BACKGROUND: In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. DESIGN AND METHODS: In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. RESULTS: In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. CONCLUSIONS: In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.
BACKGROUND: In mammalian cells a regulatory mechanism, known as nonsense-mediated mRNA decay, degrades mRNA harboring premature termination codons. This mechanism is intron-dependent and functions as a quality control mechanism to eliminate abnormal transcripts and modulates the levels of a variety of naturally occurring transcripts. DESIGN AND METHODS: In this study, we explored the molecular mechanism of ADAMTS13 deficiency in two compound heterozygous siblings carrying a 29-nucleotide deletion mutation located in exon 3 (c.291_319delGGAGGACACAGAGCGCTATGTGCTCACCA) in one allele and a single base (A) insertion mutation (c.4143_4144insA) in the second CUB domain previously reported in the other allele. Real-time quantitative reverse transcriptase polymerase chain reaction was used to explore whether the premature termination codons introduced by the deletion of the 29 nucleotides triggered the nonsense-mediated mRNA decay. RESULTS: In vitro-expression studies demonstrated that the premature termination codons inserted by the 29 bp deletion probably lead to a reduction of ADAMTS13 mRNA levels through the regulatory mechanisms of nonsense-mRNA decay. Furthermore, the 4143_4144insA mutation causes an impairment of secretion that leads to retention of the mutant protein in the endoplasmic reticulum, as observed in immunofluorescence studies. CONCLUSIONS: In conclusion, this work reports how two different ADAMTS13 gene defects acting at two different levels, i.e, impairment of steady-state mRNA level caused by the premature termination codon mediated decay mechanism induced by the 29 bp deletion mutation and alteration of the secretion pathway due to 4143_4144insA, lead to a severe deficiency of ADAMTS13.
Authors: Luca A Lotta; Haifeng M Wu; Ian J Mackie; Marina Noris; Agnes Veyradier; Marie A Scully; Giuseppe Remuzzi; Paul Coppo; Ri Liesner; Roberta Donadelli; Chantal Loirat; Richard A Gibbs; April Horne; Shangbin Yang; Isabella Garagiola; Khaled M Musallam; Flora Peyvandi Journal: Blood Date: 2012-04-23 Impact factor: 22.113