Literature DB >> 18464910

The activation of macrophage and upregulation of CD40 costimulatory molecule in lipopolysaccharide-induced acute lung injury.

Liang Dong1, Shujuan Wang, Ming Chen, Hongjia Li, Wenxiang Bi.   

Abstract

To study the activation of macrophage and upregulation of costimulatory molecule of CD40 in lipopolysaccharide- (LPS-) induced acute lung injury (ALI) model, and to investigate the pathogenecy of ALI, mice were randomly divided into two groups. ALI model was created by injecting 0.2 mg/kg LPS in phosphate saline (PBS) in trachea. The pathologic changes of mice lungs were observed by HE staining at 24 and 48 hours after LPS treatment, then the alveolar septum damage, abnormal contraction, alveolar space hyperemia, and neutrophils or other inflammatory cells infiltration in the LPS group, but not in the control group, were observed. The expression of CD40 mRNA and CD40 protein molecules were higher in LPS group as compared to the control group by Northern blot and flow cytometry, respectively. Expression of Toll-like receptor-4 (TLR4) in activated macrophage (AMPhi) was higher in LPS group as compared to the control group by RT-PCR. The activation of NF-kappaB binding to NF-kappaB consensus oligos increased in LPS group by EMSA in macrophage. The concentrations of TNF-alpha, MIP-2, and IL-1beta cytokines from bronchoalveolar lavage fluid (BALF) were increased significantly in LPS group as compared to the control group by ELISA. The activation of AM and upregulation of costimulatory molecule CD40 induced all kinds of inflammatory cytokines releasing, then led to ALI. Therefore, both of them played vital role in the process of development of ALI.

Entities:  

Mesh:

Substances:

Year:  2008        PMID: 18464910      PMCID: PMC2359863          DOI: 10.1155/2008/852571

Source DB:  PubMed          Journal:  J Biomed Biotechnol        ISSN: 1110-7243


1. INTRODUCTION

It is well known that almost all of respiratory diseases entail acute lung injury (ALI); it is the end result of common pathways initiated by a variety of local or systemic insults leading to diffuse damage of the pulmonary parenchyma. Despite the accumulation of abundant information regarding the physiological and cellular basis of lung injury and increasing sophisticated intensive care, an improvement in prognosis has lagged behind. Therefore, the fatality rate of ALI is higher and still remains as the major cause of mortality in intensive care units (ICUs) [1]. It has become clear that there is not one mediator responsible for ALI, but rather a complex interplay including some inflammatory mediators. Lipopolysaccharide (LPS) is a glycolipid that constitutes the major portion of outmost membrane of gram-negative bacteria, and it is capable of inducing severe lung injury in Gram-negative bacteria sepsis and pneumonia, which are among the most common predisposing causes of ALI [2]. The interaction of the lipid A moiety of LPS with macrophages, especially activated alveolar macrophages (AMΦ) in the lung, appears to be especially important because subsequent cellular activation results in the release of inflammatory mediators and phenotypic changes [3, 4]. As inflammatory mediators, AMΦ could release systemically active proinflammatory cytokines and chemokines, including tumor-necrosis factor-α (TNF-α), Interleukin-1β (IL-1β), and macrophage inflammatory protein-2 (MIP-2) [5]. CD40, a costimulatory molecule for antigen presentation, is expressed by a wide variety of cells including macrophages. Aberrant expression of CD40 is associated with autoimmune inflammatory diseases. Interaction of Toll-like receptor-4 (TLR4) with the Gram-negative bacteria endotoxin LPS results in the induction of an array of immune response genes [6, 7]. As numerous recent studies have demonstrated, the CD40 ligation on APC is associated with the augmentation of inflammation as follow: secretion of cytokines TNF-α, IL-1β, and MIP-2. A great number of studies indicate that the CD40L on APC is related to inflammatory amplification. The interaction of CD40-CDL in the lung is a critical step to mediate the inflammation [8]. In fact, the mechanism of the activation of macrophage and upregulation of CD40 costimulatory molecule in ALI is undetermined. Because the natural history of many of these diseases is unknown, animal model studies have been undertaken to fill in the gaps and to provide important clues to their roles in ALI. In this study, we describe that LPS is a strong inducer of CD40 expression in macrophages in ALI mice model, which occurs at the transcriptional level and involves the activation of the transcription factors nuclear factor-κB (NF-κB). LPS-induced CD40 expression involves a lot of cytokines such as TNF-α, IL-1β, and MIP-2.

2. MATERIALS AND METHODS

Reagents were obtained as follows: E.coil LPS was purchased from Sigma-Aldrich (St. Louis, Mo, USA). Enzyme-linked immunosorbent assay (ELISA) development kits for mouse TNF-α, IL-1β, and MIP-2 were obtained from Genzyme Techne Corporation (Minneapolis, Minn, USA). Anti-mouse TNF-α, MIP-2, and IL-1β signal clone antibiotics were from Sigma-Aldrich. Total cellular RNA extraction and purification kits were purchased from Roche Corporation (Basel, Switzerland). RT-PCR kits were obtained from Promage Corporation (Madison, Wis, USA). Rat anti-mouse PE-conjugated CD40 antibody (clone 3/23) and rat-PE IgG isotype control were from PtarMigen (San Diego, Calif, USA). Antibodies against CD40 and actin were from Santa Cruz Biotechnology (Santa Cruz, Calif, USA).

2.1. Induction of animal model

180 BALB/c wild-type (WT) mice (6-to-8 week old) from Shandong University animal experiment center (Shandong, China) were divided two groups named as LPS group (B group) and control group (A group), respectively. Mice were anesthetized with pentobarbital sodium followed by injecting 0.2 mg/kg LPS in phosphate saline (PBS) intratrachealy for group B and PBS alone for group A [9].

2.2. Collection and measurement of specimens

After mice were executed, a total of 2.5 mL brochoalveolar lavage fluid (BALF) was collected [10]. The trachea was cannulated, and the lungs were lavaged six times with PBS (0.5 mL each time). Total cell numbers were counted with a standard hemocytometer. After centrifugation, supernatants were stored −80°C for cytokine measure by ELISA, and cell pellets were used to prepare cytospins.

2.3. Cell culture

A smear of BAL cells was prepared with cytocentrifugation using acytospin 2 at 1000 rpm for 5 minutes and then stained with Giesma solution [11]. Cell differentiation was examined by counting at least 200 cells using hemocytologic criteria to classify the cells as neutrophils, eosinophils, lymphocytes, or macrophages. By morphologic estimation with Gimesa staining, it was confirmed that polled cells from each group consisted of >98% AMΦ for separate experiments. Cells were resuspended in RPMI-1640 medium supplemented with 2 mM L-glutamine, 100 U/mL penicillin, 100 μg/lstreptomycin, 0.25 μg/L amphotericcin B, and 10% fetal calf serum, which was used as a complete medium. After allowing the cells to adhere to plates for 3 hours, nonadjacent cells were removed with three washes. The remaining adhesive cells were used as AMΦ. Macrophages were about 1 × 105/mL in inverted microscope.

2.4. RNA analysis by RT-PCR

Total cellular RNA was extracted according to manufacture's instruction. TLR4 primers were designed by Gene Toll (616 bp) forward 5′TCCCACCACC GATTCACA3′, reverse 5′CAACC2CTTTCATTTCACA3′. PCR reaction conditions were as follow: 94°C denature 2 minutes, then 94°C denature 30 seconds, 58°C anneal 60 seconds, 68°C extend 2 minutes, after 40 cycles, 68°C extend 10 minutes. β-actin (200 bp) (5′TGGGTCAGAAGGACTCCTATGTG3′, reverse 5′CGTCCCAGTTGGTAACAATGC) was used as internal control for quantification by densitometry.

2.5. ELISA assay for TNF-α, MIP-2, and IL-1β

BALFs were collected as before, anti-mouse TNF-α, MIP-2, and IL-1β and polyclonal horseradish peroxidase-conjugated IgG were sequentially added as primary and secondary antibodies, respectively. The color was developed with o-phenylenediamine substrates, and read with universal microplate reader.

2.6. EMSA for NF-κB

Nuclear and cytoplasmic extracts were obtained from cells from two groups. Protein level was determined in all extracts using the Bio-Rad dye reagent assay (Hercules, Calif, USA). An equal amount (5 μg) of nuclear protein from each sample and NF-κB consensus oligonucleotide (5′-AGTTGAGGGGACTTTCCCAGGC-3′ (Promega) was used for EMSA following the manufacture's instructions as previously described [12].

2.7. Northern blot and immunofluorescence flow cytometry for CD40 mRNA and protein

Total cellular RNA was isolated at 24 and 48 hours after from two groups. Mouse CD40 and GAPAH probe were prepared as described previously [13, 14]. 20 μg of total RNA was hybridized with probes at 42°C overnight. The hybridized mixture was treated with RNaseA/T1 (1 : 2000) and analyzed by 5% denaturing polyacrylamide gel electrophoresis. Values for CD40 mRNA levels were normalized to GAPDH mRNA level for each experiment condition. Cells were plated at 2 × 105 cells/well into 12 well plates after 48 hours, and then incubated with 100 μL of 2.4G2 hybridoma supernatant (which contains rat-anti-mouse Fc r R Ab) for blocking Fc r R. Cells were then incubated with 10 μg/mL PE-conjugated anti-mouse CD40 Ab, and analyzed on the FACStar (Becton Dickinson, Mountain View, Calif, USA) [15]. Nagative controls were incubated with IgG isotype-matched antibody. Fold induction of CD40 expression was calculated by dividing the value of mean fluorescence intensity (MFI) of regents treated samples by value of untreated samples.

2.8. Statistical analysis

Data were presented as means ±SD. Continuous variables were tested by analysis of t-test. The P-values are two-tailed and a P-value of less than .05 was considered statistically significant.

3. RESULTS

3.1. Pathologic changes of lung tissue

Compared with mice in control group, the lung tissue from LPS-treated mice demonstrated interalveolar septum collapse, abnormal constraction, alveolar space and interstitial congestion, and neutrophilic granulocyte infiltration (Figure 1).
Figure 1

Histopathological examination. Three pictures of pathological sections showing (a) pathological appearance from control group, (b) pathological appearance from LPS group at 24 hours, and (c) pathological appearance from LPS group at 48 hours (HE*300).

3.2. TLR4 expresses in macrophages

The gene expression level of TLR4 in AMΦ detected by RT-PCR is higher in LPS group as compared to the controls (Figure 2).
Figure 2

mRNA expression of TLR4 in AMΦ by RT-PCR. A representative agarose gel electrophoresis showing PCR amplification of TLR4 and β-actin from cultured AMΦ with control group and LPS group (at 24, 48 hours).

3.3. LPS induces NF-κB binding to the NF-κB consensus oligos

To investigate the role of LPS in regulation of transcription factor activity, NF-κB activity of macrophage in control and LPS groups were compared. LPS stimulation led to increased NF-κB binding to NF-κB consensus oligos as demonstrated by EMSA (Figure 3).
Figure 3

Activation of NF-κB by EMSA. NF-κB activity of macrophage in control and LPS groups (at 24, 48 hours).

3.4. The expression levels of CD40 mRNA and protein

The expression level of CD40 mRNA was determined by Northern blot as shown in Figure 4(a). LPS-induced CD40 mRNA expression increased in both 24 and 48 hours LPS group as compared to the control group. The expression level of CD40 protein determined by immunofluorescence flow cytometry increased after 48 hours in LPS group as compared to the control group (Figure 4(b)).
Figure 4

mRNA and protein expression of CD40 in AMΦ by RT-PCR and flow cytometry, respectively, (a) a representative agarose gel electrophoresis showing PCR amplification of CD40 and β-actin from cultured AMΦ with control group and LPS group (at 24, 48 hours), (b) protein expression of CD40 in AMΦ with control group and LPS group.

3.5. The expression levels of TNF-α, MIP-2, and IL-1β in LPS-induced model

The inflammatory cytokine levels in BALF determined by ELISA demonstrated an increased expression of TNF-α, MIP-2, and IL-1β in LPS group as compared to the control group (Table 1, Figure 5).
Table 1

Concentration of TNF-α, MIP-2, and IL-1β cytokines from BALF .

GroupnTNF-α (pg/mL)IL-1β (pg/mL)MIP-2 (pg/mL)
Control group1061.02 ± 10.710.7 ± 2.784.5 ± 15.8
LPS group10115.0 ± 29.6*302.1 ± 17.3*524.9 ± 99.1*

(*P < .05, compared with the control group).

Figure 5

Concentration of TNF-α, MIP-2, and IL-1β cytokines from BALF: (a) concentration of TNF-α, (b) concentration of MIP-2, (c) concentration of IL-1β.

4. DISCUSSION

In this study, we demonstrated that the levels of inflammatory cytokines TNF-α, MIP-2, and IL-1β increased significantly in BALF in LPS-induced ALI mice model. Such cytokines have been studied more clearly than others in ALI, which have played critical role in inflammation development process. MIP-2, a functional analog of human IL-8, is an important mediator in the recruitment of neutrophils, and TNF-α acts locally to stimulate chemotaxis and activate neutrophils. These cytokines might result in the injury of the lung and eventually the development of ALI to some extent [16]. LPS can induce increased gene expressions in AMΦ, such as TLR4, CD40, TNF-α, MIP-2, and IL-1β, and activate some signal transduction pathways such as TLR4-mediated NF-κB activation, and CD40-CD40L interaction. These changes will result subsequently in releasing of large amount of inflammatory cytokines [17]. AMΦ was the first cell type in the primary immunity to kill bacterium after infection [18]. They are also the target cells to LPS. Organisms can release a large number of inflammatory and anti-inflammatory cytokines in endotoxemia [19]. TLR4 is a kind of transmembrane receptor on LPS target cell in immunity system [20]. It mediates the signal of LPS from outside to inside cell. From our experiments, we observed that TLR4 mRNA and TNF-α enhanced significantly in AMΦ of LPS-induced ALI. TLR4 is then regarded as the specific recognition receptor in the process of development ALI. The lung tissue was probably injured through increased secretion of TLR4 and strengthening its signal pathway. Therefore, TLR4 plays a vital role in a series of signals activation. LPS-TLR4 compound is able to activate many kinds of signals activation [21]: TLR4-induced NF-κB activation promotes the CD40-CD40L pathway as well as the CD40 self-activation, thus it causes the massive inflammation factors release and expanded inflammation response. Previous reports demonstrated that the LPS-TLR4 interaction activated NF-κB directly. Subsequently, they all bind to the promoter of CD40, finally activated the CD40-CD40L interaction pathway and the CD40 self-activation, led to the release of inflammation factors and the anti-inflammation factors, which activated the acquired immunity. Therefore, the CD40 activation played a vital role in the process of development of ALI. In our study, we demonstrated that CD40 mRNA and the protein level increased in the macrophage in LPS group. Large body of literatures demonstrated the expression of CD40L in the T lymphocytes and mast cells. Activation of CD40-CD40L pathway may promote the massive inflammation factors release, and the CD40-CD40L activation also indicates that T-cell dependence immunity already started [22, 23], which subsequently upregulated the other costimulatory molecules and the cell adhesion molecules to promote the massive preinflammation cell factor production and release, as well as inflammation cell differentiation. Our data demonstrated high concentrations of TNF-α, MIP-2, and IL-1β cell factors in BALF from LIP group, indicating that the CD40-CD40L pathway can enhance the inflammation response and gather massive inflammation cells, finally induces and aggravates the inflammation extent of lung injury.

5. CONCLUSIONS

Our data demonstrated that LPS-induced CD40 gene transcription, activated NF-κB transcription factors, increased their affinity and finally bound to the promoter of CD40, which led to the high expression of CD40 in the acute lung injury. Studying the mechanism of LPS-induced, TLR4-mediated in vitro CD40 transcription allowed us to provide the experimental evidences of the important role of CD40 in the development of LPS-induced ALI. We thus predict that blocking the expression of TLR4 or the inhibition of expression of CD40 through interruption of its transcription regulation complexes will be attractive targets to the treatment of LPS-induced ALI.
  23 in total

Review 1.  The acute respiratory distress syndrome.

Authors:  L B Ware; M A Matthay
Journal:  N Engl J Med       Date:  2000-05-04       Impact factor: 91.245

2.  Ordered recruitment of chromatin modifying and general transcription factors to the IFN-beta promoter.

Authors:  T Agalioti; S Lomvardas; B Parekh; J Yie; T Maniatis; D Thanos
Journal:  Cell       Date:  2000-11-10       Impact factor: 41.582

Review 3.  Toll-like receptors in the induction of the innate immune response.

Authors:  A Aderem; R J Ulevitch
Journal:  Nature       Date:  2000-08-17       Impact factor: 49.962

4.  Role of p38 mitogen-activated protein kinase in a murine model of pulmonary inflammation.

Authors:  J A Nick; S K Young; K K Brown; N J Avdi; P G Arndt; B T Suratt; M S Janes; P M Henson; G S Worthen
Journal:  J Immunol       Date:  2000-02-15       Impact factor: 5.422

5.  Involvement of STAT-1 and ets family members in interferon-gamma induction of CD40 transcription in microglia/macrophages.

Authors:  V T Nguyen; E N Benveniste
Journal:  J Biol Chem       Date:  2000-08-04       Impact factor: 5.157

Review 6.  CD40-CD40 ligand.

Authors:  C van Kooten; J Banchereau
Journal:  J Leukoc Biol       Date:  2000-01       Impact factor: 4.962

7.  TRADD interacts with STAT1-alpha and influences interferon-gamma signaling.

Authors:  Duane R Wesemann; Hongwei Qin; Natalia Kokorina; Etty N Benveniste
Journal:  Nat Immunol       Date:  2004-01-18       Impact factor: 25.606

8.  Identification of Lps2 as a key transducer of MyD88-independent TIR signalling.

Authors:  K Hoebe; X Du; P Georgel; E Janssen; K Tabeta; S O Kim; J Goode; P Lin; N Mann; S Mudd; K Crozat; S Sovath; J Han; B Beutler
Journal:  Nature       Date:  2003-07-20       Impact factor: 49.962

9.  IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway.

Authors:  Katherine A Fitzgerald; Sarah M McWhirter; Kerrie L Faia; Daniel C Rowe; Eicke Latz; Douglas T Golenbock; Anthony J Coyle; Sha-Mei Liao; Tom Maniatis
Journal:  Nat Immunol       Date:  2003-05       Impact factor: 25.606

10.  Suppressor of cytokine signaling 1 inhibits cytokine induction of CD40 expression in macrophages.

Authors:  Duane R Wesemann; Yuanshu Dong; George M O'Keefe; Vince T Nguyen; Etty N Benveniste
Journal:  J Immunol       Date:  2002-09-01       Impact factor: 5.422

View more
  6 in total

1.  A FQHPSFI peptide selectively binds to LPS-activated alveolar macrophages and inhibits LPS-induced MIP-2 production.

Authors:  Ning Ding; Hui Xiao; Fang Wang; Lixin Xu; Shouzhang She
Journal:  Inflamm Res       Date:  2010-02-27       Impact factor: 4.575

2.  Inflammatory mechanisms in the lung.

Authors:  B Moldoveanu; P Otmishi; P Jani; J Walker; X Sarmiento; J Guardiola; M Saad; Jerry Yu
Journal:  J Inflamm Res       Date:  2008-12-16

3.  Mangiferin inhibits macrophage classical activation via downregulating interferon regulatory factor 5 expression.

Authors:  Zhiquan Wei; Li Yan; Yixin Chen; Chuanhong Bao; Jing Deng; Jiagang Deng
Journal:  Mol Med Rep       Date:  2016-05-27       Impact factor: 2.952

4.  Ganglioside Synthesis by Plasma Membrane-Associated Sialyltransferase in Macrophages.

Authors:  Aldo A Vilcaes; Eduardo Garbarino-Pico; Vanina Torres Demichelis; Jose L Daniotti
Journal:  Int J Mol Sci       Date:  2020-02-05       Impact factor: 5.923

5.  A randomized, phase 1b study of the pharmacokinetics, pharmacodynamics, safety, and tolerability of bleselumab, a fully human, anti-CD40 monoclonal antibody, in kidney transplantation.

Authors:  Flavio Vincenti; Goran Klintmalm; Harold Yang; V Ram Peddi; Paul Blahunka; Angela Conkle; Vicki Santos; John Holman
Journal:  Am J Transplant       Date:  2019-09-09       Impact factor: 8.086

6.  Polyphenols from Securidaca inappendiculata alleviated acute lung injury in rats by inhibiting oxidative stress sensitive pathways.

Authors:  Cong-Lan Ji; Sheng Dai; Hong Liu; Ji-Yang Dong; Chun-Sheng Liu; Jian Zuo
Journal:  Chin Herb Med       Date:  2021-03-02
  6 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.