Literature DB >> 19186010

Respiratory disease in calves: microbiological investigations on trans-tracheally aspirated bronchoalveolar fluid and acute phase protein response.

Oystein Angen1, John Thomsen, Lars Erik Larsen, Jesper Larsen, Branko Kokotovic, Peter M H Heegaard, Jörg M D Enemark.   

Abstract

Trans-tracheal aspirations from 56 apparently healthy calves and 34 calves with clinical signs of pneumonia were collected in six different herds during September and November 2002. The 90 samples were cultivated and investigated by PCR tests targeting the species Histophilus somni, Mannheimia haemolytica, Pasteurella multocida, Mycoplasma bovis, Mycoplasma dispar, and Mycoplasma bovirhinis. A PCR test amplifying the lktC-artJ intergenic region was evaluated and shown to be specific for the two species M. haemolytica and Mannheimia glucosida. All 90 aspirations were also analyzed for bovine respiratory syncytial virus (BRSV), parainfluenza-3 virus, and bovine corona virus by antigen ELISA. Surprisingly, 63% of the apparently healthy calves harbored potentially pathogenic bacteria in the lower respiratory tract, 60% of these samples contained either pure cultures or many pathogenic bacteria in mixed culture. Among diseased calves, all samples showed growth of pathogenic bacteria in the lower respiratory tract. All of these were classified as pure culture or many pathogenic bacteria in mixed culture. A higher percentage of the samples were positive for all bacterial species in the group of diseased animals compared to the clinically healthy animals, however this difference was only significant for M. dispar and M. bovirhinis. M. bovis was not detected in any of the samples. BRSV was detected in diseased calves in two herds but not in the clinically healthy animals. Among the diseased calves in these two herds a significant increase in haptoglobin and serum amyloid A levels was observed compared to the healthy calves. The results indicate that haptoglobin might be the best choice for detecting disease under field conditions. For H. somni and M. haemolytica, a higher percentage of the samples were found positive by PCR than by cultivation, whereas the opposite result was found for P. multocida. Detection of P. multocida by PCR or cultivation was found to be significantly associated with the disease status of the calves. For H. somni a similar association with disease status was only observed for cultivation and not for PCR.

Entities:  

Mesh:

Substances:

Year:  2009        PMID: 19186010      PMCID: PMC7117372          DOI: 10.1016/j.vetmic.2008.12.024

Source DB:  PubMed          Journal:  Vet Microbiol        ISSN: 0378-1135            Impact factor:   3.293


Introduction

Respiratory disease in calves causes great economic losses for the dairy and beef industry worldwide (Snowder et al., 2006). Blom (1982) reported that the annual calf mortality between day 2 and 180 was 7% in Danish dairy herds. He reported that on average 4.5% of the calves died due to respiratory disease. A mortality rate in the range 1.5–4.2% has also been reported from other countries (Ames, 1997, Andrews, 2000). In Denmark, bovine respiratory syncytial virus (BRSV) and coronavirus are the most common viral agents found in relation to calf pneumonia (Larsen et al., 1999). Histophilus somni, Pasteurella multocida, Mannheimia haemolytica, and Arcanobacterium pyogenes are the bacteria most commonly isolated from calf pneumonia (Tegtmeier et al., 1999). Several Mycoplasma species have been isolated in Denmark from bovine lungs. Friis and Krogh (1983) found Mycoplasma dispar, Mycoplasma bovirhinis, and Ureaplasma spp. to be the most prevalent of these, whereas Mycoplasma bovis and Mycoplasma bovigenitalium were isolated infrequently. The aim of the present investigation was to study the presence and interaction of bacteria and virus in the lower respiratory tract in calves with and without clinical symptoms of respiratory disease from six Danish herds. In addition, the serum concentrations of haptoglobin and serum amyloid A (SAA) were determined to describe the correlation between the presence of infectious agents and acute phase protein response. In order to avoid contamination from bacteria resident in the upper respiratory tract, the sampling was performed by trans-tracheal aspiration. This method has been recommended as optimal for evaluation of the microbiological status of the lower respiratory tract in order to elucidate the etiology of pneumonia in an animal (Espinasse et al., 1991, Rebbun, 1995, Virtala et al., 1996, Pommier, 1999, Pommier and Wessel, 2002). Finally, an aim was to evaluate whether PCR tests are suitable for obtaining a reliable and quick diagnosis of pneumonia related to bacterial pathogens.

Materials and methods

Herds and samples

The investigation included six dairy herds, which in previous years had experienced problems with calf pneumonia during the winter period. In September 2002, 56 trans-tracheally aspirated samples were taken from clinically healthy animals in these herds (herds 1, 3, 4, and 6: 10 samples; herd 2: 9 samples; herd 5: 7 samples). In November 34 samples from calves suffering from respiratory distress were taken from 4 of the herds (herd 1: 10 samples; herd 3: 13 samples; herd 5: 6 samples; herd 6: 5 samples). No animals were treated by antibiotics at the time of sampling. In two herds (herds 2 and 4), respiratory disease was not observed and, consequently, no samples were taken. In total, 90 trans-tracheal aspirations were obtained. The first samples were taken during a warm and dry September from clinically healthy calves (rectal temperatures below 39.5 °C, no nasal discharge, no coughing, and an unprovoked respiration frequency lower than 40 min−1). All calves sampled in November showed clinical symptoms of pneumonic disease. Clinical disease was defined as a rectal temperature above 39.5 °C in connection with nasal discharge, coughing, or an unprovoked respiration frequency higher than 40 min−1. The age of the calves ranged from 14 days to 4 months. The average age of the clinically healthy calves sampled in September was 2.1 months (S.D. = 1.1) and for the pneumonic calves sampled in November 2.8 months (S.D. = 0.9). Only four of the calves were sampled on both occasions (one calf in each of herd 3 and 5, and two calves in herd 6). Blood samples were taken from all clinically healthy calves in connection with the first visit in September. In addition, paired blood samples (3 weeks interval) were taken in November–December after onset of clinical disease in the four herds where pneumonia was observed. An area of 3 cm × 3 cm located 7–10 cm distal to the larynx was shaved and decontaminated with 70% alcohol and iodophors. The calves were sedated by intramuscular injection of 0.1–0.2 mg/kg xylasine. After injection of local analgesic (0.5 ml 2% lidocain), a longitudinal incision of 1 cm was made in the midline directly above the trachea. Perforation of trachea was done with an Intraflon® 12G between two cartilage rings. A male dog urinary catheter was inserted into the Intraflon® and pushed down into the airway until a slight resistance was felt. Between 20 and 40 ml sterile 0.9% NaCl were injected through the catheter and followed by immediate aspiration. This resulted normally in 5–7 ml aspirated fluid. One milliliter aspirated fluid was centrifuged for 3 min at 16,000 ×  g. The supernatant was removed and a loopful (approx. 10 μl) of the sedimented material was used for bacterial cultivation. The growth of the different bacterial species was recorded on a semi-quantitative scale (pure culture, many bacteria in mixed culture, mixed culture, few bacteria in mixed culture, no growth). Bacterial identification was done according to the standard procedures of the laboratory (Tegtmeier et al., 1999). For M. haemolytica, the identification was based on the methods given by Angen et al. (2002). The identification of H. somni was performed by PCR as described by Angen et al. (1998). Cultivation and identification of Mycoplasma spp. were performed according to the procedures described by Friis and Krogh (1983). The samples had been stored at −20 °C for 2 years before cultivation for mycoplasmas was initiated. The collection of samples in the herds was performed in connection with herd diagnosis by a trained veterinary surgeon according to the Law for veterinarians in Denmark and is thereby accepted by the Danish Animal Experiments Inspectorate.

PCR detection

DNA was extracted by the addition of 200 μl PrepMan™ Ultra (Applied Biosystems) to the sedimented trans-tracheal sample according to the manufacturer's recommendations. The DNA preparation was stored at −20 °C until used for PCR analysis. Species-specific detection using previously published methods was performed for H. somni (Angen et al., 1998), P. multocida (Miflin and Blackall, 2001), M. dispar and M. bovirhinis (Miles et al., 2004), and M. bovis (Subramaniam et al., 1998) using 2 μl of the extracted DNA per reaction. For M. haemolytica, the lktA-artJ intergenic region was used for PCR amplification. From pure cultures, one bacterial colony was resuspended in 100 μl distilled water and lysed by boiling for 10 min. One microliter sample from lysed bacteria or 2 μl of DNA extracted by PrepMan™ Ultra was added to respectively 49 and 48 μl prepared reaction mixture containing 10 mM Tris/HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 100 μM of each dNTP, 65 pmol of each primer (forward primer: GTCCCTGTGTTTTCATTATAAG; reverse primer: CACTCGATAATTATTCTAAATTAG), and 0.5 U of Taq polymerase (Applied Biosystems, Foster City, CA, USA). The reaction mixture was covered with 50 μl of paraffin oil. Samples were subjected to an initial denaturation step at 94 °C for 3 min followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 58 °C for 1 min, and extension at 72 °C for 1 min in a thermal cycler. Samples of PCR amplification products (10 μl) were subjected to electrophoresis in a 1.2% agarose gel in Tris/borate buffer according to standard protocols. DNA was visualized by UV fluorescence after staining with ethidium bromide. The PCR test was expected to give a specific amplicon of 385 bp. For evaluation of the species specificity of this test, see supplementary material.

Detection of viral antigens and antibodies to BRSV

The trans-tracheal aspirations were investigated for the presence of antigens from BRSV, parainfluenza-3 virus (PI-3) and corona virus using the ELISA tests described by Uttenthal et al. (1996). Blood samples from diseased calves were tested for IgG1 antibodies against BRSV according to Uttenhal et al. (2000).

Measurement of acute phase proteins

Serum haptoglobin and SAA were determined as earlier described (Heegaard et al., 2000). For these analyses, only the sera from diseased calves in herds 1, 3, and 5 were available in addition to the sera from clinically healthy calves in all herds.

Statistical methods

Differences in frequencies were evaluated using least-squares test statistics and the relationship between disease status and test results by a logistic regression model evaluated with the chi-square test using the statistical software package S-Plus 6.1 for Windows (Profession Release 1; Insightful). Data from the acute phase protein measurements were analyzed using a two-sided t-test. The similarity of the different populations was tested using the Mann–Whitney non-parametric test as some of the sample sets proved to be not normally distributed.

Results

Clinically healthy animals

Among the 56 clinically healthy calves, potentially pathogenic bacteria were detected either by cultivation or PCR from 68% of the animals (Table 1 ), this number varied from 29 to 90% between the herds (Table 2 ). Bacteria were cultivated from 33 samples (59%). From 18 of the calves (32%), H. somni, P. multocida, M. haemolytica, or A. pyogenes were isolated in high numbers in pure culture or as the dominating flora in a mixed culture. From three of the calves only few P. multocida in pure culture was cultivated. M. dispar and M. bovirhinis were detected by PCR from 21 and 14% of the samples, respectively. M. bovis was not detected. Forty-one percent of the samples tested positive in one or more of the PCR tests applied. By cultivation or PCR, P. multocida was detected in 48%, H. somni in 20%, and M. haemolytica in 23% of the calves. A. pyogenes was isolated from three of the calves and Moraxella sp. from one calf. From 23 samples (41%) two or more bacterial species were detected. Only one of the samples contained virus antigens (corona virus).
Table 1

Bacteriological investigation of trans-tracheally aspirated bronchoalveolar fluid from clinically normal calves (n = 56) and calves with pneumonia (n = 34) from six Danish herds.

Clinically normal calves (% positive)
Diseased calves (% positive)
Cultivation or PCRCultivationPCRCultivation or PCRCultivationPCR
Pasteurella multocida484332828274
Histophilus somni20420412938
Mannheimia haemolytica23162329629
Arcanobacterium pyogenes55ND66ND
Moraxella sp.22ND33ND
Mycoplasma disparNDND21NDND79
Mycoplasma bovirhinisNDND14NDND79
Mycoplasma bovisNDND0NDND0



Total number of positive samples68594110010097

ND: not done.

Table 2

Herd prevalences (%) of pathogenic microorganisms found in trans-tracheally aspirated bronchoalveolar fluid from clinically normal calves (N) and calves with pneumonia (P) from six Danish herds.

Microorganism presentHerd 1
Herd 2a
Herd 3
Herd 4a
Herd 5
Herd 6
N
P
N
N
P
N
N
P
N
P
n = 10n = 10n = 9n = 10n = 13n = 10n = 7n = 6n = 10n = 5
Pasteurella multocida60404450100502910050100
Histophilus somni30901100300504040
Mannheimia haemolytica10301120312014176040
Arcanobacterium pyogenes01022000017100
Moraxella sp.00000014000
Mycoplasma dispar050440922014835020
Mycoplasma bovirhinis0701110851029673080
Mycoplasma bovis0000000000



No bacteria detected3002250020710100



BRSV-antigen06000100000b00b
PI-3 antigen0000000000
Coronavirus antigen040000014000

Pneumonic disease not observed during study period.

No seroconversion to BRSV detected in herds 5 and 6.

Bacteriological investigation of trans-tracheally aspirated bronchoalveolar fluid from clinically normal calves (n = 56) and calves with pneumonia (n = 34) from six Danish herds. ND: not done. Herd prevalences (%) of pathogenic microorganisms found in trans-tracheally aspirated bronchoalveolar fluid from clinically normal calves (N) and calves with pneumonia (P) from six Danish herds. Pneumonic disease not observed during study period. No seroconversion to BRSV detected in herds 5 and 6.

Diseased animals

Among the 34 diseased animals, potentially pathogenic bacteria were isolated in high numbers in pure culture or as the dominant flora in a mixed culture from all animals (Table 1). P. multocida, H. somni, and M. haemolytica were cultivated or detected by PCR in 82, 41, and 29% of the calves, respectively. A. pyogenes was isolated from two of the calves and Moraxella sp. from one calf. M. dispar and M. bovirhinis were both detected from 79% of the calves. M. bovis was not detected. From 33 of the samples (97%) two or more bacterial species were detected. A higher percentage of the samples were positive for all bacterial species investigated in the group of diseased animals compared to the clinically healthy animals, however this difference was statistical significant only for M. dispar and M. bovirhinis (p  < 0.01 for both).

Herd prevalences

Some differences between the herds in the prevalence of the different microorganisms were observed (Table 2). P. multocida, M. haemolytica, M. dispar and M. bovirhinis were found in all six herds. H. somni was found in all herds except for herd 3. Coronavirus antigen was only detected in herds 1 and 5. BRSV-antigens were detected in 60 and 100% of the calves from herds 1 and 3, respectively (Table 2). In herds 5 and 6, no BRSV-antigens were detected. The test of paired sera from these two herds showed that seroconversion to BRSV had not taken place. M. bovis and PI-3 were not detected in any of the herds.

PCR and cultivation

For H. somni and M. haemolytica, a significantly higher number of samples were found positive by the PCR tests than by cultivation (p  = 0.04 and 0.01, respectively). For P. multocida, a higher number of samples were found positive by cultivation than by PCR but the difference was not statistically significant (p  = 0.10). There was a significant correlation between detection of H. somni by cultivation and pneumonia (p  < 0.01) but no significant correlation between the presence of pneumonia and detection of H. somni by PCR (p  = 0.05). For P. multocida a significant correlation (p  < 0.01) was found between disease status and both cultivation and PCR, whereas there were no significant correlations observed for the detection of M. haemolytica and disease status. Cultivation for mycoplasma was performed on 10 samples representing each sampling event per herd. M. dispar was isolated from five of these samples and M. bovirhinis from two samples.

Acute phase proteins

Comparing the three diseased versus healthy calf populations within each of the herds 1, 3 and 5, statistically significant differences were found for haptoglobin as well as SAA concentrations for all herds with the clear exception of SAA in herd 5 where no difference was found (Fig. 1 ). Haptoglobin concentrations also showed a less significant increase in herd 5 compared to herds 1 and 3. This increase was, however, significant for all three herds. The SAA concentrations of the healthy populations were generally closer to the values of the diseased calves than what was found for haptoglobin. Thus, for SAA both herd 3 and 5 diseased populations were not significantly different from the healthy population taken as a whole.
Fig. 1

Concentrations of haptoglobin (top) and SAA (bottom) in the different populations of animals sampled at the different farms as indicated. Mean values and S.D. are given for each population sampled. Significance of differences between healthy and diseased populations within the same herd is indicated by stars as explained in the figure.

Concentrations of haptoglobin (top) and SAA (bottom) in the different populations of animals sampled at the different farms as indicated. Mean values and S.D. are given for each population sampled. Significance of differences between healthy and diseased populations within the same herd is indicated by stars as explained in the figure.

Discussion

In the present investigation, 68% of the clinically healthy calves were found to harbor potentially pathogenic bacteria in the lower respiratory tract. Only a limited number of reports have been published on the normal flora of the lower respiratory tract. Viso et al. (1982) sampled 23 healthy animals and found bacteria in 52% of the calves and 83% of these bacteria were identified as “Pasteurella sp.”. Espinasse et al. (1991) performed trans-tracheal aspiration on 49 healthy calves. P. multocida and M. haemolytica were each found in eight of these calves. Virtala et al. (1996) also performed trans-tracheal aspiration on 47 healthy calves and found 55% of these to harbor pathogenic bacteria, finding Mycoplasma spp. and P. multocida in 47 and 17% of the samples, respectively. Autio et al. (2007) investigated a group of 144 healthy calves by tracheobronchial lavage using a double catheter and found pathogenic bacteria (excluding mycoplasmas), Mycoplasma spp., and pathogenic bacteria including mycoplasmas in 27, 75, and 83% of the samples, respectively. However, none of these investigations reported the quantity of bacteria isolated in the healthy animals. In the present investigation, a striking observation was that 32% of the healthy calves harbored bacteria in the lower respiratory tract in high numbers without showing clinical disease. These observations underline the multi-factorial nature of calf pneumonia and supports earlier reports that bacteria seldom act as primary pathogens in relation to calf pneumonia (Tegtmeier et al., 1999, Tegtmeier et al., 2000a). Both Baudet et al. (1994) and Babiuk et al. (1988) concluded that virus-infections precede 90% of all bacterial pneumonias. Samples from clinically diseased animals were only obtained from four of the six herds. Among the calves in herds 1 and 3, BRSV-antigens could be detected in 83% of the diseased calves. In these herds, a viral infection is probably the primary cause for the development of clinical disease. These observations are in accordance with previous results, showing that BRSV plays an important role for the development of calf pneumonia in Denmark (Larsen et al., 1999, Uttenhal et al., 2000). On the other hand, no BRSV-antigens could be detected in herds 5 and 6 and the test of paired sera from these two herds showed that seroconversion to BRSV had not taken place. Consequently, the etiology of pneumonic disease in these two herds was probably dependent on the presence of bacteria alone. However, as a number of different bacterial species were isolated from these herds and no autopsies were performed, firm conclusions about the etiology of the observed pneumonia cannot be drawn. A general conclusion from the present study is that haptoglobin is the more sensitive indicator of disease in the herds investigated, while neither haptoglobin nor SAA levels were affected by the potentially harmful agents in the lower respiratory tract if animals were healthy. SAA concentrations of the healthy calves were much closer to those of the diseased populations than what was found for haptoglobin. Of the three herds in which healthy and diseased populations were compared to each other, BRSV could be demonstrated in the diseased subpopulations of herds 1 and 3 but not in the diseased population of herd 5. SAA concentrations in herd 5 did not differ between the diseased and the normal subpopulation. This might indicate that SAA needs virus to be present in order to respond while haptoglobin is fully induced by bacterial infection alone. It has previously been shown that SAA seems to be a more sensitive marker for viral infections (Heegaard et al., 2000) and acute inflammation (Alsemgeest et al., 1994, Horadagoda et al., 1999) compared to haptoglobin. In experimental bacterial infections (intra-tracheal inoculation of M. haemolytica), SAA was found to be more rapidly induced than haptoglobin (Horadagoda et al., 1994). The results presented here show that even if SAA is more sensitive and rapidly reacting, haptoglobin might be preferable in the field, its bigger and more prolonged response giving rise to its higher sensitivity in detecting disease. In the present investigation, a higher percentage of the samples were found positive for P. multocida, M. dispar, M. bovirhinis and H. somni in the group of diseased animals compared to the clinically healthy animals (Table 1), this increase was however not statistically significant. In herds 3, 5, and 6, P. multocida was found in all diseased animals, indicating a possible role for this organism in the development of pneumonia. Autio et al. (2007) also reported an association between P. multocida and clinical respiratory disease among calves in Finland, provided P. multocida was found together with other bacterial pathogens. This supports the common opinion that P. multocida should be regarded as an opportunistic pathogen (Maheswaran et al., 2002). On the other hand, Nikunen et al. (2007) in another Finnish study found strong indications for P. multocida having a pathogenic role, provided other known pathogens were absent. Virtala et al. (1996) found a significant association between clinical disease and increased isolation rate of P. multocida and Mycoplasma spp., alone or in combination. In the present investigation we found a significantly higher detection rate of M. dispar and M. bovirhinis among clinically diseased calves although a high proportion of the healthy calves also harbored these organisms. On the other hand, in two Finnish studies, no association between clinical disease and the presence of Mycoplasma spp. was observed (Autio et al., 2007, Nikunen et al., 2007). M. bovis is in many countries regarded as one of the major causes of respiratory disease in cattle with reports of increasing prevalence (Nicholas and Ayling, 2003). M. bovis was not found in any of the six herds in the present investigation. Earlier studies in Denmark have only found a low prevalence of this organism (Friis and Krogh, 1983, Feenstra et al., 1991), so apparently M. bovis is still of low importance in connection with pneumonic disease in Denmark. Cultivation of Mycoplasma spp. was attempted from 10 PCR-positive samples. However, due to the long storage time before analysis, isolation of Mycoplasma spp. was only successful from seven of these samples. The cultivation nevertheless confirmed the presence of M. dispar and M. bovirhinis in these samples as found by PCR. For H. somni and M. haemolytica, a significantly higher number of samples were found positive by the PCR tests than by cultivation. For P. multocida, a higher number of samples were found positive by cultivation than by PCR, but the difference was not statistically significant. The lower sensitivity of the P. multocida PCR compared to cultivation may be due to the large size of the amplicon produced by this method (1250 bp) compared to the H. somni and M. haemolytica PCRs (both approximately 400 bp). Detection of P. multocida by both cultivation and PCR was significantly associated with the disease status of the animal, whereas no such association was observed for M. haemolytica. A previous study on H. somni demonstrated a higher sensitivity of a species-specific PCR test (Tegtmeier et al., 2000b) compared to bacterial cultivation. However, the present investigation indicates that PCR nevertheless is less suited for prediction of H. somni-related pneumonia compared to bacterial cultivation. These observations might be related to the fact that the use of a highly sensitive method such as PCR will also detect the presence of a very low number of bacteria that not necessarily have any correlation with disease. On the other hand, a higher diagnostic value of a PCR test could be obtained if real-time PCR tests were developed, whereby the infectious agents can be quantified and give a result which might better reflect the clinical status of the animal.
  25 in total

1.  Acute phase proteins in cattle: discrimination between acute and chronic inflammation.

Authors:  N U Horadagoda; K M Knox; H A Gibbs; S W Reid; A Horadagoda; S E Edwards; P D Eckersall
Journal:  Vet Rec       Date:  1999-04-17       Impact factor: 2.695

Review 2.  Mycoplasma bovis: disease, diagnosis, and control.

Authors:  R A J Nicholas; R D Ayling
Journal:  Res Vet Sci       Date:  2003-04       Impact factor: 2.534

3.  Epidemiologic and pathologic characteristics of respiratory tract disease in dairy heifers during the first three months of life.

Authors:  A M Virtala; G D Mechor; Y T Gröhn; H N Erb; E J Dubovi
Journal:  J Am Vet Med Assoc       Date:  1996-06-15       Impact factor: 1.936

4.  Viral aetiology of enzootic pneumonia in Danish dairy herds: diagnostic tools and epidemiology.

Authors:  A Uttenthal; N P Jensen; J Y Blom
Journal:  Vet Rec       Date:  1996-08-03       Impact factor: 2.695

5.  Diagnosis of enzootic pneumonia in Danish cattle: reverse transcription-polymerase chain reaction assay for detection of bovine respiratory syncytial virus in naturally and experimentally infected cattle.

Authors:  L E Larsen; K Tjørnehøj; B Viuff; N E Jensen; A Uttenthal
Journal:  J Vet Diagn Invest       Date:  1999-09       Impact factor: 1.279

6.  Species identification of Mycoplasma bovis and Mycoplasma agalactiae based on the uvrC genes by PCR.

Authors:  S Subramaniam; D Bergonier; F Poumarat; S Capaul; Y Schlatter; J Nicolet; J Frey
Journal:  Mol Cell Probes       Date:  1998-06       Impact factor: 2.365

7.  Aerosol challenge of calves with Haemophilus somnus and Mycoplasma dispar.

Authors:  C Tegtmeier; S N Grell; U Riber; N F Friis
Journal:  Vet Microbiol       Date:  2000-03-15       Impact factor: 3.293

8.  The acute phase response of haptoglobin and serum amyloid A (SAA) in cattle undergoing experimental infection with bovine respiratory syncytial virus.

Authors:  P M Heegaard; D L Godson; M J Toussaint; K Tjørnehøj; L E Larsen; B Viuff; L Rønsholt
Journal:  Vet Immunol Immunopathol       Date:  2000-11-23       Impact factor: 2.046

9.  Association of bovine respiratory disease with clinical status and acute phase proteins in calves.

Authors:  S Nikunen; H Härtel; T Orro; E Neuvonen; R Tanskanen; S-L Kivelä; S Sankari; P Aho; S Pyörälä; H Saloniemi; T Soveri
Journal:  Comp Immunol Microbiol Infect Dis       Date:  2007-01-26       Impact factor: 2.268

Review 10.  Dairy calf pneumonia. The disease and its impact.

Authors:  T R Ames
Journal:  Vet Clin North Am Food Anim Pract       Date:  1997-11       Impact factor: 3.357

View more
  48 in total

Review 1.  Acute phase response in animals: a review.

Authors:  Carolyn Cray; Julia Zaias; Norman H Altman
Journal:  Comp Med       Date:  2009-12       Impact factor: 0.982

2.  Infant baboons infected with respiratory syncytial virus develop clinical and pathological changes that parallel those of human infants.

Authors:  James F Papin; Roman F Wolf; Stanley D Kosanke; Justin D Jenkins; Sara N Moore; Michael P Anderson; Robert C Welliver
Journal:  Am J Physiol Lung Cell Mol Physiol       Date:  2013-02-15       Impact factor: 5.464

3.  Association of plasma haptoglobin concentration and other biomarkers with bovine respiratory disease status in pre-weaned dairy calves.

Authors:  Sonia J Moisá; Sharif S Aly; Terry W Lehenbauer; William J Love; Paul V Rossitto; Alison L Van Eenennaam; Sophia C Trombetta; Eduarda M Bortoluzzi; Lindsey E Hulbert
Journal:  J Vet Diagn Invest       Date:  2018-10-17       Impact factor: 1.279

4.  Changes in serum protein electrophoresis profiles and acute phase proteins in calves with diarrhea.

Authors:  Kyoung-Seong Choi; Jin-Hee Kang; Hyung-Chul Cho; Do-Hyeon Yu; Jinho Park
Journal:  Can J Vet Res       Date:  2021-01       Impact factor: 1.310

5.  Diversity of bacterial species in the nasal cavity of sheep in the highlands of Ethiopia and first report of Histophilus somni in the country.

Authors:  Biruk Tesfaye; Tesfaye Sisay Tessema; Genene Tefera
Journal:  Trop Anim Health Prod       Date:  2013-01-19       Impact factor: 1.559

Review 6.  Innate immunology of bovine respiratory disease.

Authors:  Mark R Ackermann; Rachel Derscheid; James A Roth
Journal:  Vet Clin North Am Food Anim Pract       Date:  2010-05-14       Impact factor: 3.357

7.  Pathogens of bovine respiratory disease in North American feedlots conferring multidrug resistance via integrative conjugative elements.

Authors:  Cassidy L Klima; Rahat Zaheer; Shaun R Cook; Calvin W Booker; Steve Hendrick; Trevor W Alexander; Tim A McAllister
Journal:  J Clin Microbiol       Date:  2013-11-20       Impact factor: 5.948

8.  Intestinal infection following aerosol challenge of calves with Mycobacterium avium subspecies paratuberculosis.

Authors:  Susanne W F Eisenberg; Ad P Koets; Mirjam Nielen; Dick Heederik; Rienske Mortier; Jeroen De Buck; Karin Orsel
Journal:  Vet Res       Date:  2011-12-03       Impact factor: 3.683

9.  Prevalence and Risk Factors Associated With Antimicrobial Resistance in Bacteria Related to Bovine Respiratory Disease-A Broad Cross-Sectional Study of Beef Cattle at Entry Into Canadian Feedlots.

Authors:  Sara Andrés-Lasheras; Reuben Ha; Rahat Zaheer; Catrione Lee; Calvin W Booker; Craig Dorin; Joyce Van Donkersgoed; Rob Deardon; Sheryl Gow; Sherry J Hannon; Steve Hendrick; Michele Anholt; Tim A McAllister
Journal:  Front Vet Sci       Date:  2021-07-01

10.  Design of a High-Throughput Real-Time PCR System for Detection of Bovine Respiratory and Enteric Pathogens.

Authors:  Nicole B Goecke; Bodil H Nielsen; Mette B Petersen; Lars E Larsen
Journal:  Front Vet Sci       Date:  2021-06-24
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.