| Literature DB >> 19014520 |
Qumar Parwez1, Susanne Stemmler, Jörg T Epplen, Sabine Hoffjan.
Abstract
BACKGROUND: Atopic dermatitis (AD) is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP), eosinophil-derived neurotoxin (EDN), eosinophil peroxidase (EPO) and major basic protein (MBP). Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls.Entities:
Mesh:
Substances:
Year: 2008 PMID: 19014520 PMCID: PMC2596079 DOI: 10.1186/1477-5751-7-9
Source DB: PubMed Journal: J Negat Results Biomed ISSN: 1477-5751
Polymorphisms typed in the EDN, ECP, EPO and MBP genes.
| rs2013109 | Intron 1 | - | F: GGGTAAGTCAACGATCCCCAG | 69°C | HpyF10VI | |
| rs10132319 | Intron 1 | - | F: GGGTAAGTCAACGATCCCCAG | 65°C | AciI | |
| rs17792481 | Intron 1 | - | F: TGAGGGAGAGGTGAGCTGAAGT | 58°C | MboI | |
| rs2073342 | Exon 2 | T124R | F: TACGCTGCCCTCATAACAGAACT | 58°C | PstI | |
| rs2233860 | 3' UTR | - | F: GTATGCAGACAGACCAGGAAGGA | 61°C | RsaI | |
| rs11652709 | Exon 4 | Q122H | F: CTACCCTGGCCTGGAGTAGAAG | 64°C | HpyF10VI | |
| rs3785496 | Intron 6 | - | F: ACTGGTTGTCACTTCCCCTCTC | 58°C | MseI | |
| rs490358 | Exon 2 | - | F: GGAAAAAACAGAGAAAGAAAGACTGAA | 58°C | BslI | |
| rs3741098 | Intron 3 | - | F: TGGTGGACAAAAACCTTACGTGTC | 58°C | BsaHI |
Genotype frequencies of EDN, ECP, EPO and MBP polymorphisms in AD patients and controls.
| rs2013109 | C/C | 22 (6.1%) | 23 (7.1%) | 0.66 | |
| C/G | 148 (41.0%) | 123 (37.8%) | |||
| G/G | 191 (52.9%) | 179 (55.1%) | |||
| rs10132319 | Not polymorphic | - | - | - | |
| rs2073342 | A/A | 53 (14.7%) | 57 (17.6%) | 0.45 | |
| A/C | 185 (51.2%) | 152 (47.1%) | |||
| C/C | 123 (34.1%) | 114 (35.3%) | |||
| rs2073342 | C/C | 26 (7.2%) | 32 (9.8%) | 0.13 | |
| C/G | 158 (43.9%) | 120 (36.9%) | |||
| G/G | 176 (48.9%) | 173 (53.2%) | |||
| rs2233860 | C/C | 15 (4.1%) | 19 (5.9%) | 0.55 | |
| C/G | 123 (34.1%) | 104 (32.1%) | |||
| G/G | 223 (61.8%) | 201 (62.0%) | |||
| rs11652709 | C/C | 34 (9.4%) | 35 (10.8%) | 0.42 | |
| C/G | 170 (47.2%) | 137 (42.3%) | |||
| G/G | 156 (43.3%) | 152 (46.9%) | |||
| rs3785496 | G/G | 23 (6.4%) | 18 (5.6%) | 0.89 | |
| G/A | 142 (39.4%) | 130 (40.1%) | |||
| A/A | 195 (54.2%) | 176 (54.3%) | |||
| rs490358 | A/A | 29 (8.0%) | 27 (8.3%) | 0.98 | |
| A/G | 137 (38.0%) | 121 (37.2%) | |||
| G/G | 195 (54.0%) | 177 (54.5%) | |||
| rs3741089 | T/T | 99 (27.6%) | 99 (30.7%) | 0.66 | |
| T/C | 184 (51.2%) | 158 (49.1%) | |||
| C/C | 76 (21.2%) | 65 (20.2%) |
Frequencies and p-values of ECP haplotypes in AD patients and controls.
| A-G-G | 0.401 | 0.408 | 0.762 |
| C-G-G | 0.305 | 0.304 | 0.934 |
| C-C-C | 0.209 | 0.214 | 0.830 |
| C-C-G | 0.080 | 0.070 | 0.439 |