| Literature DB >> 17593977 |
Marina Pfalz1, Heiko Vogel, Thomas Mitchell-Olds, Juergen Kroymann.
Abstract
BACKGROUND: In Arabidopsis thaliana and other crucifers, the glucosinolate-myrosinase system contributes to resistance against herbivory by generalist insects. As yet, it is unclear how crucifers defend themselves against crucifer-specialist insect herbivores. METHODOLOGY/PRINCIPALEntities:
Mesh:
Substances:
Year: 2007 PMID: 17593977 PMCID: PMC1892800 DOI: 10.1371/journal.pone.0000578
Source DB: PubMed Journal: PLoS One ISSN: 1932-6203 Impact factor: 3.240
Figure 1Natural variation among 16 Arabidopsis accessions for insect resistance, growth and defense-related traits.
Accessions are ranked according to increasing susceptibility to herbivory by Pieris brassicae larvae. Shown are least squares means and standard errors (vertical bars) for Pieris brassicae herbivory, Plutella xylostella herbivory, plant diameter, leaf upper-side trichomes, myrosinase activity, aliphatic and indole glucosinolates. Values for Da(1)-12 are set as 100.
Figure 2Genetic map of Da(1)-12×Ei-2 recombinant inbred lines.
Shown are markers and genetic distances between adjacent markers along the chromosomes. Triangles indicate the approximate location of centromeres. The white bar for chromosome 1 indicates a region with marker distortion. Grey bars indicate 2-LOD support intervals for Pieris resistance QTL. Known genes involved in glucosinolate biosynthesis, hydrolysis, and gene regulation are shown below chromosomes; explanations, AGI numbers and references are given in Table S2.
Figure 3QTL for insect resistance and defense-related traits in Da(1)-12×Ei-2 recombinant inbred lines.
A. QTL for resistance against Pieris brassicae, obtained with composite interval mapping (CIM). The horizontal red line indicates the significance threshold for this trait. B. Bayesian interval mapping (BIM) detects the same QTL as CIM. Horizontal red lines indicate high density probability regions in BIM, vertical red lines high density probability peaks. C. Additive effects in BIM, shown as a scatter plot with a smoothing spline fit (solid blue line) plus or minus two standard errors (dashed blue lines). For all six QTL, Pieris larvae cause greater damage when plants carry the Ei-2 alleles at the QTL. Hence, the Da(1)-12 alleles confer higher resistance. D. QTL for resistance against specialist lepidopterans, plant diameter, myrosinase activity, trichome density on the leaf upper and under-sides and perimeter, and for glucosinolates. For glucosinolates, QTL for individual compounds and for sum variables are given. Abbreviations are as follows: 3OHP = 3-hydroxypropyl; 3MSOP = 3-methylsulfinylpropyl; 4MSOB = 4-methylsulfinylbutyl; 7MSOH = 7-methylsulfinylheptyl; 8MSOO = 8-methylsulfinyloctyl; 8MTO = 8-methylthiooctyl; I3M = indol-3-yl-methyl; 1MO-I3M = 1-methoxy-indol-3-yl-methyl; 4OH-I3M = 4-hydroxy-indol-3-yl-methyl; 4MO-I3M = 4-methoxy-indol-3-yl-methyl. Total 3, 4, 7 and 8 are the sums of homomethionine-, di-homomethionine-, penta-homomethionine-, and hexa-homomethionine-derived glucosinolates, respectively. Total MSO, MT, and alkenyls are the sums of aliphatic glucosinolates with methylsulfinyl-, methylthio-, and alkenyl-groups, respectively. Total aliphatics and indoles are the sums of methionine- and tryptophan-derived glucosinolates, respectively, and total GS is the sum of all glucosinolates. Colored arrows correspond to 2-LOD support intervals for QTL identified with CIM, black arrows for high density probability regions in BIM, with vertical black bars showing the position of the high density probability peaks. Arrow directions correspond to effect directions; arrows pointing left indicate that the Ei-2 allele has a stronger effect on a particular trait. Arrow fill colors code for the relative effect strength of a QTL, arrow background colors for R 2, the percentage of variance explained by a QTL. Horizontal red lines connecting colored arrows indicate epistatic interactions between QTL.
Figure 4Epistatic interactions in the biosynthesis of homomethionine-derived glucosinolates.
Left: 3-methylsulfinylpropyl glucosinolate (3MSOP) is produced when the genotype at the AOP locus (marker F4C21) is Da(1)-12. An Ei-2 allele at marker nga139 reduces the accumulation of this glucosinolate by 60%. Right: allyl glucosinolate is produced when the genotype at AOP is Ei-2. A Da(1)-12 allele at 3FM12 increases and a Da(1)-12 allele at nga249 decreases leaf allyl glucosinolate accumulation. N indicates the number of RILs with a particular combination of genotypes at the different markers.
Epistatic interactions in glucosinolate biosynthesis
| Trait | Source |
|
|
|
| 3-methylsulfinylpropyl |
| 1 | 102.54 | 0.00000 |
|
| 1 | 23.81 | 0.00000 | |
|
| 1 | 20.17 | 0.00001 | |
| Error | 187 | |||
| allyl |
| 1 | 8.59 | 0.00382 |
|
| 1 | 632.11 | 0.00000 | |
|
| 1 | 12.54 | 0.00051 | |
|
| 1 | 10.99 | 0.00111 | |
|
| 1 | 0.20 | 0.65704 | |
|
| 1 | 16.54 | 0.00007 | |
|
| 1 | 0.51 | 0.47812 | |
| Error | 178 | |||
| Total 4 |
| 1 | 23.02 | 0.00000 |
|
| 1 | 20.58 | 0.00001 | |
|
| 1 | 9.88 | 0.00195 | |
| Error | 182 | |||
| 3-butenyl |
| 1 | 20.77 | 0.00001 |
|
| 1 | 56.73 | 0.00000 | |
|
| 1 | 15.06 | 0.00015 | |
| Error | 181 | |||
| Total Indoles |
| 1 | 11.49 | 0.00090 |
|
| 1 | 17.21 | 0.00006 | |
|
| 1 | 14.35 | 0.00022 | |
|
| 1 | 31.28 | 0.00000 | |
|
| 1 | 6.02 | 0.01534 | |
|
| 1 | 1.68 | 0.19748 | |
|
| 1 | 0.30 | 0.58454 | |
|
| 1 | 0.40 | 0.52740 | |
|
| 1 | 0.00 | 0.96366 | |
|
| 1 | 8.33 | 0.00450 | |
|
| 1 | 0.04 | 0.84950 | |
|
| 1 | 0.01 | 0.94323 | |
|
| 1 | 6.36 | 0.01279 | |
|
| 1 | 7.27 | 0.00783 | |
|
| 1 | 0.55 | 0.46085 | |
|
| 1 | 0.00 | 0.96727 | |
|
| 1 | 1.01 | 0.31703 | |
|
| 1 | 0.00 | 0.96243 | |
|
| 1 | 0.17 | 0.68519 | |
|
| 1 | 0.73 | 0.39366 | |
|
| 1 | 0.41 | 0.52310 | |
|
| 1 | 13.69 | 0.00031 | |
|
| 1 | 2.05 | 0.15448 | |
|
| 1 | 0.23 | 0.63376 | |
|
| 1 | 0.69 | 0.40783 | |
| Error | 144 |
Markers used for genotyping of Da(1)-12×Ei-2 RILs
| Marker | Chr | BAC/P1 | Primer 1 (5′→3′) | Primer 2 (5′→3′) | Gel pattern |
|
| 1 | F20B24 |
|
| D>E |
|
| 1 | F20D23 |
|
| D>E |
|
| 1 | F12K8 |
|
| D>E |
|
| 1 | F3H9 |
|
| D<E |
|
| 1 | F1K23 |
|
| D>E |
|
| 1 | F1K23 |
|
| D<E |
|
| 1 | F28L22 |
|
| D<E |
|
| 1 | F7F22 |
|
| D>E |
|
| 1 | F11F12 |
|
| D<E |
|
| 1 | T18A20 |
|
| D<E |
|
| 1 | F5I14 |
|
| D>E |
|
| 1 | T26J14 |
|
| D>E |
|
| 1 | F24J5 |
|
| D<E |
|
| 1 | F20P5 |
|
| D>E |
|
| 1 | F22K20 |
|
| D>E |
|
| 2 | F18P14 |
| CGCTCTTTCGCTCTG | D>E |
|
| 2 | T4E14 |
|
| D>E |
|
| 2 | T26I20 |
|
| D<E |
|
| 2 | F19F24 |
|
| D>E |
|
| 2 | T20K24 |
|
| D<E |
|
| 2 | F3K23 |
|
| D>E |
|
| 2 | T22F11 |
|
| D>E |
|
| 2 | T19L18 |
|
| D<E |
|
| 2 | T26B15 |
|
| D<E |
|
| 2 | T26B15 | TGGGTTTTTGTGGGTC |
| D<E |
|
| 2 | T1J8 |
|
| D<E |
|
| 2 | F17A22 |
|
| D<E |
|
| 3 | F9F8 |
|
| D<E |
|
| 3 | K20I9 |
|
| D>E |
|
| 3 | MRC8 |
|
| D>E |
|
| 3 | MAL21 |
|
| D>E |
|
| 3 | MSD21 |
|
| D>E |
|
| 3 | K7M2 |
|
| D<E |
|
| 3 | K24A2 |
|
| D: 1 band E: 2 bands |
|
| 3 | K5K13 |
|
| D>E |
|
| 3 | MXO21 |
|
| D>E |
|
| 3 | T15B3 |
|
| D<E |
|
| 3 | T26I12 |
|
| D<E |
|
| 4 | T5J8 |
|
| D>E |
|
| 4 | T5J8 | GCCAAGACGCAGAAGAAGAG |
| D<E |
|
| 4 | F4C21 |
|
| D>E |
|
| 4 | T32A17 |
|
| D<E |
|
| 4 | F28M11 |
|
| D<E |
|
| 4 | F25E4 | GAATGGTTGTTGATAGTTGA |
| D<E |
|
| 4 | F25G13 |
|
| D<E |
|
| 4 | F25G13 |
|
| D<E |
|
| 4 | T6G15 |
|
| D>E |
|
| 4 | T12H17 |
|
| D<E |
|
| 4 | T27E11 |
|
| D>E |
|
| 4 | F25O24 |
|
| D<E |
|
| 4 | T16L4 |
|
| D<E |
|
| 4 | F9N11 |
|
| D<E |
|
| 4 | F9N11 |
|
| D>E |
|
| 4 | F17I23 |
|
| D>E |
|
| 4 | T10C21 |
|
| D<E |
|
| 4 | F8F16 |
|
| D<E |
|
| 4 | F3L17 |
|
| D<E |
|
| 4 | F11C18 |
|
| D<E |
|
| 4 | F10N7 |
|
| D<E |
|
| 4 | F10N7 |
|
| D<E |
|
| 4 | F8B4 |
|
| D<E |
|
| 4 | L23H3 |
|
| D<E |
|
| 4 | F4D11 |
|
| D<E |
|
| 4 | F4B14 |
|
| D<E |
|
| 4 | F6G17 |
|
| D>E |
|
| 4 | F6G17 |
|
| D>E |
|
| 4 | F19F18 |
|
| D>E |
|
| 4 | F20D10 |
|
| D<E |
|
| 4 | T5J17 | AGGGATATGGATTGAGA |
| D<E |
|
| 5 | MAH20 |
|
| D>E |
|
| 5 | F18022 |
|
| D<E |
|
| 5 | K18P6 |
|
| D>E |
|
| 5 | T26D3 |
|
| D<E |
|
| 5 | MOK9 |
|
| D<E |
|
| 5 | MWP19 |
|
| D<E |
|
| 5 | MFO20 |
|
| D<E |
|
| 5 | MIO24 |
|
| D<E |
|
| 5 | MNC6 |
|
| D>E |
|
| 5 | MMN10 |
|
| D<E |
|
| 5 | MFB13 |
|
| D>E |
|
| 5 | MPA24 |
|
| D<E |
: Markers are from http://www.inra.fr/qtlat/msat/index.php
: Markers are from [14]
Bold-typed markers were used for QTL mapping.