Rickettsia spp. in ticks, Poland.

Ticks are recognized as the main vectors and reservoirs of spotted fever group rickettsiae. We searched for the most prevalent Rickettsia spp. in Poland and found R. slovaca and R. helvetica bacteria in ticks in southern and central Poland; R. raoulti was found in ticks in all parts of Poland.

Ticks are ectoparasites infesting many mammals, including humans and their pets. In Poland, Ixodes ricinus ticks are widely distributed throughout the country whereas Dermacentor reticulatus ticks are limited to the northeast region. Both I. ricinus and D. reticulatus ticks are known to be the main vectors and reservoirs of the spotted fever group rickettsiae (SFG) worldwide. Detection of the SFG pathogens requires a 2-step procedure: PCR and sequencing of selected genes (16S rRNA, citrate synthase [gltA], outer membrane protein A [ompA], ompB, and 17-kDa protein) (–). The aim of the present study was to identify and characterize rickettsial species occurring in ticks in Poland.

The Study

We collected 214 ticks in 3 regions of Poland: the Warsaw region (central Poland) (107 I. ricinus ticks), the Radomsko region (southern Poland) (47 I. ricinus ticks), and the Bialowieza Primeval Forest National Park (northeastern Poland) (60 D. reticulatus ticks). The specimens were collected from April 2005 through August 2007 and identified on the basis of morphologic characteristics. All I. ricinus ticks were obtained from dogs and cats, and D. reticulatus ticks were collected from vegetation.

DNA was extracted from I. ricinus specimens by using the QIAamp DNA Tissue Kit (QIAGEN, Hilden, Germany). D. reticulatus specimens were crushed in Eppendorf (Hamburg, Germany) tubes, after which DNA extraction was performed by boiling the specimens in 200 μL of 0.7 M NH4OH for 30 min.

Bacterial DNA was examined for the Rickettsia spp. gltA gene by using RpCS.409d and RpCS.1258n primers. Each positive specimen was amplified with paired primers Rr190-70 and Rr190-701, which were specific for the SFG rickettsiae ompA gene. In the absence of amplifiable fragments of the ompA gene, molecular identification was conducted by using PCR with paired primers Rr17.61p and Rr17.492n, which are able to anneal the specific 17-kDa outer membrane protein gene (Table 1).

Table 1

Oligonucleotide primers used for PCR amplification and sequencing of rickettsial species in ticks, Poland, 2005–2007

No.	Primers	Fragment gene (size, bp)	Nucleotide sequences (5′ → 3′)	Reference
1	RpCS.409d	Citrate synthase (850)	CCTATGGCTATTATGCTTGC	(5)
	RpCS.1258n		ATTGCAAAAAGTACAGTGAACA
2	Rr190-70	Outer membrane protein A (632)	ATGGCGAATATTTCTCCAAAA	(3)
	Rr190-701		GTTCCGTTAATGGCAGCATCT
3	Rr17.61p	17-kDa genus-common antigen (434)	GCTCTTGCA ACT TCT ATG TT	(7)
	Rr17.492n		CATTGTTCGTCAGGTTGGCG

The QIAquick PCR Purification Kit (QIAGEN) was used to purify PCR products for sequencing. All amplicons were sequenced with the ABI Prism 377 DNA Sequencer (Applied Biosystems, Foster City, CA, USA) in accordance with the manufacturer’s recommendations. All sequences were edited by using the AutoAssembler software (Applied Biosystems), identified with the BLAST software (http://blast.ncbi.nlm.nih.gov/Blast.cgi), and compared with sequences available in GenBank.

The DNA of Rickettsia spp. was found in 70 (32.7%) I. ricinus and D. reticulatus ticks by using PCR and primers specific for the gltA gene. All 70 tick samples that tested positive for the genus Rickettsia were subjected to amplification with primers specific for the ompA gene. Twenty-eight I. ricinus and 34 D. reticulatus ticks were positive in PCR for the specific ompA fragment. In DNA samples extracted from 8 I. ricinus specimens (7 negative for the ompA gene and 1 having a faint reaction to the gltA gene), gene fragments characteristic of the 17-kDa protein were found.

Sequences of the gltA gene fragment (688 nt) from 62 samples were identical to the R. raoultii Marne and R. raoultii Khabarovsk strain sequences (GenBank accession nos. DQ365803.1 and DQ 365804.1). Results were confirmed by sequencing the ompA fragment; all 62 showed 99%–100% nucleotide similarity with the ompA gene (610 nt) of the R. raoultii Marne and the R. raoultii Khabarovsk strains (GenBank accession nos. DQ365799.1 and DQ365801.1).

Seven sequences of the gltA gene fragment amplicons were identical with the R. helvetica gltA gene (GenBank accession nos. U59723.1 and DQ131912.1). These samples also had 100% identical sequences of the 17-kDa protein gene characteristic of R. helvetica (GenBank accession nos. EF392726.1 and AJ427881.1).

The sequence of 1 amplicon with primers specific for the ompA gene showed 99% similarity with the R. slovaca ompA gene (GenBank accession no. U43808.1). Sequencing of PCR products with primers specific for the gltA and 17-kDa protein gene were not conducted due to the small amount of DNA in the sample and also due to poor amplification.

R. raoultii DNA was detected in 34 (56.7%) of the 60 D. reticulatus specimens from Bialowieza and in 28 (18.2%) of the 154 I. ricinus specimens tested, including 25 (23.4%) of 107 from the Warsaw region in central Poland and 3 (6.4%) of 47 I. ricinus specimens from the Radomsko region in the south. R. helvetica and R. slovaca were noted exclusively in DNA extracted from the I. ricinus ticks. In 3 (2.8%) of the 107 ticks from the Warsaw area, DNA of R. helvetica was found. In the Radomsko area, 4 (8.5%) of 47 specimens had R. helvetica DNA, and 1 (2.1%) had R. slovaca DNA (Table 2).

Table 2

Rickettsia spp. detected in ticks (N = 214) from 3 regions of Poland, 2005–2007

Rickettsia sp.	Total no. (%) ticks positive	Białowieża,* Dermacentor reticulatus ticks (n = 60), no. (%) positive	Radomsko,† Ixodes ricinus ticks (n = 47), no. (%) positive	Warszawa,‡ I. ricinus ticks (n = 107), no. (%) positive
R. helvetica	7 (3.3)	0	4 (8.5)	3 (2.8)
R. slovaca	1 (0.5)	0	1 (2.1)	0
R. raoultii	62 (29.0)	34 (56.7)	3 (6.4)	25 (23.4)

*Eastern Poland.
†Southern Poland.
‡Central Poland.

Conclusions

The DNA of R. raoultii was found in Ixodes spp. ticks in southern Poland and in Dermacentor spp. ticks in northeastern Poland. Until recently, R. raoultii had been reported only in D. nutallii, Rhipicephalus sp., and Dermacentor sp. ticks in Europe and Asia (i.e., Siberia and the Astrakhan area) (–).

SFG rickettsiae in Poland have been previously noted solely in D. reticulatus ticks (). The gltA gene fragment sequence demonstrated similarities with R. honei and other unidentified SFG rickettsiae. The nucleotide sequences of amplified fragments of the ompA gene were 98% homologous to RpA4 Rickettsia sp.

Our findings show that R. raoultii occur in all regions of Poland. These bacteria were noted in 18.2% of I. ricinus and 56.7% of D. reticulatus specimens. Their occurrence in various species of ticks may suggest that they are capable of being distributed all over Europe.

Although the pathogenic role of these genotypes has not yet been established, their ability to cause infection cannot be ruled out. In fact, the RpA4 strain has been isolated from a patient with symptoms resembling those of R. slovaca infection (D. Raoult, unpub. data) (). R. slovaca, a member of the SFG rickettsiae, was isolated from D. marginatus ticks in Slovakia in 1968 (). Research has established that this bacterium is widely distributed and has been isolated from D. marginatus, I. ricinus, Haemaphisalis spp., and Argas ticks in many countries (). From a medical standpoint, R. slovaca infection seems to be the most important SFG rickettsiosis in central Europe because of the severe and characteristic symptoms that occur after being bitten by these ectoparasites.

R. helvetica, which was detected in Switzerland in 1979, is also widespread in Europe. This species has recently been found in I. ricinus ticks in the northern part of Poland (). Our study also confirms the occurrence of R. helvetica in central and southern Poland. These reports suggest that R. helvetica can infect I. ricinus ticks and may be extensively distributed in several European countries, including Poland. The pathogenicity of R. helvetica as a self-limiting illness associated with headache, myalgias, rash, or eschar has been confirmed. Also, several patients with perimyocarditis associated with R. helvetica have been observed in Sweden ().

Our findings indicate that SFG rickettsiae transmitted by ticks could penetrate biotopes in various parts of Europe. Though the pathogenicity of the newly recognized species of the genus Rickettsia has not yet been proven definitively, it is prudent for clinicians in Poland and other European countries to be alert to possible appearances of infections caused by these pathogens.