/290 (ATCC 25840; BCCN R17)	Sheep	Africa	A	A	A	F	A	B	NA	NA	A	C
			Reo 198 (BCCN R22)	Sheep	United States	A	A	A	F	A	B	NA	NA	A	C
			BCCN 76–250	Sheep	France	A	A	A	F	A	B	NA	NA	A	C
B. canis			RM6/66 (ATCC 23365; BCCN R18)	Dog	United States	A	A	A	D	D	C	A	A	A	A
			D519 (BCCN C1)	Dog	Madagascar	A	A	A	D	D	C	A	A	A	A
			BCCN 87.65	Dog	Canada	A	A	A	D	D	C	A	A	A	A
B. neotomae		A	5K33 (ATCC 23459; BCCN R16)	Desert rat	United States	A	B	A	D	A	A	A	A	A	A
Marine mammal:
B. pinnipedialis		A	B2/94	Common seal	Scotland	A	A	A	G	A	A	A	A	A	A
B. ceti		A	B1/94	Porpoise	Scotland	A	A	A	G	A	A	A	A	A	A

a ATCC, American Type Culture Collection; BCCN, Brucella Culture Collection, Nouzilly, France.

NA: Not Amplified

manC

Despite the use of several endonucleases (BamHI, AvaI, AvaII, BglI, ClaI, PstI), manCrestriction patterns were identical in all Brucella strains (Figure 2, Table 1). Therefore, no polymorphism was observed by this method.

manB

B. melitensis 16 M (biovar 1) and B. abortus Tulya (biovar 3) presented a similar manBrestriction pattern (pattern A), and B. melitensis biovars 2 and 3 showed a Sau3A site absent in other strains (pattern B). All B. abortus (except B. abortus Tulya (biovar 3)) strains tested showed a specific pattern characterized by the absence of the EcoRV site at position 1238 (pattern C). B. suis biovars 1, 3, 4 and 5, B. canis and B. neotomae formed a separate group (pattern C) on the basis of the Sau3A restriction patterns of this gene. B. ovis shared this pattern only partially because it lacked one more Sau3A site (pattern F). B. suis biovar 2 strains lacked the manBSau3A site and showed an additional HinfI site in this gene (pattern E). When this gene was amplified (primers manB-A and manB-B; (Table 2) from B. ovis 63/290, sequenced, and aligned with the homologous genes of B. melitensis biovar 1, B. abortus biovar 1, and B. suis biovar 1, polymorphism in both sequence and length was detected. As compared to B. melitensis biovar 1 and B. abortus biovar 1, two more nucleotides were found at position 1265–1266 in B. suis biovar 1 and B. ovis which should lead to a modification of C-terminal sequence of the protein (not shown). All strains isolated from marine mammals yielded restriction manBpatterns very different from those of the six classical species (pattern G, Table 1) as well as a larger PCR product (2,933 bp and 2,091 bp, respectively) (Figure 3). Sequencing of the PCR product of three strains (B2/94, B1/94 and B14/94) revealed an IS711 element (842 bp) inserted into the gene (from position 780 to 1622) (Figure 2), and this insertion was confirmed by PCR in 82 additional marine mammal strains (not shown).

Table 2

DNA Primers used

Target DNA	Primer name	Sequence (5'-3')	Amplicon size
manAO-Ag	manA-A	CATCACCATCGTTCAGAGCA	1804 bp
	manA-B	GCCAGGGGAAATGATAATGA
manBO-Ag	manB-A	GTTGGCAGAAGTTGGCATCG	2091 bp
	manB-B	CTAATGCCTGTTCCGCCACC
manCO-Ag	manC-A	TTGAAGACTGGTTTATTGCG	2210 bp
	manC-B	GCAAGACTGCCATAGAAACC
wbkE	wbkE-A	CCGCAAACTGAATGGATAAA	2452 bp
	wbkE-B	GCAACTGTCAGGTCTGGTGC
wbkF	wecA-A	GCGGAGGAATGGACAAGGAC	1234 bp
	wecA-B	AGGAAAGCCTGGCGGTACTG
wbkD	wbkD-A	TGGCTGGAGTGTGCCGAAAG	2165 bp
	wbkD-B	ACGGTTGCTGGTGCTTGTGG
wa**	wa**-A	CATCACGCATAATGACACCG	2342 bp
	wa**-B	TGCTTTTGACAAGCTCGTCG
manBcore	manBcore-A	CCAGCCGACGATTGAACTGG	1589 bp
	manBcore-B	AAGCCTTGAACCCGATCCCC
wboA	wboA-A	TCTGCATAACGGTCCTTGCC	1334 bp
	wboA-B	GCTTTTACGGCAACAAGTCC
wboB	wboB-A	CTTGGGATGCGAAACTACCG	1656 bp
	wboB-B	GCTCACGCTTCCGAATACTG

wbkD and wbkF

The wbkD PCR product was tested with HinfI, AvaII, Sau3A, BglI, ClaI and StyI, but a very low degree of DNA polymorphism was observed (Figures 2 and 3, and Table 1). For B. melitensis, B. neotomae and all marine mammal strains, all strains showed the same Sau3A pattern. An additional Sau3A site was observed for all B. abortus, B. suis and B. ovis strains (pattern B). Interestingly, the B. canis product showed a reduced size of around 400 bp and, therefore, yielded species specific restriction patterns(Figures 2 and 3). This result indicated the existence of a deletion in B. canis wbkD (see below). The wbkF PCR product showed also a low degree of polymorphism when tested with EcoRV, HaeII, HinfI, AluI, Sau3A and StyI (Figures 2 and 3, and Table 1). One pattern, however, was specific for B. melitensis biovar 2 which lacked an AluI site, and a distinct pattern for two B. abortus biovar 2 and 45/20, was also observed with AluI site. Remarkably, no amplification was obtained for B. canis, suggesting that the sequence of the wbkF-B primer corresponded to a deletion extending from the adjacent wbkD gene (see above). In fact, when the appropriate primer was used, the wbkF PCR product showed a reduced size of about 400 bp. To examine this point further, the wbkF-wbkD locus was amplified and sequenced in B. melitensis, B. ovis and B. canis. The sequences showed a 351 bp deletion in B. canis extending from wbkD nucleotide 1594 (in BMEI 1426) to wbkF nucleotide 918 (in BMEI 1427) (Figure 3 and 4) as confirmed by the genome sequence of B. canis RM 6/66 (ATCC 23365) (Genbank accession # CP000872 and CP000873). Moreover, as compared to their homologs in B. melitensis, B. abortus and B. suis, gene wbkF of B. ovis showed a single nucleotide deletion at position 35. This frame shift mutation necessarily leads to an extensive modification of cognate protein (Figure 5).

Figure 4

The . The two 7 bp direct repeats located in B. melitensis 16 M at both sides of the fragment absent in B. canis are in bold.

Figure 5

Comparison of the . Conserved amino acids are indicated by stars. The alignment was performed using the Clustal W program.

Gene polymorphism in wboA

A low degree of DNA polymorphism was observed in wboA. However, one pattern was specific of B. abortus since all strain testedlacked an AluI site. As described above, no amplification was observed for any B. ovis strain. This confirms [16,17] that absence of wboA (and wboB) is a B. ovis species-specific marker.

Polymorphism in core LPS genes

Despite using six restriction enzymes, all brucellae displayed the same RFLP pattern for the manBamplicon. In silico, the four genomes available showed low polymorphism. A single nucleotide deletion at position 812 was detected in B. ovis, which should modify the C-terminal sequence of the protein (Figure 5). Similarly, a low degree of polymorphism was observed in wa**. With the exception of B. suis biovar 2, one PstI pattern was specific of B. suis. Biovar 2 also lacked an AvaII site, which could be considered as a biovar marker. With Hinf1, a pattern was specific of B. ovis (Figure 2, Table 1).

Discussion

Despite the high DNA homology of brucellae, gene polymorphism and species- and biovar-specific markers have been consistently found. Concerning outer membrane molecules, both have been found in genes of proteins [16,18,19] but not in the LPS genes examined, all of the wbk region (wbkA, gmd, per, wzm, wzt, wbkB, and wbkC). Interestingly, these O-polysaccharide genes were found to be highly conserved not only in the classical S Brucella species and biovars but also in B. ovis and B. canis, the two species that lack the O-polysaccharide [14]. Therefore, an implication of these observations is that the R phenotype of B. ovis and B. canis cannot be explained by the absence of any of those seven wbk genes. More recently, the wbk region has been extended to include wbkE, manA, manB, manC, wbkF, and wkdD [12]. The present study includes an analysis of some of these genes and the results not only show the existence of specific markers but, more important, they also improve our understanding of the genetics-structure relationship in Brucella LPS. Concerning the O-polysaccharide, the results are relevant to interpret the variations in O-polysaccharide linkages of S Brucella and add further weight to our previous finding (12) that the putative mannose genes in wbk are not essential for perosamine synthesis. Furthermore, they help to explain the differences existing between S and R Brucella species.

Despite extensive transposon mutagenesis searches, only four putative glycosyltransferase genes have been implicated in N-formylperosamine polymerization in Brucella: wbkA, wbkE, wboA and wboB. As mentioned above, wbkA is conserved in classical Brucella species [14], and the results reported here show that wboA, wboB and wbkE are similarly present in S B. melitensis, B. abortus, B. suis, B. pinnipedialis and B. ceti. Moreover, these genes displayed low polymorphism, no matter the A or M serotype. It has to be noted that the consensus sequences of glycosyltransferases are conspicuous enough to make unlikely the existence of O-polysaccharide transferases other than wboA, wboB, wbkA and wbkE, and that, although the α (1–3) linkage relates to the M serotype, there is evidence showing that at least some A dominant strains generate a very small proportion (i.e. 2%) of α (1–3) linkages [20]. In keeping with this, it has been observed that strain RB51 (a wboA mutant of the A-dominant B. abortus 2308 S strain [21]) generates small amounts of atypical M-type polysaccharides [22]. All this evidence suggests that, rather than the presence of a α (1–3)-specific transferases in the M serotype, there are subtle variations in the expression of wboB, wbkA or wbkE, or in the activity of the corresponding glycosyltransferases that lead to the increase in α (1–3) linkages typical of the M and A = M serotypes.

A surprising feature of the wbk is the presence of genes that are not essential for O-polysaccharide synthesis. Godfroid et al. [13] analyzed the functions of the ORFs between BMEI1404 (wbkA, encoding a putative mannosyltransferase [perosaminyltransferase since mannose and perosamine are related]) and BMEI1418 (wbkC, encoding a putative formyltransferase) and found that disruption of ORF BMEI1417 (wbkB) generated no R phenotype. Later, it was found that the genome of B. melitensis contains three putative mannose synthesis genes (ORFs BMEI1394 to BMEI1396) adjacent to wbkA. Because mannose is the direct precursor of perosamine and O-polysaccharide genes usually cluster together, Monreal et al. [23] proposed the names of manA, manB, manCfor BMEI1394 to BMEI1396, and their assignment to wbk is supported by the finding by González et al. [12] that disruption of ORF BME1393 (wbkE) blocks O-polysaccharide synthesis. The latter authors provided proof that at least manB, is dispensable for perosamine synthesis but also pointed out that the existence of manB-manC(ORFs BMEII0900 and BMEII0899) preclude to rule out any role for the wbk putative mannose synthesis genes since there could be internal complementation [12]. All these results are fully consistent with the observation that, although manBis disrupted by IS711 in B. pinnipedialis and B. ceti, these two species keep the S phenotype. The wbk region has features suggestive of horizontal acquisition [14] whereas manB(and manC) are Brucella older genes necessary for the synthesis of the LPS core oligosaccharide [23,24]. Accordingly, a drift to dysfunction of the wbk man genes may have been made possible by the redundancy created after horizontal acquisition of wbk, and the similarity in this regard between B. ceti and B. pinnipedialis suggests a common ancestor.

The results of this research also shed additional light on the genetic basis behind the R phenotype of B. ovis and B. canis. Previous work has shown a large deletion in B. ovis that encompasses wboA and wboB [16,17]. The present work confirms the absence of these two putative perosaminyltraneferase genes in B. ovis, an absence that can account by itself for the lack of O-polysaccharide in this species [12,25]. To this evidence, the present work adds the nucleotide deletion detected in B. ovis wbkF. Indeed, the frame-shift thus created predicts a very modified protein. Presumably, WbkF is involved in catalyzing the transfer of an acetylated aminosugar to undecaprenylphosphate, thus priming this carrier for O-chain polymerization. The N-terminal region of the E. coli WbkF homologue was found to be necessary for this function [26] and, therefore, it seems likely that the frame-shift in B. ovis wbkF produces a non-functional protein, thus explaining in part the R phenotype of this species. Other changes detected in several B. ovis LPS genes do not have this dramatic effect. As discussed above, the man wbk genes are dispensable and, therefore, the nucleotide substitution and frame shift detected in B. ovis manAdo not contribute to the R phenotype. Since disruption of manBgenerates a deep R-LPS [24,24], the presence of two more nucleotides in the sequence of B. ovis manBwas interesting. However, this deletion modified only the C-terminal sequence (5 last amino-acids) of the protein making unlikely a change severe enough to contribute to the R phenotype. In support of this interpretation, B. ovis R-LPS is not deeply truncated like that of manBmutants. Moreover, the same two nucleotide addition was detected in B. suis, and it is known that a functional manBis required for the synthesis of S-LPS in this species [27].

A DNA deletion of 351 bp. including 3' end of wbkF and 3' end of wbkD was detected in B. canis, which might have occurred by a slipped mispairing mechanism (a direct repeat sequence of 7 bp «GGATCAT» is present at both sides of the deleted sequence in the other Brucella species (Figure 5). It is clear that this deletion has profound consequences in the synthesis of LPS. We have discussed above the essential role of wbkF in O-polysaccharide synthesis, and wbkD seems involved in the synthesis of quinovosamine, a sugar that is possibly linking the Brucella O-polysaccharide to the R-LPS [12]. This double mutation clearly explains the R phenotype of B. canis and is consistent with the absence of quinovosamine in this species [28].

Conclusion

The analyses carried out suggest new hypothesis to study the genetics of Brucella O-polysaccharide serotypes and provide evidence on both the dispensability of some wbk genes which is consistent with their horizontal acquisition. They also confirm the essential role of wbkD and wbkF in O-polysaccharide synthesis and, at the same time, contribute to understand the R phenotype of B. ovis and B. canis. Finally, they provide several biovar and species specific markers that can be used to design the corresponding molecular typing tools.

Methods

Brucella strains

The strains (Table 1) were maintained freeze-dried in the INRA Brucella Culture Collection, Nouzilly (BCCN), France. For routine use, they were grown on tryptic soy agar (Difco)-0.1% (w/v) yeast extract (Difco). Fastidious strains (B. abortus biovar 2 and B. ovis) were grown on the same medium supplemented with 5% sterile horse serum (Gibco BRL). All strains were checked for purity, and species and biovar confirmed by standard procedures [2].

DNA preparation

Bacteria were cultured at 37°C for 24 h, suspended in 3 ml sterile distilled water, harvested (2000 × g, 10 minutes) and resuspended in 567 μl of 50 mM Tris, 50 mM EDTA, 100 mM NaCl (pH 8.0). Then, 30 μl of 10% (w/v) SDS and 3 μl of 2% (w/v) proteinase K were added, the mixture was held at 37°C for 1 h and extracted twice with phenol-chloroform. Nucleic acids in the aqueous phase were precipitated with two volumes of cold ethanol, dissolved in 100 μl of 10 mM Tris, 1 mM EDTA (pH 8.0) and the amount of DNA estimated by electrophoresis on 0.8% agarose gels using appropriate DNA solutions as the standards.

Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP)

The 20-mer primers were selected to amplify manB, manA, manC, wbkF, wkdD, wbkE, wboA and wboB, wa* and manBaccording to the B. melitensis 16 M genome sequence (Genbank accession numbers AE008917 and AE008918) (Table 2). Amplification mixtures were prepared in 100 μl volumes containing 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2, 0.1% Triton X-100, 0.2 mg ml-1 gelatin (1 × PCR buffer; Appligene), 200 μM each deoxynucleoside triphosphate, 1 μM each primer, 100 ng of genomic DNA, and 2.5 U of Taq DNA polymerase (Appligene). Amplification was performed in a GeneAmp PCR System 9600 thermocycler (Perkin Elmer) as follows: cycle 1, 94°C for 5 minutes (denaturation); the next 30 cycles, 58°C for 30 s (annealing), 70°C for 30 s (extension) and 94°C for 30 s (denaturation); the last cycle, 58°C for 30 s (annealing) and 70°C for 10 minutes (extension). For PCR-RFLP, AluI, AvaI, AvaII, BamHI, BglI, BglII, ClaI, EcoRI, EcoRV, HindIII, HaeII, HinfI, PstI, PvuII, Sau3A, SaII, StyI were used. The restriction enzymes were chosen according to the B. melitensis 16 M genomic sequences of the above-listed genes.

2.4. Nuceotide sequence and data analysis

PCR products of the expected sizes were purified from 1% agarose gels (Invitrogen) with a QIAquick gel extraction kit (Qiagen GmbH, Hilden, Germany), cloned into pGEM-T Easy vector (Promega, Madison, Wis.), and transformed into competent JM109 Escherichia coli cells (Promega). The transformants were selected with ampicillin, and recombinants were selected by blue-white differentiation. Plasmids were isolated from several clones with a Qiagen Plasmid Mini kit. To check for the presence of the correct insert, plasmids were digested with EcoRI and the restriction products were separated on 1% agarose gels. Nucleotide sequencing of clone was performed by automated cycle sequencing with Big Dye terminators (ABI 377XL; PE Applied Biosystems, Foster City, Calif.) and primers RP (reverse primer) and UP (universal primer M13-20). Multiple DNA and amino acid sequence alignments were performed with CLUSTAL W http://www2.ebi.ac.uk/clustalw/.

Nucleotide sequence accession numbers

The Brucella nucleotide sequences determined in this work have been deposited in the GenBank/EMBL/DDBJ databases under the following accession numbers: FJ376556, FJ 376557 for the manBgene of B. pinnipedialis B2/94 and B. ceti B1/94.

Authors' contributions

MSZ, IM and AC conceived the study. MSZ designed and performed the experimental work. All authors analyzed the data. MSZ wrote the manuscript. IM, and AC helped to draft the manuscript. All authors read, corrected and approved the final manuscript.