Mycobacterium tuberculosis and Corynebacterium glutamicum share a similar cell wall structure and orthologous enzymes involved in cell wall assembly. Herein, we have studied C. glutamicum NCgl1505, the orthologue of putative glycosyltransferases Rv1459c from M. tuberculosis and MSMEG3120 from Mycobacterium smegmatis. Deletion of NCgl1505 resulted in the absence of lipomannan (Cg-LM-A), lipoarabinomannan (Cg-LAM) and a multi-mannosylated polymer (Cg-LM-B) based on a 1,2-di-O-C(16)/C(18:1)-(alpha-D-glucopyranosyluronic acid)-(1-->3)-glycerol (GlcAGroAc(2)) anchor, while syntheses of triacylated-phosphatidyl-myo-inositol dimannoside (Ac(1)PIM(2)) and Man(1)GlcAGroAc(2) were still abundant in whole cells. Cell-free incubation of C. glutamicum membranes with GDP-[(14)C]Man established that C. glutamicum synthesized a novel alpha(1-->6)-linked linear form of Cg-LM-A and Cg-LM-B from Ac(1)PIM(2) and Man(1)GlcAGroAc(2) respectively. Furthermore, deletion of NCgl1505 also led to the absence of in vitro synthesized linear Cg-LM-A and Cg-LM-B, demonstrating that NCgl1505 was involved in core alpha(1-->6) mannan biosynthesis of Cg-LM-A and Cg-LM-B, extending Ac(1)PI[(14)C]M(2) and [(14)C]Man(1)GlcAGroAc(2) primers respectively. Use of the acceptor alpha-D-Manp-(1-->6)-alpha-D-Manp-O-C(8) in an in vitro cell-free assay confirmed NCgl1505 as an alpha(1-->6) mannopyranosyltransferase, now termed MptB. While Rv1459c and MSMEG3120 demonstrated similar in vitroalpha(1-->6) mannopyranosyltransferase activity, deletion of the Rv1459c homologue in M. smegmatis did not result in loss of mycobacterial LM/LAM, indicating a functional redundancy for this enzyme in mycobacteria.
Mycobacterium tuberculosis and Corynebacterium glutamicum share a similar cell wall structure and orthologous enzymes involved in cell wall assembly. Herein, we have studied C. glutamicum NCgl1505, the orthologue of putative glycosyltransferases Rv1459c from M. tuberculosis and MSMEG3120 from Mycobacterium smegmatis. Deletion of NCgl1505 resulted in the absence of lipomannan (Cg-LM-A), lipoarabinomannan (Cg-LAM) and a multi-mannosylated polymer (Cg-LM-B) based on a 1,2-di-O-C(16)/C(18:1)-(alpha-D-glucopyranosyluronic acid)-(1-->3)-glycerol (GlcAGroAc(2)) anchor, while syntheses of triacylated-phosphatidyl-myo-inositol dimannoside (Ac(1)PIM(2)) and Man(1)GlcAGroAc(2) were still abundant in whole cells. Cell-free incubation of C. glutamicum membranes with GDP-[(14)C]Man established that C. glutamicum synthesized a novel alpha(1-->6)-linked linear form of Cg-LM-A and Cg-LM-B from Ac(1)PIM(2) and Man(1)GlcAGroAc(2) respectively. Furthermore, deletion of NCgl1505 also led to the absence of in vitro synthesized linear Cg-LM-A and Cg-LM-B, demonstrating that NCgl1505 was involved in core alpha(1-->6) mannan biosynthesis of Cg-LM-A and Cg-LM-B, extending Ac(1)PI[(14)C]M(2) and [(14)C]Man(1)GlcAGroAc(2) primers respectively. Use of the acceptor alpha-D-Manp-(1-->6)-alpha-D-Manp-O-C(8) in an in vitro cell-free assay confirmed NCgl1505 as an alpha(1-->6) mannopyranosyltransferase, now termed MptB. While Rv1459c and MSMEG3120 demonstrated similar in vitroalpha(1-->6) mannopyranosyltransferase activity, deletion of the Rv1459c homologue in M. smegmatis did not result in loss of mycobacterial LM/LAM, indicating a functional redundancy for this enzyme in mycobacteria.
The taxon Corynebacterineae belongs to the Actinomycetes family which includes human pathogens, such as Mycobacterium tuberculosis, Mycobacterium leprae and Corynebacterium diphtheriae, the causal agents of tuberculosis, leprosy and diphtheria respectively (Coyle and Lipsky, 1990; Bloom and Murray, 1992). Some animal pathogens, for instance, Corynebacterium pseudotuberculosis and Corynebacterium matruchotii (Coyle and Lipsky, 1990; Funke ; Stackebrandt ), also belong to the Corynebacterianeae. In addition, the family member Corynebacterium glutamicum is widely used for the industrial production of amino acids (Eggeling and Bott, 2005). These bacilli share a unique cell wall ultra-structure that is composed of a mycolyl-arabinogalactan-peptidoglycan (mAGP) complex (Daffé; McNeil ; 1991; Besra ; Brennan, 2003; Dover ). The esterified mycolates of the mAGP complex are considered to be packed side by side and are intercalated by lipids and glycolipids. This combined lipid structure gives rise to an asymmetric bilayer critical for the survival of these organisms (Minnikin ).In addition to the mAGP complex, other glycolipids, such as phosphatidyl-myo-inositol (PI) mannosides (PIMs) and lipoglycans, termed lipomannan (LM) and lipoarabinomannan (LAM), are also found in this outer leaflet (Hill and Ballou, 1966; Brennan and Ballou, 1967; 1968; Brennan and Nikaido, 1995; Besra ; Morita ). However, LM and LAM possess important physiological functions, and play key roles in the modulation of the host response during infection (Schlesinger ; Chatterjee and Khoo, 1998; Nigou ; Maeda ). The modulation of the immune response by LAM has been attributed to its terminal-capping motif (Nigou ; 2003). Different permutations of LAM capping have been found in Mycobacterium strains, including ManLAM (Chatterjee ; Khoo ), PILAM (Gilleron ) and (non-capped) LAM (Guerardel ). Slow-growing mycobacteria, such as M. tuberculosis and M. leprae, produce ManLAM, which enables them to infect macrophages and dendritic cells (Schlesinger ; Tascon ). ManLAM inhibits the production of proinflammatory cytokines, such as IL-12 and TNF-α and inhibits phagosomal maturation (Knutson ; Nigou ; Fratti ), while PILAM from the non-pathogenic fast-growing Mycobacterium smegmatis strain induces the proliferation of these cytokines (Adams ; Gilleron ).The current model of lipoglycan biosynthesis follows a linear pathway, PI→PIM→LM→LAM (Besra and Brennan, 1997) (Fig. 1). PI is glycosylated by an α-mannopyranosyl (Manp) residue catalysed by PimA (Rv2610c), which transfers Manp from GDP-mannose to the 2-position of PI to form PIM1 (Kordulakova ). PIM1 is further glycosylated by PimB (Rv0557), which may occur before, or after acylation of PIM1 by Rv2611c (Kordulakova ) and results in the formation of Ac1PIM2 (Schaeffer ). However, recently, this second mannosylation step in the biosynthesis of Ac1PIM2 has now been shown to be catalysed by PimB′ (Rv2188c, NCgl2106), while PimB (Rv0557, NCgl0452), now termed MgtA, is involved in synthesizing a novel mannosylated glycolipid, 1,2-di-O-C16/C18:1-(α-D-mannopyranosyl)-(1→4)-(α-D-glucopyranosyluronic acid)-(1→3)-glycerol (Man1GlcAGroAc2) (Tatituri ; Lea-Smith ; Mishra ). The analysis of deletion mutants of NCgl0452 and NCgl2106 established that this glycolipid is further modified to produce a multi-mannosylated derivative, Man12−20GlcAGroAc2 (Cg-LM-B) which is coincident on SDS-PAGE with PI-based Cg-LM, which is now termed Cg-LM-A (Tatituri ; Lea-Smith ; Mishra ). Previous studies have shown that RvD2-ORF1 from M. tuberculosis CDC1551, designated as PimC, catalysed further α-mannosylation of Ac1PIM2 resulting in Ac1PIM3 (Kremer ). Recently, PimE (Rv1159) has been shown to be involved in higher PIM biosynthesis and directly in the biosynthesis of Ac1PIM5 (Morita ); however, the enzyme responsible for the synthesis of Ac1PIM4 from Ac1PIM3 remains to be identified.
Fig. 1
Schematic representation of the current understanding of the LM and LAM biosynthetic pathway in M. tuberculosis. ManT, mannosyltransferase; AraT, arabinosyltransferase; PPM, polyprenyl-1-monophosphorylmannose; DPA, decaprenyl-1-monophosphoryl-arabinose; R1, R2 and R3 represent acyl groups.
Schematic representation of the current understanding of the LM and LAM biosynthetic pathway in M. tuberculosis. ManT, mannosyltransferase; AraT, arabinosyltransferase; PPM, polyprenyl-1-monophosphorylmannose; DPA, decaprenyl-1-monophosphoryl-arabinose; R1, R2 and R3 represent acyl groups.The point at which lipoglycan biosynthesis continues probably occurs after Ac1PIM2 and Man1GlcAGroAc2 in C. glutamicum (Gibson ; Tatituri ; Mishra ), where a transition occurs from glycosyltransferases which utilize nucleotide sugars (i.e. GDP-Man) as substrate to glycosyltransferases which utilize polyprenyl-phosphate sugars (i.e. polyprenyl-phosphomannose, PPM) and which belong to the GT-C superfamily, and are membrane-bound (Liu and Mushegian, 2003). Recently, we (Mishra ) and others (Kaur ) reported a novel α-mannosyltransferase, MptA (Rv2174), involved in the latter stages of Ms-LM/LAM, Cg-LAM, Cg-LM-A and Cg-LM-B biosynthesis in Corynebacterineae. The core mannan backbone is further glycosylated by Rv2181 and results in the synthesis of α(1→2)-Manp-linked branches, characteristic of the mannan backbone in LM and LAM (Kaur ). The mature LM is then elaborated with arabinose by the essential arabinofuranosyltransferase EmbC (G.S. Besra, unpubl. res.) to form LAM (Berg ). Recently, a novel mannosyltransferase, Rv1635c (and MT1671), has been shown to add terminal Manp residues to the mature LAM in M. tuberculosis to form ManLAM (Dinadayala ; Appelmelk ). However, the enzyme involved in the early stages of linear LM/LAMmannan core biosynthesis through an α(1→6) mannosyltransferase prior to MptA remains to be identified (Fig. 1).In this study, we have examined the function of C. glutamicum NCgl1505, and its orthologous genes Rv1459c of M. tuberculosis and MSMEG3120 of M. smegmatis encoding a putative GT-C glycosyltransferase. The NCgl1505 gene and its orthologues based on the results described below have been designated as mptB, as an acronym for mannopyranosyltransferase B. Null mutants of C. glutamicum together with in vitro cell-free assays established that NCgl1505 is a key α(1→6) mannosyltransferase involved in the initiation of core mannan biosynthesis of Cg-LM-A and Cg-LM-B from Corynebacterineae extending Ac1PIM2 and Man1GlcAGroAc2 respectively. In addition, the M. tuberculosis orthologue Rv1459c and M. smegmatis MSMEG3120 demonstrated α(1→6) mannosyltransferase activity in a membrane-based in vitro assay when utilizing a C. glutamicumΔmptBΔmptA double mutant complemented with either plasmid-encoded Rv1459c or MSMEG3120. Finally, using a M. smegmatis null mutant of MSMEG3120, we also demonstrate that the mycobacterial orthologue of NCgl1505 is functionally redundant.
Results
Genome locus and structural features of Rv1459c/NCgl1505
Glycosyltransferases belonging to the GT-C superfamily have been shown by us (Alderwick ; Alderwick ; Mishra ; Seidel ) and others (Dinadayala ; Kaur ; 2007; Morita ) to play important roles in the biosynthesis of the cell wall heteropolysaccharides arabinogalactan (AG), LM-A, LM-B and LAM in Corynebacterinaeae. Our attention was recently drawn to a putative glycosyltransferase encoded by M. tuberculosis Rv1459c and C. glutamicum NCgl1505, which are members of the GT-C family of glycosyltransferases. Orthologues of these genes are present in all Mycobacterium and Corynebacterium species as well as the sequenced Nocardia farcinica IFM 10152 and Rhodococcus sp. RHA1 strains (Fig. 2A). In addition, this gene is retained in M. leprae, supporting the hypothesis that NCgl1505 encodes for a protein possessing a vital function inherent to this group of bacteria.
Fig. 2
Generation of an in-frame deletion mutant of C. glutamicum mptB. A. The locus in the bacteria analysed consists of mptB which has in C. glutamicum the locus tag NCgl1505 and in M. tuberculosis Rv1459c. sufR encodes a transcriptional regulator in front of an operon of the SUF machinery of [Fe-S] cluster synthesis (Huet ). The genomic region displayed encompasses 7 kb, and orthologous genes are highlighted accordingly. Nocardia farcina, Nocardia farcina IFM 10152; Rhodococcus, Rhodococcus sp. strain RHA1. B. MptB is a hydrophobic protein predicted to span the membrane 15 times and the transmembrane helices are numbered accordingly. The lower part of the figure shows the degree of conservation of the orthologues given in A as analysed by the dialign method (Morgenstern, 2004). Also shown is the approximate position of the fully conserved aspartyl (D) and glutamyl (E) residues. C. Strategy to delete Cg-mptB using the deletion vector pK19mobsacBΔmptB. This vector carries 18 nucleotides of the 5′ end of Cg-mptB and 36 nucleotides of its 3′ end, thereby enabling the in-frame deletion of almost the entire Cg-mptB gene. The arrows marked PA and PB locate the primers used for the PCR analysis to confirm the absence of Cg-mptB. Distances are not drawn to scale. The results of the PCR analysis with the primer pair PA/PB are shown on the right. Amplification products obtained from the wild type (wt) were applied in the middle lane and that of the deletion mutant (Δ) in the left lane. ‘st’ marks the standard, where the arrowheads are located at 1.5, 1 and 0.5 kb. D. Growth of C. glutamicum on rich BHIS (solid lines). Wild-type C. glutamicm, filled triangle; C. glutamicumΔmptB, open triangle; C. glutamicumΔmptB pVWEx-Cg-mptB, open square. Growth of C. glutamicumΔmptB on rich BHI medium are the open triangles with the broken line.
Generation of an in-frame deletion mutant of C. glutamicummptB. A. The locus in the bacteria analysed consists of mptB which has in C. glutamicum the locus tag NCgl1505 and in M. tuberculosis Rv1459c. sufR encodes a transcriptional regulator in front of an operon of the SUF machinery of [Fe-S] cluster synthesis (Huet ). The genomic region displayed encompasses 7 kb, and orthologous genes are highlighted accordingly. Nocardia farcina, Nocardia farcina IFM 10152; Rhodococcus, Rhodococcus sp. strain RHA1. B. MptB is a hydrophobic protein predicted to span the membrane 15 times and the transmembrane helices are numbered accordingly. The lower part of the figure shows the degree of conservation of the orthologues given in A as analysed by the dialign method (Morgenstern, 2004). Also shown is the approximate position of the fully conserved aspartyl (D) and glutamyl (E) residues. C. Strategy to delete Cg-mptB using the deletion vector pK19mobsacBΔmptB. This vector carries 18 nucleotides of the 5′ end of Cg-mptB and 36 nucleotides of its 3′ end, thereby enabling the in-frame deletion of almost the entire Cg-mptB gene. The arrows marked PA and PB locate the primers used for the PCR analysis to confirm the absence of Cg-mptB. Distances are not drawn to scale. The results of the PCR analysis with the primer pair PA/PB are shown on the right. Amplification products obtained from the wild type (wt) were applied in the middle lane and that of the deletion mutant (Δ) in the left lane. ‘st’ marks the standard, where the arrowheads are located at 1.5, 1 and 0.5 kb. D. Growth of C. glutamicum on rich BHIS (solid lines). Wild-type C. glutamicm, filled triangle; C. glutamicumΔmptB, open triangle; C. glutamicumΔmptBpVWEx-Cg-mptB, open square. Growth of C. glutamicumΔmptB on rich BHI medium are the open triangles with the broken line.The glycosyltransferase encoded by NCgl1505 is a polytopic membrane protein, which is comprised of 558 amino acid (aa) residues, and is predicted to encode 15 hydrophobic segments (HSs) (Fig. 2B). Rv1459c constitutes 591 aa, with the additional length mostly due to an extended loop between HSs 7 and 8. This loop extension is not present in Mycobacterium paratuberculosis or M. smegmatis. It contains a number of repeated Pro and Arg residues, and similarly highly charged repeat sequences are found in loop regions of other transporters, without having a specific function (Eng ; Vrljic ). The sequence identity of the orthologues NCgl1505 and Rv1459c is 37% (52% similarity) and can therefore be considered very high. The strongest conserved regions are found in loops connecting HSs and adjacent regions with intermediate hydrophobicity, like those between HSs 3–4, HSs 7–8 and HSs 13–14 (Fig. 2B). Within the highest conserved regions; five of the six fully conserved acidic Asp and Glu residues are located, given as D and E in Fig. 2B, which are known to play important roles as general bases and nucleophiles in enzyme catalysis. They are also retained in the MptB orthologue in N. farcinica IFM 10152 and Rhodococcus sp. RHA1 are therefore likely to be involved in catalysis, or in interactions with the sugardonor or acceptor (Liu and Mushegian, 2003). Interestingly, among the glycosyltransferases of M. tuberculosis and C. glutamicum previously identified (Alderwick ; Dinadayala ; Kaur ; Morita ; Seidel ), NCgl1505 and Rv1459c possess the highest identities to the recently identified mannosyltransferase MptA (Kaur ; Mishra ) and, based on the results described below, the NCgl1505 gene and its orthologues have been designated as MptB.
Construction and growth of C. glutamicumΔmptB and complemented strains
In order to delete mptB in C. glutamicum, the non-replicative plasmid pK19mobsacBΔmptB was constructed carrying sequences adjacent to Cg-mptB. Using this vector, C. glutamicum was transformed to kanamycin resistance, indicating integration of the vector into the genome by homologous recombination (Fig. 2C). The sacB gene enables for selection of loss of vector in a second homologous recombination event, which can result either in the original wild-type genomic organization or in clones deleted of Cg-mptB. Ninety clones exhibiting the desired phenotype of vector loss (kanamycin-sensitive, sucrose-resistant) were analysed by PCR, but only one single colony was found to have Cg-mptB excised, whereas the others resulted in a wild-type genotype. The low number of recombinant knockouts indicates that the loss of Cg-mptB is apparently a disadvantage for cell viability, similar to that of previously observed mutants with altered mycolate (Gande ) or arabinogalactan biosynthesis (Alderwick ). The resulting clone was subsequently termed C. glutamicumΔmptB and confirmed by PCR with different primer pairs to have Cg-mptB deleted, whereas controls with C. glutamicum wild type resulted in the expected larger amplification product (Fig. 2C).In liquid culture, growth of C. glutamicumΔmptB was very poor. Only when rich brain heart infusion (BHI) medium was used was a growth rate of 0.13 h−1 obtained (Fig. 2D) in comparison with wild-type C. glutamicum growth rate of 0.31 h−1 (Mishra ) and, on the same medium supplemented with 500 mM sorbitol (BHIS), the growth rate was 0.51 h−1, which is still lower than that of the wild type on this medium (0.70 h−1). C. glutamicumΔmptB was transformed with pVWEx-Cg-mptB and the resultant complemented strain exhibited a growth rate of 0.66 h−1, almost superimposable to that of the wild type in BHIS medium.
Polar lipid analysis of C. glutamicum and C. glutamicumΔmptB
Lyophilized cells were extracted using petroleum-ether and methanolic saline to initially recover apolar lipids. Further processing of the methanolic extract afforded the polar lipid fraction which was examined by two-dimensional thin-layer chromatography (2D-TLC). In both the wild-type C. glutamicum and C. glutamicumΔmptB, Ac1PIM2 and Man1GlcAGroAc2 (Tatituri ) were visualized either by α-naphthol/sulphuric acid (specific for sugars), 5% ethanolic molybdophosphoric acid (general lipid stain) (Fig. S1) or Dittmer and Lester reagent (specific for phospholipids). In both C. glutamicum and C. glutamicumΔmptB, no products could be observed which correspond to higher PIMs (i.e. Ac1PIM3 through to Ac1PIM6) or higher mannose variants of Man1GlcAGroAc2 (Tatituri ; Mishra ). The presence of only Ac1PIM2 and Man1GlcAGroAc2, and the inability to synthesize Cg-LAM, Cg-LM-A and Cg-LM-B by C. glutamicumΔmptB (as shown below) demonstrated that MptB is involved in the early steps of α(1→6) mannan core biosynthesis by extending the substrates Ac1PIM2 and Man1GlcAGroAc2.
Analysis of lipoglycans from C. glutamicum, C. glutamicumΔmptB and C. glutamicumΔmptB pVWEx-Cg-mptB
Lipoglycans were extracted by refluxing delipidated cells in ethanol, followed by hot-phenol extraction, protease digestion and dialysis to remove impurities. The extracted lipoglycans were examined initially on 15% SDS-PAGE (Fig. 3A). Extracts from wild-type C. glutamicum showed the presence of Cg-LAM, Cg-LM-A and Cg-LM-B with the latter product based on previous results comigrating with Cg-LM-A (Tatituri ; Mishra ), while all of these lipoglycans were absent from C. glutamicumΔmptB. Complementation of C. glutamicumΔmptB by transformation with plasmid pVWEx-Cg-mptB restored the wild-type phenotype (Fig. 3A). In addition, transformation of C. glutamicumΔmptB with plasmid pVWEx-Cg-mptA failed to restore the wild-type phenotype (data not shown).
Fig. 3
Lipoglycan profile of C. glutamicum strains analysed using SDS-PAGE and visualized using a Pro-Q emerald glycoprotein stain (Invitrogen) specific for carbohydrates. A. Lipolglycans extracted from C. glutamicum, C. glutamicumΔmptB and C. glutamicumΔmptB pVWEx-Cg-mptB. The major bands represented by Cg-LAM, Cg-LM-A and Cg-LM-B are indicated. B. C. glutamicum, C. glutamicumΔmptB, C. glutamicumΔmptA, C. glutamicumΔmptBΔmptA, C. glutamicumΔmptBΔmptA pVWEx-Cg-mptB and C. glutamicumΔmptBΔmptA pVWEx-Cg-mptA. The truncated version of Cg-LM-A/B is indicated as Cg-t-LM-A/B (Mishra ). The four major bands represent glycoproteins of 180, 82, 42 and 18 kDa respectively.
Lipoglycan profile of C. glutamicum strains analysed using SDS-PAGE and visualized using a Pro-Q emerald glycoprotein stain (Invitrogen) specific for carbohydrates. A. Lipolglycans extracted from C. glutamicum, C. glutamicumΔmptB and C. glutamicumΔmptBpVWEx-Cg-mptB. The major bands represented by Cg-LAM, Cg-LM-A and Cg-LM-B are indicated. B. C. glutamicum, C. glutamicumΔmptB, C. glutamicumΔmptA, C. glutamicumΔmptBΔmptA, C. glutamicumΔmptBΔmptApVWEx-Cg-mptB and C. glutamicumΔmptBΔmptApVWEx-Cg-mptA. The truncated version of Cg-LM-A/B is indicated as Cg-t-LM-A/B (Mishra ). The four major bands represent glycoproteins of 180, 82, 42 and 18 kDa respectively.
Construction and growth of C. glutamicumΔmptAΔmptB and complemented strains
As a result of the similarity of MptB with MptA, we wanted to exclude any possible interferences and constructed a strain of C. glutamicum deficient in mptB and mptA. For this purpose, C. glutamicumΔmptB was transformed with plasmid pK19mobsacBΔmptA (Mishra ) and processed as described in Experimental procedures to afford the double mutant, C. glutamicumΔmptBΔmptA. Analysis of this strain showed that its growth characteristics were very similar to C. glutamicumΔmptB (data not shown). For further analysis, C. glutamicumΔmptAΔmptB was transformed with plasmid-encoded Cg-mptB, Cg-mptA, Mt-mptB and Ms-mptB.
Analysis of lipoglycans from C. glutamicumΔmptBΔmptA, C. glutamicumΔmptBΔmptA pVWEx-Cg-mptB and C. glutamicumΔmptBΔmptA pVWEx-Cg-mptA
In addition to MptB, C. glutamicum possesses the known α(1→6) mannosyltransferase MptA, which is involved in the later stages of core mannan biosynthesis (Mishra ) and, as a result, we wanted to study the in situ specificity of these glycosyltransferases. For this purpose, lipoglycans were extracted from C. glutamicumΔmptBΔmptA, and from the same strain carrying either pVWEx-Cg-mptB or pVWEx-Cg-mptA and analyzed by 15% SDS-PAGE (Fig. 3B). Extracts from C. glutamicumΔmptBΔmptA indicated that, as expected, no lipoglycans were present, whereas the presence of pVWEx-Cg-mptB resulted in formation of a truncated (Cg-t) version of Cg-LM-A and Cg-LM-B (Mishra ; 2008). However, lipoglycan extracts from C. glutamicumΔmptBΔmptA carrying pVWEx-Cg-mptA were identical to that of C. glutamicumΔmptBΔmptA, indicating that MptA fails to substitute for MptB in the double mutant. As pVWEx-Cg-mptA results in functional MptA (Mishra ), this result shows that MptA is unable to substitute in vivo for MptB. Therefore, both MptA and MptB are distinct and MptB is involved in the initial steps of Cg-LAM, Cg-LM-A and Cg-LM-B biosynthesis, prior to MptA. Furthermore, analysis of C. glutamicumΔmptBΔmptA carrying either pVWEx-Mt-mptB or pVWEx-Ms-mptB resulted in a complete lack of lipoglycan biosynthesis (data not shown), indicating that Mt-MptB and Ms-MptB do not function in vivo as the initial α(1→6) mannosyltransferase probably because of an inability to extend Ac1PIM2 and Man1GlcAGroAc2 by mannose residues as shown below through in vitro chase experiments.
In vitro incorporation of radiolabelled Man from GDP-[14C]Man into membrane lipids utilizing C. glutamicum, C. glutamicumΔmptB and complemented strains
Incorporation of [14C]Man from GDP-[14C]Man into CHCl3/CH3OH (2:1) and CHCl3/CH3OH/H2O (10:10:3)-soluble lipids was examined using membrane/cell envelope extracts prepared from C. glutamicum as described previously utilizing mycobacterial membrane/cell envelope fractions (Besra ). TLC autoradiography (Fig. 4A, lane 1) of the CHCl3/CH3OH (2:1)-soluble lipids synthesized by wild-type C. glutamicum membrane/cell envelope extracts contained as expected β-D-mannopyranosyl-1-monophosphoryl-decaprenol (C50-PP[14C]M), [14C]Man1GlcAGroAc2 and Ac1PI[14C]M2. The identity of the three labelled lipids was established by: (i) base treatment, i.e. degradation of Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2 (Fig. 4A, lane 2), (ii) addition of amphomycin, which specifically chelates polyprenyl phosphates in the presence of Ca2+ and thus inhibiting the transfer of Man from GDP-Man to polyprenyl carriers (Fig. 4A, lane 3) and (iii) in comparison with known standards (Tatituri ). As expected from the analysis of whole cells, C. glutamicumΔmptB synthesized comparable levels of all three radiolabelled lipids using membrane/cell envelope extracts prepared from C. glutamicumΔmptB (Fig. 4A, lane 4).
Fig. 4
Incorporation of [14C]Man from GDP-[14C]Man into corynebacterial membrane/cell envelope lipids. A. TLC autoradiography of labelled CHCl3/CH3OH (2:1)-soluble lipids, C50-PP[14C]M, [14C]Man1GlcAGroAc2 and Ac1PI[14C]M2 using GDP-[14C]Man and membrane/cell envelope extracts from C. glutamicum and C. glutamicumΔmptB. Membrane/cell envelope fractions were incubated with GDP-[14C]Man in a total volume of 100 μl for 60 min in either the absence or presence of amphomycin (10 μg) and Ca2+ ions per reaction mixture pre-incubated with membranes for 15 min. Enzymatically synthesized products C50-PP[14C]M, [14C]ManGlcAGroAc2 and Ac1PI[14C]M2 were isolated as described in Experimental procedures to provide washed CHCl3/CH3OH (2:1)-soluble lipids and also subjected to base treatment. Aliquots (10%) were taken for scintillation counting and the remaining products subjected to TLC/autoradiography using CHCl3/CH3OH/NH4OH/H2O (65:25:0.4:3.6, v/v/v/v). C. glutamicum CHCl3/CH3OH (2:1)-soluble lipids (lane 1), base treatment of CHCl3/CH3OH (2:1)-soluble lipids (lane 2), amphomycin treatment (lane 3) and C. glutamicumΔmptB CHCl3/CH3OH (2:1)-soluble lipids (lane 4). B. Characterization of CHCl3/CH3OH/H2O (10:10:3)-soluble lipids as α(1→6)-linear mannooligosaccharides. The insoluble pellet from the above reaction mixtures following extraction with CHCl3/CH3OH (2:1) were sequentially washed with 0.9% NaCl in 50% CH3OH, 50% CH3OH and CH3OH, prior to extraction with CHCl3/CH3OH/H2O (10:10:3) and an aliquot (10%) taken for scintillation counting and the remaining product analysed by SDS-PAGE/autoradiography (left-panel inset). C. glutamicum (no. 1), amphomycin treatment (no. 2) and acetolysis treatment of CHCl3/CH3OH/H2O (10:10:3)-soluble lipids (no. 3), C. glutamicumΔmptB (no. 4) and C. glutamicumΔmptB pVWEx-Cg-mptB (no. 5) as described in the Experimental procedures. C and D. Incorporation of in vitro in situ Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2 into α(1→6)-linear mannooligosaccharides with either C. glutamicum, C. glutamicumΔmptB or C. glutamicumΔmptB pVWEx-Cg-mptB membrane preparations. Membranes were initially pre-treated with amphomycin, labelled using GDP-[14C]Man, re-harvested by centrifugation and extensively washed with buffer. At t = 0 min, an aliquot of membranes (20%) was processed as described in the Experimental procedures for CHCl3/CH3OH (2:1)-soluble lipids and analysed by TLC/autoradiography using CHCl3/CH3OH/NH4OH/H2O (65:25:0.4:3.6, v/v/v/v) (C) and CHCl3/CH3OH/H2O (10:10:3)-soluble lipids by SDS-PAGE/autoradiography (D). The carefully washed [14C]-labelled membranes were re-incubated for a further 60 min following the addition of 0.5 mg cold C50-PPM (Gurcha ). At t = 60 min, an equivalent membrane aliquot as based on t = 0 was again analysed for CHCl3/CH3OH (2:1) and CHCl3/CH3OH/H2O (10:10:3)-soluble lipids as described above (C and D).
Incorporation of [14C]Man from GDP-[14C]Man into corynebacterial membrane/cell envelope lipids. A. TLC autoradiography of labelled CHCl3/CH3OH (2:1)-soluble lipids, C50-PP[14C]M, [14C]Man1GlcAGroAc2 and Ac1PI[14C]M2 using GDP-[14C]Man and membrane/cell envelope extracts from C. glutamicum and C. glutamicumΔmptB. Membrane/cell envelope fractions were incubated with GDP-[14C]Man in a total volume of 100 μl for 60 min in either the absence or presence of amphomycin (10 μg) and Ca2+ ions per reaction mixture pre-incubated with membranes for 15 min. Enzymatically synthesized products C50-PP[14C]M, [14C]ManGlcAGroAc2 and Ac1PI[14C]M2 were isolated as described in Experimental procedures to provide washed CHCl3/CH3OH (2:1)-soluble lipids and also subjected to base treatment. Aliquots (10%) were taken for scintillation counting and the remaining products subjected to TLC/autoradiography using CHCl3/CH3OH/NH4OH/H2O (65:25:0.4:3.6, v/v/v/v). C. glutamicum CHCl3/CH3OH (2:1)-soluble lipids (lane 1), base treatment of CHCl3/CH3OH (2:1)-soluble lipids (lane 2), amphomycin treatment (lane 3) and C. glutamicumΔmptBCHCl3/CH3OH (2:1)-soluble lipids (lane 4). B. Characterization of CHCl3/CH3OH/H2O (10:10:3)-soluble lipids as α(1→6)-linear mannooligosaccharides. The insoluble pellet from the above reaction mixtures following extraction with CHCl3/CH3OH (2:1) were sequentially washed with 0.9% NaCl in 50% CH3OH, 50% CH3OH and CH3OH, prior to extraction with CHCl3/CH3OH/H2O (10:10:3) and an aliquot (10%) taken for scintillation counting and the remaining product analysed by SDS-PAGE/autoradiography (left-panel inset). C. glutamicum (no. 1), amphomycin treatment (no. 2) and acetolysis treatment of CHCl3/CH3OH/H2O (10:10:3)-soluble lipids (no. 3), C. glutamicumΔmptB (no. 4) and C. glutamicumΔmptBpVWEx-Cg-mptB (no. 5) as described in the Experimental procedures. C and D. Incorporation of in vitro in situ Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2 into α(1→6)-linear mannooligosaccharides with either C. glutamicum, C. glutamicumΔmptB or C. glutamicumΔmptBpVWEx-Cg-mptB membrane preparations. Membranes were initially pre-treated with amphomycin, labelled using GDP-[14C]Man, re-harvested by centrifugation and extensively washed with buffer. At t = 0 min, an aliquot of membranes (20%) was processed as described in the Experimental procedures for CHCl3/CH3OH (2:1)-soluble lipids and analysed by TLC/autoradiography using CHCl3/CH3OH/NH4OH/H2O (65:25:0.4:3.6, v/v/v/v) (C) and CHCl3/CH3OH/H2O (10:10:3)-soluble lipids by SDS-PAGE/autoradiography (D). The carefully washed [14C]-labelled membranes were re-incubated for a further 60 min following the addition of 0.5 mg cold C50-PPM (Gurcha ). At t = 60 min, an equivalent membrane aliquot as based on t = 0 was again analysed for CHCl3/CH3OH (2:1) and CHCl3/CH3OH/H2O (10:10:3)-soluble lipids as described above (C and D).The above reaction mixtures were then further processed as described in the Experimental procedures section to provide the CHCl3/CH3OH/H2O (10:10:3)-soluble lipids initially using membrane/cell envelope extracts prepared from C. glutamicum to provide [14C]mannooligosaccharides (Fig. 4B, no. 1), which were further characterized by a series of degradation experiments. The [14C]mannooligosaccharides were sensitive to acetolysis (see Fig. 4B, no. 3), thus establishing a core α(1→6)-linear mannan backbone within the CHCl3/CH3OH/H2O (10:10:3)-soluble lipids. In separate experiments, the addition of amphomycin to block C50-PP[14C]M synthesis also inhibited the synthesis of the α(1→6)-linear mannanlipids, demonstrating that the synthesis of these CHCl3/CH3OH/H2O (10:10:3)-soluble lipids is PPM-dependent (Fig. 4B, no. 2) and similar to the previously characterized in vitro synthesized mycobacterial products (Besra ). SDS-polyacrylamide gel electrophoresis and subsequent autoradiography of the dried gels demonstrated that the CHCl3/CH3OH/H2O (10:10:3)-soluble lipids (Fig. 4B, no. 1) had slightly reduced mobility, indicating that they were smaller in size (Fig. 4B, left-panel inset), presumably because of their lack of α(1→2) branching characteristic of Cg-LM-A and Cg-LM-B (Tatituri ). As expected, synthesis of CHCl3/CH3OH/H2O (10:10:3)-soluble lipids using membranes from C. glutamicumΔmptB was completely abolished (Fig. 4B, no. 4). Furthermore, complementation with pVWEx-Cg-mptB restored synthesis of CHCl3/CH3OH/H2O (10:10:3)-soluble lipids (Fig. 4B, no. 5).
Chase of in situ labelled Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2 into α(1→6)-linear Cg-LM-A and Cg-LM-B utilizing membranes from C. glutamicum, C. glutamicumΔmptB and C. glutamicumΔmptB complemented strains
Amphomycin-treated wild-type C. glutamicum membrane/cell envelope extracts were initially pulsed with GDP-[14C]Man during a short incubation period (15 min) which was shown earlier to inhibit the synthesis of the CHCl3/CH3OH/H2O (10:10:3)-soluble α(1→6)-linear [14C]mannanlipids but, instead of extracting with CHCl3/CH3OH (2:1), the [14C]Man-labelled membranes were re-harvested by ultracentrifugation at 100 000 g, carefully washed and re-centrifuged twice using cold buffer, to remove unused GDP-[14C]Man. An aliquot of the [14C]Man-labelled membranes were extracted with CHCl3/CH3OH (2:1) and contained as expected solely Ac1PI[14C]M2 (3329 c.p.m.) and [14C]Man1GlcAGroAc2 (5474 c.p.m.) at t = 0 chase time as determined by TLC autoradiography and phosphorimaging (Fig. 4C). The CHCl3/CH3OH/H2O (10:10:3)-soluble lipids at t = 0 gave 226 c.p.m. The [14C]Man-labelled membranes were then further incubated for 60 min following the addition of excess exogenous cold C50-PPM (Gurcha ) prior to the standard extraction method to provide CHCl3/CH3OH (2:1) and CHCl3/CH3OH/H2O (10:10:3)-soluble lipids. The t = 60 chase time revealed a loss of radioactivity from both Ac1PI[14C]M2 (1709 c.p.m.) and [14C]Man1GlcAGroAc2 (2530 c.p.m.) as determined by TLC autoradiography and phosphorimaging, and incorporation into CHCl3/CH3OH/H2O (10:10:3)-soluble α(1→6)-linear [14C]mannooligosaccharidelipids (2895 c.p.m.) (Fig. 4D). The in vitro in situ chase experiment demonstrated that the α(1→6)-linear [14C]mannooligosaccharidelipids synthesized were elongation products of both Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2. Similar experiments repeated with C. glutamicumΔmptB in situ prepared [14C]-labelled membranes as above resulted in comparable products at t = 0 and t = 60 for CHCl3/CH3OH (2:1)-soluble lipids [Ac1PI[14C]M2 (t = 0, 3345 c.p.m.; t = 60, 2968 c.p.m.) and [14C]Man1GlcAGroAc2 (t = 0, 5840 c.p.m.; t = 60, 5025 c.p.m.)] and a lack of the synthesis of α(1→6)-linear [14C]mannooligosaccharidelipids (240 c.p.m.) from the elongation primers Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2 following the ‘chase period’ (Fig. 4C and D). Complementation of C. glutamicumΔmptB by transformation with plasmid pVWEx-Cg-mptB resulted in Ac1PI[14C]M2 (t = 0, 3229 c.p.m.; t = 60, 1725 c.p.m.) and [14C]Man1GlcAGroAc2 (t = 0, 5367 c.p.m.; t = 60, 2550 c.p.m.) and in vitro in situ synthesis of α(1→6)-linear [14C]mannooligosaccharidelipids (2471 c.p.m.) to levels comparable to wild type C. glutamicum (Fig. 4C and D). The data clearly demonstrate that Cg-MptB functions in vivo and in vitro as the initial α-mannosyltransferase, which extends Ac1PIM2 and Man1GlcAGroAc2. However, under the same in vitro in situ chase conditions, C. glutamicumΔmptB pVWEx-Mt-mptB (or pVWEx-Ms-mptB) failed to elongate the primers Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2 and restore synthesis of the α(1→6)-linear [14C]mannooligosaccharides (data not shown). In addition, experiments conducted with C. glutamicumΔmptB pVWEx-Mt-mptB and C. glutamicumΔmptB pVWEx-Ms-mptB and the addition of the exogenous primer Ac1PI[14C]M4 isolated from a M. bovis BCGPimE mutant also failed to restore the synthesis of the α(1→6)-linear [14C]mannooligosaccharides (data not shown).
In vitro analysis of α(1→6) mannosyltransferase activity using C. glutamicumΔmptB, C. glutamicumΔmptBΔmptA and complemented strains
Initial attempts to develop an in vitro assay using either purified recombinant-expressed MptB, or Escherichia coli membranes harbouring the protein, have thus far proved unsuccessful. Alternatively, we assessed the capacity of membrane preparations from C. glutamicum and its recombinant strains to catalyse α(1→6) mannosyltransferase activity in a previously defined acceptor assay utilizing the neoglycolipid acceptor α-D-Manp-(1→6)-α-D-Manp-O-C8 and C50-PP[14C]M as a sugardonor (Brown ) (Fig. 5A). The TLC autoradiography of products from in vitro assays when assayed with wild-type C. glutamicum resulted in the formation of product X, a trisaccharide α-D-[14C]Manp-(1→6)-α-D-Manp-(1→6)-α-D-Manp-O-C8, and product Y, a tetrasaccharide α-D-[14C]Manp-(1→6)-α-D-Manp-(1→6)-α-D-Manp-(1→6)-α-D-Manp-O-C8 (Fig. 5B). These products comigrated on TLC autoradiography with the corresponding products previously chemically characterized and prepared using mycobacterial membranes, and were cleaved by acetolysis, demonstrating that they were α(1→6)-linked [14C]Manproducts (Fig. 5B and C) (Brown ; 2001). The intensity of the major product X, a trisaccharide α-D-[14C]Manp-(1→6)-α-D-Manp-(1→6)-α-D-Manp-O-C8, was consistently slightly reduced in the case of C. glutamicumΔmptB (89 217 ± 4269 c.p.m.) in comparison with wild-type C. glutamicum (92 325 ± 5017 c.p.m.) (Fig. 5B). This reduction in activity corresponded to the residual α(1→6) mannosyltransferase activity observed in C. glutamicumΔmptA (2053 ± 604 c.p.m.) (Fig. 5B) (Mishra ). These results suggested the presence of two α(1→6) mannosyltransferase activities utilizing this neoglycolipid acceptor, catalysed by MptA and MptB, with the former more efficiently utilizing the neoglycolipid acceptor as a substrate. Assays containing membrane preparations from C. glutamicumΔmptBΔmptA showed no product formation on TLC, indicating a complete abrogation of both α(1→6) mannopyranosyltransferase activities from C. glutamicum (Fig. 5B). Analysis of the double mutant with pVWEx-Cg-mptB revealed a significant but weak band (2682 ± 940 c.p.m.) corresponding to product X on TLC analysis; however, when complemented with pVWEx-Cg-mptA, a similar phenotype to that of C. glutamicumΔmptB could be observed (80 614 ± 4135 c.p.m. for X), although at a slower transfer rate. The data confirmed that NCgl1505 is an α(1→6) mannopyranosyltransferase; however, the specific α(1→6) mannopyranosyltransferase activity is much lower in comparison with MptA, under the assay conditions utilizing the neoglycolipid acceptor.
Fig. 5
Analysis of products obtained in a cell-free assay for detecting α(1→6) mannosyltransferase activity. A. Biosynthetic reaction scheme of products formed in the α(1→6) mannosyltransferase assay utilizing α-D-Manp-(1→6)-α-D-Manp-O-C8 and C50-PP[14C]M. B. TLC analysis of products obtained in a cell-free assay for detecting α(1→6) mannosyltransferase activity with membranes prepared from M. smegmatis, C. glutamicum, C. glutamicumΔmptB, C. glutamicumΔmptA, C. glutamicumΔmptBΔmptA, C. glutamicumΔmptBΔmptA pVWEx-Cg-mptB and C. glutamicumΔmptBΔmptA pVWEx-Cg-mptA. C. TLC autoradiography of reaction products X and Y prepared with M. smegmatis and C. glutamicum membranes and subjected to acetolysis as described in the Experimental procedures (Brown ). D. TLC analysis of products obtained in a cell-free assay for detecting α(1→6) mannosyltransferase activity with membranes prepared from C. glutamicumΔmptAΔmptB, C. glutamicumΔmptAΔmptB pVWEx-Mt-mptB and C. glutamicumΔmptAΔmptB pVWEx-Ms-mptB. Assays were performed using the synthetic α-D-Manp-(1→6)-α-D-Manp-O-C8 neoglycolipid acceptor in a cell-free assay as described (Brown ). The products of the assay were re-suspended in n-butanol before scintillation counting. The incorporation of [14C]Manp was determined by subtracting counts present in control assays (incubations in the absence of acceptor), which were typically less than 100 c.p.m. per assay. The remaining labelled material was subjected to TLC using silica gel plates (5735 silca gel 60F254, Merck) developed in CHCl3:CH3OH:H2O; NH4OH (65:25:3.6:0.5, v/v/v/v) and the products visualized by phosphorimaging (Kodak K Screen). The results represent triplicate assays in three independent experiments. A schematic representation of the reaction is showed in (A) and the products X and Y are indicated by arrows.
Analysis of products obtained in a cell-free assay for detecting α(1→6) mannosyltransferase activity. A. Biosynthetic reaction scheme of products formed in the α(1→6) mannosyltransferase assay utilizing α-D-Manp-(1→6)-α-D-Manp-O-C8 and C50-PP[14C]M. B. TLC analysis of products obtained in a cell-free assay for detecting α(1→6) mannosyltransferase activity with membranes prepared from M. smegmatis, C. glutamicum, C. glutamicumΔmptB, C. glutamicumΔmptA, C. glutamicumΔmptBΔmptA, C. glutamicumΔmptBΔmptApVWEx-Cg-mptB and C. glutamicumΔmptBΔmptApVWEx-Cg-mptA. C. TLC autoradiography of reaction products X and Y prepared with M. smegmatis and C. glutamicum membranes and subjected to acetolysis as described in the Experimental procedures (Brown ). D. TLC analysis of products obtained in a cell-free assay for detecting α(1→6) mannosyltransferase activity with membranes prepared from C. glutamicumΔmptAΔmptB, C. glutamicumΔmptAΔmptB pVWEx-Mt-mptB and C. glutamicumΔmptAΔmptB pVWEx-Ms-mptB. Assays were performed using the synthetic α-D-Manp-(1→6)-α-D-Manp-O-C8 neoglycolipid acceptor in a cell-free assay as described (Brown ). The products of the assay were re-suspended in n-butanol before scintillation counting. The incorporation of [14C]Manp was determined by subtracting counts present in control assays (incubations in the absence of acceptor), which were typically less than 100 c.p.m. per assay. The remaining labelled material was subjected to TLC using silica gel plates (5735 silca gel 60F254, Merck) developed in CHCl3:CH3OH:H2O; NH4OH (65:25:3.6:0.5, v/v/v/v) and the products visualized by phosphorimaging (Kodak K Screen). The results represent triplicate assays in three independent experiments. A schematic representation of the reaction is showed in (A) and the products X and Y are indicated by arrows.
In vitro and mutational analysis of the mycobacterial MptB
To study the function of the mycobacterial MptB, we transformed the C. glutamicumΔmptBΔmptA double mutant with a plasmid containing either M. tuberculosis Rv1459c (pVWEx-Mt-mptB) or M. smegmatis MSMEG3120 (pVWEx-Ms-mptB). Membrane preparations of these strains restored in vitroα(1→6) mannopyranosyltransferase activity (Fig. 5D) by formation of the trisaccharideproduct X (Mt-MptB, 3159 ± 456 c.p.m. and Ms-MptB, 2949 ± 378 c.p.m.) to a similar level to that of the isogenic strain with pVWEx-Cg-mptB (Fig. 5B), showing that the M. tuberculosis and M. smegmatis gene could restore activity in an in vitro cell-free assay with the C. glutamicum double mutant. We then generated a null mutant of M. smegmatis mc2155 MSMEG3120 (homologue of Rv1459c) using specialized transduction (Fig. 6A), and analysed total lipids and lipoglycans in the mutant strain. Surprisingly, the mutant strain ΔMSMEG3120 had a total lipidprofile identical to the parental wild-type strain M. smegmatis mc2155 (TLC system designed to separate PIMs and other phospholipids is shown in Fig. 6B) and also synthesized LM and LAM (Fig. 6C). These results suggested that MSMEG3120, unlike its corynebacterial counterpart, was redundant and it was likely that another α-mannosyltransferase compensated for the loss of its function in the ΔMSMEG3120 mutant.
Fig. 6
Characterization of a M. smegmatis mptB (MSMEG3120) mutant. A. Map of the MSMEG3120 region in the wild type, parental strain M. smegmatis mc2155 and its corresponding region in the ΔMSMEG3120 mutant. res, resolvase site; hyg, hygromycin-resistance gene from Streptomyces hygroscopicus; sacB, sucrose counterselectable gene from Bacillus subtilis. B. 2D-TLC analysis of the [14C]-labelled (50 000 c.p.m.) polar lipids fraction from M. smegmatis (WT) and M. smegmatisΔMSMEG3120 strains. The polar lipid extract was examined on aluminum-backed plates of silica gel 60 F254 (Merck 5554), using CHCl3/CH3OH/H2O (60:30:6, v/v/v) in the first direction and CHCl3/CH3COOH/CH3OH/H2O (40:25:3:6, v/v/v/v) in the second direction. Lipids were visualized by autoradiography by overnight exposure of Kodak X-Omat AR film to the TLC plates to reveal labelled lipids. C. Lipoglycan analysis of wild-type M. smegmatis and M. smegmatisΔMSMEG3120 using SDS-PAGE and visualized using a Pro-Q emerald glycoprotein stain (Invitrogen). The four major bands represent glycoproteins of 180, 82, 42 and18 kDa respectively.
Characterization of a M. smegmatismptB (MSMEG3120) mutant. A. Map of the MSMEG3120 region in the wild type, parental strain M. smegmatis mc2155 and its corresponding region in the ΔMSMEG3120 mutant. res, resolvase site; hyg, hygromycin-resistance gene from Streptomyces hygroscopicus; sacB, sucrose counterselectable gene from Bacillus subtilis. B. 2D-TLC analysis of the [14C]-labelled (50 000 c.p.m.) polar lipids fraction from M. smegmatis (WT) and M. smegmatisΔMSMEG3120 strains. The polar lipid extract was examined on aluminum-backed plates of silica gel 60 F254 (Merck 5554), using CHCl3/CH3OH/H2O (60:30:6, v/v/v) in the first direction and CHCl3/CH3COOH/CH3OH/H2O (40:25:3:6, v/v/v/v) in the second direction. Lipids were visualized by autoradiography by overnight exposure of Kodak X-Omat AR film to the TLC plates to reveal labelled lipids. C. Lipoglycan analysis of wild-type M. smegmatis and M. smegmatisΔMSMEG3120 using SDS-PAGE and visualized using a Pro-Q emerald glycoprotein stain (Invitrogen). The four major bands represent glycoproteins of 180, 82, 42 and18 kDa respectively.
Discussion
Over the past decade, much research has been carried out on the mechanisms and genetics of mycobacterial cell wall carbohydrate biosynthesis, particularly the formation of the essential AG (Daffe ; Besra ; Belanger ; Kremer ; Alderwick ; 2006a, 2006b; Berg ; Seidel ) and the immunomodulatory heteropolysaccharides LM and LAM (Schaeffer ; Kordulakova ; Kremer ; Zhang ; Dinadayala ; Kaur ; 2007; Mishra ). An archetypal biosynthetic pathway is now emerging for the formation of these important macromolecules, which predominantly include enzymes from the GT-A, B and C superfamily of glycosyltransferases (Liu and Mushegian, 2003) (Fig. 1). PimA, PimB, PimB′ and PimC, all of which are GT-A/B glycosyltransferases, have been shown to be involved in PIM biosynthesis, which serves as a substrate for LM/LAM extension and maturation (Schaeffer ; Kordulakova ; Kremer ; Lea-Smith ; Mishra ). We and others recently identified the GT-C glycosyltransferase MptA as an α(1→6) mannosyltransferase involved in intermediate LM biosynthesis, specifically in distal α(1→6) core LM formation (Kaur ; Mishra ). Apart from a core α(1→6) mannan backbone, α(1→2) mannose residues punctuate LM, and the GT-C glycosyltransferase Rv2181 has been identified to be responsible for some, if not all, of these branched mannose residues (Kaur ). At some point, LM is further glycosylated by other GT-C glycosyltransferases, such as EmbC for the biosynthesis of LAM (Zhang ) and then mannose-capped (Dinadayala ; Appelmelk ). In this study, we have characterized the role of a putative glycosyltransferase (NCgl1505) belonging to the GT-C superfamily of glycosyltransferases (Liu and Mushegian, 2003) by virtue of genomic deletion in C. glutamicum. We present MptB as a PPM-dependent α(1→6) mannosyltransferase, involved in early stages of proximal α(1→6) core Cg-LM-A and Cg-LM-B biosynthesis in C. glutamicum (Fig. 7).
Fig. 7
Schematic representation of the glycosyltransferases involved in C. glutamicum lipoglycan biosynthesis.
Schematic representation of the glycosyltransferases involved in C. glutamicum lipoglycan biosynthesis.Our initial in vivo and in vitro studies of PIM and Man1GlcAGroAc2 biosynthesis in C. glutamicumΔmptB highlighted no apparent change in lipidprofiles, compared with those from wild-type C. glutamicum (Figs S1 and 4A). It is reasonable to conclude from the data that MptB is not involved in either early PIM or Man1GlcAGroAc2 biosynthesis. This was not surprising as these early biosynthetic steps are completely unique to enzymes belonging to the GT-A/B glycosyltransferase family, which utilize GDP-mannose as a substrate (Liu and Mushegian, 2003). Assays utilizing membrane preparations from C. glutamicum and C. glutamicumΔmptB indicated that there was no further accumulation of higher mannosylated versions of PIMs and Man1GlcAGroAc2. The lack of higher mannosylated versions in C. glutamicum suggests that the next committed step in lipoglycan biosynthesis stems from Ac1PIM2 and Man1GlcAGroAc2 and that this is catalysed by Cg-MptB.As a result of absence of MptB, C. glutamicumΔmptB is unable to synthesize Cg-LAM, Cg-LM-A and Cg-LM-B in vivo, which is in contrast to our earlier studies on MptA, where a truncated Cg-LM-A and Cg-LM-B species was synthesized (Mishra ). In C. glutamicum, we now also present in vitro evidence that Ac1PIM2 and Man1GlcAGroAc2 are acceptors for Cg-MptB, the first GT-C α-mannosyltransferase committed to Cg-LM-A and Cg-LM-B biosynthesis. This is supported by in vitro in situ chase experiments elongating the Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2 primers by the sugardonorC50-PPM. These crucial observations, together with the presence of Ac1PIM2 and Man1GlcAGroAc2, completely support our hypothesis that Cg-MptBmannosylates Ac1PIM2 and Man1GlcAGroAc2. Our previous experiments on glycosyltransferase activities in membranes prepared from C. glutamicumΔmptA identified a residual α(1→6) mannosyltransferase activity (Mishra ). This α-mannosyltransferase activity can now be attributed to the presence of MptB as, upon its deletion in C. glutamicum, a partial depletion in α(1→6) mannosyltransferase activity is observed and a complete loss of activity is found upon deletion of both Cg-mptA and Cg-mptB. These data together with the in vivo analyses identify MptB as a bona fideα(1→6) mannosyltransferase. Interestingly, α(1→6) mannan extension is more complex in Mycobacterium based on the evidence that Mt-MptB and Ms-MptB fail to complement the C. glutamicumΔmptB mutant and suggests a slightly different substrate specificity of the MptB orthologues of M. tuberculosis and M. smegmatis. Although, clearly α(1→6) mannosyltransferase(s) based on in vitro data, studies are currently underway exploring heterologous protein expression systems for Mt-MptB and Ms-MptB in combination with a variety of substrates in a revised in vitro assay format.Given the high degree of homology between the C. glutamicum and mycobacterial orthologues of MptB and the similar organization of neighbouring genes in the two genera, we expected deletion of M. smegmatismptB (MSMEG3120) to have the same effect as that in C. glutamicum. However, surprisingly, the M. smegmatismptB mutant still synthesised LM and LAM, indicating that another, yet unidentified, α-mannosyltransferase could substitute for MptB in the mutant M. smegmatis strain. It has been previously shown that a high degree of functional redundancy exists in key enzymes involved in mycobacterial cell wall assembly, for instance, PimB/PimB′ and MgtA (Schaeffer ; Tatituri ; Lea-Smith ; Mishra ), PimC (Kremer ), and EmbA and EmbB (Berg ) in PIM/LM/LAM and AG biosynthesis, and the antigen 85 complex in mycolic acid biosynthesis (Puech ). In this particular case, the C. glutamicum mutant study enabled the assignment of function to the GT-C glycosyltransferase NCgl1505, which would have otherwise not been possible if similar studies would have concentrated solely on mycobacterial species.Interestingly, the mechanism of how Ac1PIM2 traverses the cytoplasmic membrane remains poorly understood. Bioinformatic inspection of the locus surrounding MptB has highlighted two possible candidates for potential flippases. Downstream of the putative glycosyltransferase Rv1459c, three conserved genes are located in all Corynebacterinaeae and the expression of the four-gene locus in C. glutamicum is translationally coupled (Wang ). This presents strong evidence for a functional coupling of the putative glycosyltransferase Rv1459c with Rv1458c, Rv1457c and Rv1456c. The latter genes encode for two ABC transporter integral membrane proteins, with Rv1458c encoding for an ATP-dependent binding protein. Applying structure prediction comparisons and hidden Markov models (Soding ), Rv1458c exhibits remote structural similarities to sugar-binding proteins of ABC carriers, such as the sugar-binding protein of Pyrococcus horikoshii or the maltose/maltodextrin-binding protein MALK of E. coli (Lu ). Rv1457c encodes a permease component of an ABC-2-type transporter, characteristically involved in catalysing the export of drugs and carbohydrates (Reizer ). As transmembrane channels of ABC-2-type transporters are either homo- or heterooligomers and Rv1456c has features of a transporter protein, it is plausible to suggest that the membrane channel coupled to the glycosyltransferase might be a heterooligomer made up of Rv1457c and Rv1456c. In a previous study, Wang proposed that one or more of the proteins encoded by the orthologues of Rv1456c-Rv1459c gene locus in C. matruchotii was involved in mycolic acid transport. A transposon mutant with an insertion in the cluster had an altered mycolic acidprofile. However, in light of the evidence described in this work, this change in mycolylation may be an indirect effect as a result of the loss of Cg-LAM and Cg-LM-A/B. Further examination of this gene locus is required for characterization of potential roles in mycolic acid and glycolipid transport across the membrane bilayer.
Experimental procedures
Bacterial strains and growth conditions
Corynebacterium glutamicum ATCC 13032 (referred to the remainder of the text as C. glutamicum) and E. coli DH5αmcr were grown in Luria–Bertani broth (Difco) at 30°C and 37°C respectively. The recombinant strains generated in this study were grown on rich BHI medium (Difco), and the salt mediumCGXII used for C. glutamicum as described (Eggeling and Bott, 2005). Kanamycin and ampicillin were used at a concentration of 50 μg ml−1. Samples for lipid analysis were prepared by harvesting cells at an OD of 10–15, followed by a saline wash and freeze drying. M. smegmatis strains were grown in Tryptic Soy Broth (TSB; Difco) containing 0.05% Tween80 (TSBT). Solid media were made by adding 1.5% agar to the above-mentioned broths. The concentrations of antibiotics used for M. smegmatis were 100 μg ml−1 for hygromycin and 20 μg ml−1 for kanamycin. M. tuberculosis H37Rv DNA was obtained from the NIH Tuberculosis Research Materials and Vaccine Testing Contract at Colorado State University. All other chemicals were of reagent grade and obtained from Sigma-Aldrich.
Construction of plasmids and strains
The genes analysed were the orthologues of Rv1459c and NCgl1505 from M. tuberculosis and C. glutamicum, respectively, termed mptB. The vectors made were pVWEx-Mt-mptB, pVWEx-Ms-mptB, pVWEx-Cg-mptB, pET-Mt-mptB, pET-Cg-mptB and pK19mobsacBΔmptB. To construct the deletion vector pK19mobsacBΔmptB, cross-over PCR was applied with primer pairs AB (A, CGTTAAGCTTCCAAAGGTAACCTTATTTATGCTGGCCACAGG; B, CCCATCCACTAAACTTAAACACGATGCGCGGCAAAGT) and CD (C, TGTTTAAGTTTAGTGGATGGGGAGTTTGAGGCGGAATCC; D, GCATGGATCCGCGGTAAAACCTTCGCACATTTCAATG) (all primers in 5′-3′ direction) and C. glutamicum genomic DNA as template. Both amplified products were used in a second PCR with primer pairs AD to generate a 597 bp fragment consisting of sequences adjacent to Cg-mptB, which was ligated with HindIII-BamHI-cleaved pK19mobsacB.To enable expression of Cg-mptB in C. glutamicum, the primer pair EF was used (E, CGAATTGGATCCTCAGTGTAAACCAAAGGTTGGATTCC; F, GATATGTTAACAGGGAGATATAGTTGCCGCGCATCGG) to amplify C. glutamicummptB, which was ligated with SalI-, BamHI-cleaved pVWEx to generate pVWEx-Cg-mptB. For expression of Cg-mptB in E. coli, the primer pair GF was used (G, CGCGTCATATGTTGCCGCGCATCGGCAC) and the resulting product ligated with NdeI-, BamHI-cleaved pET16b (Novagen) to generate pET-Cg-mptB. To enable expression of Mt-mptB in C. glutamicum, the primer pair HJ was used (H, GATATGTTAACAGGGAGATATAGATGGCAGCCCGCCAC; J, GGAATTGGATCCTCACGTGGAATCAGCGTAGGCG) to amplify M. tuberculosismptB, which was ligated with SalI-, BamHI-cleaved pVWEx to generate pVWEx-Mt-mptB. To express Mt-mptB in E. coli, the primer pair JK (K, CTTAATGGATCCATGGCAGCCCGCCAC) was used and the resulting product ligated with BamHI-cleaved pET16b to generate pET-Mt-mptB. To enable expression of Ms-mptB in C. glutamicum, the primer pair MsB_for (5′-CGCGTCGACAAGGAGATATAGATATGATGGCCAGCCGCCTGTCGT-3′) and MsB_rev (5′-CCGGAATTCTTACGGGGATTCAGCGTAGGCGTC-3′) was used to amplify Ms-mptB, which was cloned in pUC18 and ligated as an EcoRI/SalI fragment with similar cleaved pEKEx2 to generate pEKEx2-Ms-mptB.All plasmids were confirmed by sequencing. The chromosomal deletion of Cg-mptB was performed as described previously using two rounds of positive selection (Schafer ), and its successful deletion was verified by use of primer pair AB and the additional primer pair LM (L, GCGCGTATCACCGTCTCCGGTGTG; M, GCTGTTGGCCACCTGACAGACGTCG). Because of the similarity of MptB with MptA, C. glutamicumΔmptB was transformed together with pK19mobsacBΔmptA (Mishra ) to yield the double mutant C. glutamicumΔmptBΔmptA. Plasmids pVWEx-Mt-mptB, pVWEx-Ms-mptB and pVWEx-Cg-mptB were introduced into C. glutamicumΔmptB and C. glutamicumΔmptBΔmptA by electroporation with selection to kanamycin resistance (25 μg ml−1).To generate an allelic recombination substrate to replace MSMEG3120 with hyg, approximately 1 kb of upstream and downstream flanking sequences were PCR-amplified from M. smegmatis mc2155 genomic DNA using the primer pairs MS3120LL (ttt-ttt-ttc-cat-aaa-ttg gAT-TGT-GAC-GGA-ATT-CGT-CCG-ACG-GT) and MS3120LR (ttt-ttt-ttc-cat-ttc-ttg-gAT GCC-CTG-ACC-GAT-CCA-CAG-GAA), and MS3120RL (ttt-ttt-ttc-cat-aga-ttg-gTG-TTC-CAG-ATC-GTC-ATG-GCA-ACC-CT) and MS3120RR (ttt-ttt-ttc-cat-ctt-ttg-gAT-GAT-CAC-GAT-GCG-ATC-GGC-GAG-TT) respectively. The PCR products consisted of a 682 bp upstream DNA fragment (including the last 15 bp coding sequence of MSMEG3121, 89 bp intergenic sequence and the first 578 bp of MSMEG3120) and a 813 bp downstream DNA fragment (including the last 160 bp of MSMEG3120 and the first 655 bp of MEMEG3119). Following restriction digestion of the primer-introduced Van91I sites (shown in lower case), the PCR fragments were cloned into Van91I-digested p0004S to yield the knockout plasmid pΔMSMEG3120 which was then packaged into the temperature-sensitive mycobacteriophage phAE159 as described previously (Bardarov ), to create a recombinant phage, which was then used to transduce wild-type M. smegmatis mc2155 to generate the ΔMSMEG3120 deletion mutant which was confirmed by Southern blot and PCR analysis (data not shown).
Lipid extraction and analysis
Polar lipids and apolar lipids were extracted as described previously (Dobson ). Briefly, 6 g of dried cells of wild-type, mutant and complemented strains of C. glutamicum or M. smegmatis were mixed thoroughly using the biphasic mixture of methanolic saline (220 ml containing 20 ml of 0.3% NaCl and 200 ml of CH3OH) and petroleum ether (220 ml) for 2 h. The upper petroleum-ether layer containing apolar lipids were separated following centrifugation. The lower methanolic saline extract was further extracted using petroleum ether (220 ml), mixed and centrifuged. The two upper petroleum-ether fractions were combined and dried. Polar lipids were extracted by the addition of CHCl3/CH3OH/0.3% NaCl (260 ml, 9:10:3, v/v/v) added to the lower methanolic saline phase and stirred for 4 h. The mixture was filtered and the filter cake re-extracted twice with CHCl3/CH3OH/0.3% NaCl (85 ml, 5:10:4, v/v/v). CHCl3 (145 ml) and 0.3% NaCl (145 ml) were added to the combined filtrates and stirred for 1 h. The mixture was allowed to settle, and the lower layer containing the polar lipids recovered and dried. The polar lipid extract was examined by 2D-TLC on aluminum-backed plates of silica gel 60 F254 (Merck 5554), using CHCl3/CH3OH/H2O (60:30:6, v/v/v) in the first direction and CHCl3/CH3COOH/CH3OH/H2O (40:25:3:6, v/v/v/v) in the second direction. C. glutamicum glycolipids were visualized by either spraying plates with α-naphthol/sulphuric acid or 5% ethanolic molybdophosphoric acid followed by gentle charring of plates. Identification of phospholipids was carried out using the Dittmer and Lester reagent as described (Tatituri ).
Extraction and purification of lipoglycans
Lipoglycans from C. glutamicum and M. smegmatis strains were extracted as described previously (Nigou ; Ludwiczak ). Briefly, delipidated cells were re-suspended in deionized water and disrupted by probe sonication (MSE Soniprep 150, 12 μm amplitude, 60 s on, 90 s off for 10 cycles, on ice). Ethanol extraction was carried out by mixing C2H5OH/H2O (100 ml, 1:1, v/v) to the cell suspension and refluxing at 68°C, for 12 h intervals, followed by centrifugation and recovery of the supernatant. This C2H5OH/H2O extraction process was repeated five times and the combined supernatants dried. The dried supernatant was then treated with phenol/H2O (80%, w/w) at 70°C for 1 h followed by dialysis using a 1500 MWCO membrane (Spectrapore) against deionized water. The retentate was dried, re-suspended in water and treated sequentially digested with α-amylase, DNase, RNase chymotrypsin and trypsin, and the lipoglycan recovered following extensive dialysis using a 1500 MWCO membrane (Spectrapore) against deionized water (Nigou ). The lipoglycans were monitored on 15% SDS-PAGE using either a silver stain utilizing periodic acid and silver nitrate (Hunter ) or a Pro-Q emerald glycoprotein stain (Invitrogen).
Extraction and analysis of [14C]PIMs from M. smegmatis strains
Mycobacterium smegmatis cultures (5 ml) were grown in TSB and metabolically labelled using 1 μCi ml−1[1,2-14C]acetate (50–62 mCi mmol−1, GE Healthcare, Amersham Bioscience) at an OD600 of 0.4 and cultures grown for a further 4 h at 37°C with gentle shaking. Cells were harvested by centrifugation, washed once with PBS and a small-scale apolar and polar lipid extraction performed according to the methods of Dobson . The polar lipid extracts were re-suspended in CHCl3:CH3OH (2:1) and crude lipid (50 000 c.p.m.) applied to the corners of 6.6 × 6.6 cm pieces of Merck 5554 aluminium-backed TLC plates. The plates were developed using CHCl3:CH3OH:H2O (60:30:6, v/v/v) in the first direction and CHCl3:CH3COOH:CH3OH:H2O (40:25:3:6, v/v/v/v) in the second direction to separate [14C]-labelled PIMs. Lipids were visualized by autoradiography by overnight exposure of Kodak X-Omat AR film to the TLC plates to reveal labelled lipids and compared with known standards.
Preparation of enzymatically active membranes and cell envelope fraction
Mycobacterium smegmatis and C. glutamicum strains used in this study were cultured to the mid-logarithmic growth phase in 1 l BHIS medium supplemented with kanamycin (25 μg ml−1) and IPTG (0.2 mM) where appropriate. Cells were harvested by centrifugation, re-suspended in 20 ml of buffer A (50 mM MOPS pH 7.9, 5 mM β-mercaptoethanol and 5 mM MgCl2) and lysed immediately by sonication (60 s on, 90 s off for a total of 10 cycles). The lysate was clarified by centrifugation at 27 000 g (4°C, 30 min) and membranes were deposited by centrifugation of the supernatant at 100 000 g (4°C, 90 min). The membranes were re-suspended in buffer A to a final protein concentration of 20 mg ml−1. The 27 000 g pellet was re-suspended in 10 ml of buffer A and 15 ml of Percoll (Pharmacia, Sweden), and centrifuged at 27 000 g for 60 min at 4°C. The particulate, upper diffuse band, containing both cell walls and membranes, was removed, collected by centrifugation, washed three times in buffer A, and finally re-suspended in 1 ml of buffer A. The final concentration of this Percoll-60 cell envelope fraction (P-60) was 20 mg ml−1.
In vitro incorporation of radiolabelled Man from GDP-[14C]Man into membrane lipids
Initial assays involved incubation of membranes (0.5 mg of protein), P-60 fraction (0.5 mg of protein) in buffer A, containing 1 mM ATP and 0.25 μCi of GDP-[14C]Man (Amersham Pharmica Biotech, Uppsala, Sweden, 303 mCi mmol−1) in a final volume of 100 μl incubated at 37°C for 60 min as described (Besra ). The reactions were terminated by the addition of CHCl3/CH3OH (6 ml, 2:1, v/v), centrifuged and the pellet re-extracted thrice using CHCl3/CH3OH (6 ml, 2:1, v/v). The resulting insoluble pellet was sequentially washed three times with 0.9% NaCl in CH3OH (2 ml), CH3OH/H2O (2 ml, 1:1, v/v) and CH3OH (2 ml) to remove residual GDP-[14C]Man before extracting three times with CHCl3/CH3OH/H2O (2 ml, 10:10:3, v/v/v). The CHCl3/CH3OH/H2O (10:10:3)-soluble lipids were dried and re-suspended in 200 μl of CHCl3/CH3OH/H2O (10:10:3, v/v/v) and an aliquot (10%) of the resulting [14C]-labelled mannooligosaccharidepolymers [α(1→6)-linear-LM-A and α(1→6)-linear-LM-B] quantified by liquid scintillation counting using 5 ml of EcoScintA (National Diagnostics, Atlanta, GA). The remaining aliquot was analysed by SDS-PAGE/autoradiography. The original combined CHCl3/CH3OH (2:1) organic extracts were dried and re-suspended in CHCl3/CH3OH/H2O (4 ml, 10:10:3, v/v/v) followed by the addition of 1.75 ml of CHCl3 (1.75 ml) and H2O (0.75 ml). The reaction mixture was vortexed, centrifuged and the upper aqueous phase removed. The organic phase was washed three times with CHCl3/CH3OH/H2O (2 ml, 3:47:48, v/v/v), and the final organic extract dried under a stream of nitrogen to afford C50-PP[14C]M, Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2. Alternatively, the combined CHCl3/CH3OH (2:1) organic extracts were dried and re-suspended in CHCl3/CH3OH/0.8 M NaOH (4 ml, 10:10:3, v/v/v) and heated at 50°C for 30 min, followed by the addition of CHCl3 (1.75 ml) and H2O (0.75 ml), and processed as described above to afford C50-PP[14C]M. The resulting C50-PP[14C]M, Ac1PI[14C]M2 and [14C]Man1GlcAGroAc2 products were subjected to TLC/autoradiography using silica gel plates (5735 silca gel 60F254, Merck) developed in CHCl3:CH3OH:H2O:NH4OH (65:25:3.6:0.5, v/v/v/v) and the products visualized and quantified by phosphorimaging (Kodak K Screen).
Pre-treatment of membranes with amphomycin and further incorporation of in situ labelled [14C]Man-labelled membrane glycolipids into CHCl3/CH3OH/H2O (10:10:3)-soluble [14C]-labelled mannooligosaccharide polymers
The lipopetide amphomycin (2 mg) was dissolved in 500 μl of 0.1 M acetic acid, and the solution adjusted to 0.05 M sodium acetate (pH 7.0) with 0.1 M NaOH for a final concentration of 2 mg ml−1 (Gurcha ). Membranes/cell envelope (5 mg) in 500 μl of buffer A were pre-incubated with amphomycin (10 μg per 100 μl reaction mixture) at 37°C for 15 min, resulting in inhibition of PPM synthesis, prior to a further short 15 min pulse incubation with 1.25 μCi of GDP-[14C]Man (Amersham Pharmica Biotech, Uppsala, Sweden, 303 mCi mmol−1). A 20% aliquot of the reaction mixture was processed as described above to afford Ac1PI[14C]M2, [14C]Man1GlcAGroAc2 and CHCl3/CH3OH/H2O (10:10:3)-soluble lipids. The remaining amphomycin-treated membranes/cell envelope containing in situ[14C]Man-labelled lipids (Ac1PIM2 and Man1GlcAGroAc2) were diluted with buffer A and recovered by re-centrifugation at 100 000 g for 60 min, carefully washed and re-centrifuged with cold buffer A twice, thereby ensuring complete removing of unused GDP-[14C]Man (Besra ). The [14C]Man-labelled membranes were then carefully re-suspended in 400 μl buffer A prior to the addition of 0.5 mg C50-PPM in 1% IgePal CA-630 (40 μl, Sigma Aldrich) (Gurcha ), incubated further at 37°C for 60 min and a 100 μl aliquot processed/analysed as described above to provide the CHCl3/CH3OH (2:1) and CHCl3/CH3OH/H2O (10:10:3)-soluble [14C]-labelled mannose-containing products.
In vitro analysis of α(1→6) mannosyltransferase activity
The neoglycolipid acceptors α-D-Manp-(1→6)-α-D-Manp-O-C8 (stored in C2H5OH) and C50-PP[14C]M (stored in CHCl3/CH3OH, 2:1, v/v), prepared as described (Gurcha ), were separated into aliquots into 1.5 ml eppendorf tubes to a final concentration of 2 mM and 0.25 μCi (0.305 Ci mmol−1) respectively, and dried under nitrogen. IgePal CA-630 (8 μl, Sigma Aldrich) was added and the tubes sonicated to re-suspend the lipid-linked components, and the remaining assay components in a final volume of 80 μl were added, which included: 1 mM ATP, 1 mM NADP, and membrane protein (1 mg) from either C. glutamicum, C. glutamicumΔmptB, C. glutamicumΔmptA, C. glutamicumΔmptBpVWEx-Cg-mptB, C. glutamicumΔmptBΔmptA, C. glutamicumΔmptBΔmptApVWEx-Cg-mptB, C. glutamicumΔmptBΔmptApVWEx-Cg-mptA, C. glutamicumΔmptBΔmptA pVWEx-Mt-mptB and C. glutamicumΔmptBΔmptA pVWEx-Ms-mptB. Assays were incubated at 37°C for 1 h and then quenched by the addition of CHCl3/CH3OH (533 μl, 1:1, v/v). The reaction mixtures were then centrifuged at 27 000 g for 15 min at 4°C, the supernatant removed and dried under nitrogen. The residue was re-suspended in C2H5OH/H2O (700 μl, 1:1, v/v) and loaded onto a 1 ml SepPak strong anion exchange cartridge (Supleco) pre-equilibrated with C2H5OH/H2O (1:1, v/v). The column was washed with 2 ml of C2H5OH, and the eluate collected, dried and partitioned between the two phases arising from a mixture of n-butanol (3 ml) and water (3 ml). The resulting organic phase was recovered after centrifugation at 3500 g, and the aqueous phase again extracted twice with 3 ml of water-saturated butanol. The pooled extracts were back-washed twice with n-butanol-saturated water (3 ml). The n-butanol fraction was dried and re-suspended in 200 μl of n-butanol. The extracted radiolabelled material was quantified by liquid scintillation counting using 10% of the labelled material and 5 ml of EcoScintA (National Diagnostics, Atlanta, GA). The incorporation of [14C]Manp was determined by subtracting counts present in control assays (incubations in the absence of acceptor), which were typically less than 100 c.p.m. per assay. The remaining labelled material was subjected to TLC using silica gel plates (5735 silca gel 60F254, Merck) developed in CHCl3:CH3OH:H2O:NH4OH (65:25:3.6:0.5, v/v/v/v) and the products visualized by phosphorimaging (Kodak K Screen).
Selective cleavage by partial acetolysis
[14C]-mannosylated products were dried and acetylated using 40 μl of pyridine/acetic anhydride (1:1, v/v) for 30 min at 100°C. The products were dried in a Speed Vac and residual acetic acid removed by co-evaporation with toluene (2 × 50 μl). The per-O-acetylated products were dissolved in 30 μl of acetic anhydride/acetic acid/sulphuric acid (10:10:1, v/v/v) and acetolysis performed for 8 h at 37°C (Brown ). The reaction mixture was then quenched by the addition of 10 μl pyridine and 500 μl H2O. After 1 h, the per-O-acetylated products were recovered by extraction into CHCl3. The CHCl3 phase was washed three times with 500 μl of H2O and dried. The products were then de-O-acetylated using 200 μl of concentrated ammonium hydroxide/methanol (1:1, v/v) for 60 h at 37°C and subsequently dried. The acetolysis products derived from α-D-[14C]Manp-(1→6)-α-D-Manp-(1→6)-α-D-Manp-O-C8 were re-dissolved in 40% propan-1-ol and analysed by TLC using one development with propan-1-ol/acetone/H2O (5:4:1, v/v/v), followed by one development with butan-1-ol/acetone/H2O (5:3.5:1.5, v/v/v) and the products visualized by phosphorimaging (Kodak K Screen). The acetolysis products derived from the CHCl3/CH3OH/H2O (10:10:3)-soluble [14C]-labelled mannooligosaccharidepolymer [α(1→6)-linear-LM-A and α(1→6)-linear-LM-B] were re-dissolved in water and applied onto a 50 ml Bio-Gel P-2 gel filtration column (30 × 1.5 cm; Bio-Rad). Elution from the column was performed using water and 1 ml fractions collected which were subsequently quantified by liquid scintillation counting. The control de-O-acylated [14C]-labelled mannooligosaccharidepolymers prior to acetolysis eluted form the Bio-Gel P-2 column at fractions 11–13 and degraded acetolysis products were retained and co-eluted in later fractions 33–39 based on a de-O-acylated PI[14C]M2, [14C]Man1GlcAGroAc2 and [14C]Man standards.
Authors: Devinder Kaur; Stefan Berg; Premkumar Dinadayala; Brigitte Gicquel; Delphi Chatterjee; Michael R McNeil; Varalakshmi D Vissa; Dean C Crick; Mary Jackson; Patrick J Brennan Journal: Proc Natl Acad Sci U S A Date: 2006-08-31 Impact factor: 11.205
Authors: Yasu S Morita; Chubert B C Sena; Ross F Waller; Ken Kurokawa; M Fleur Sernee; Fumiki Nakatani; Ruth E Haites; Helen Billman-Jacobe; Malcolm J McConville; Yusuke Maeda; Taroh Kinoshita Journal: J Biol Chem Date: 2006-06-27 Impact factor: 5.157
Authors: Luke J Alderwick; Eva Radmacher; Mathias Seidel; Roland Gande; Paul G Hitchen; Howard R Morris; Anne Dell; Hermann Sahm; Lothar Eggeling; Gurdyal S Besra Journal: J Biol Chem Date: 2005-07-21 Impact factor: 5.157
Authors: Premkumar Dinadayala; Devinder Kaur; Stefan Berg; Anita G Amin; Varalakshmi D Vissa; Delphi Chatterjee; Patrick J Brennan; Dean C Crick Journal: J Biol Chem Date: 2006-05-16 Impact factor: 5.157
Authors: Raju V V Tatituri; Petr A Illarionov; Lynn G Dover; Jerome Nigou; Martine Gilleron; Paul Hitchen; Karin Krumbach; Howard R Morris; Neil Spencer; Anne Dell; Lothar Eggeling; Gurdyal S Besra Journal: J Biol Chem Date: 2006-12-19 Impact factor: 5.157
Authors: Luke J Alderwick; Lynn G Dover; Mathias Seidel; Roland Gande; Hermann Sahm; Lothar Eggeling; Gurdyal S Besra Journal: Glycobiology Date: 2006-08-04 Impact factor: 4.313
Authors: Kathryn C Rahlwes; Stephanie A Ha; Daisuke Motooka; Jacob A Mayfield; Lisa R Baumoel; Justin N Strickland; Ana P Torres-Ocampo; Shota Nakamura; Yasu S Morita Journal: J Biol Chem Date: 2017-08-29 Impact factor: 5.157
Authors: Michael Young; Vladislav Artsatbanov; Harry R Beller; Govind Chandra; Keith F Chater; Lynn G Dover; Ee-Been Goh; Tamar Kahan; Arseny S Kaprelyants; Nikos Kyrpides; Alla Lapidus; Stephen R Lowry; Athanasios Lykidis; Jacques Mahillon; Victor Markowitz; Konstantinos Mavromatis; Galina V Mukamolova; Aharon Oren; J Stefan Rokem; Margaret C M Smith; Danielle I Young; Charles L Greenblatt Journal: J Bacteriol Date: 2009-11-30 Impact factor: 3.490
Authors: Helen L Birch; Luke J Alderwick; Doris Rittmann; Karin Krumbach; Helga Etterich; Anna Grzegorzewicz; Michael R McNeil; Lothar Eggeling; Gurdyal S Besra Journal: J Bacteriol Date: 2009-05-29 Impact factor: 3.490
Authors: Shiva Kumar Angala; Juan Manuel Belardinelli; Emilie Huc-Claustre; William H Wheat; Mary Jackson Journal: Crit Rev Biochem Mol Biol Date: 2014-06-10 Impact factor: 8.250
Authors: Arek K Rainczuk; Stephan Klatt; Yoshiki Yamaryo-Botté; Rajini Brammananth; Malcolm J McConville; Ross L Coppel; Paul K Crellin Journal: J Biol Chem Date: 2020-03-26 Impact factor: 5.157