Literature DB >> 17547761

Comprehensive EST analysis of Atlantic halibut (Hippoglossus hippoglossus), a commercially relevant aquaculture species.

Susan E Douglas1, Leah C Knickle, Jennifer Kimball, Michael E Reith.   

Abstract

BACKGROUND: An essential first step in the genomic characterisation of a new species, in this case Atlantic halibut (Hippoglossus hippoglossus), is the generation of EST information. This forms the basis for subsequent microarray design, SNP detection and the placement of novel markers on genetic linkage maps.
RESULTS: Normalised directional cDNA libraries were constructed from five different larval stages (hatching, mouth-opening, midway to metamorphosis, premetamorphosis, and post-metamorphosis) and eight different adult tissues (testis, ovary, liver, head kidney, spleen, skin, gill, and intestine). Recombination efficiency of the libraries ranged from 91-98% and insert size averaged 1.4 kb. Approximately 1000 clones were sequenced from the 5'-end of each library and after trimming, 12675 good sequences were obtained. Redundancy within each library was very low and assembly of the entire EST collection into contigs resulted in 7738 unique sequences of which 6722 (87%) had matches in Genbank. Removal of ESTs and contigs that originated from bacteria or food organisms resulted in a total of 7710 unique halibut sequences.
CONCLUSION: A Unigene collection of 7710 functionally annotated ESTs has been assembled from Atlantic halibut. These have been incorporated into a publicly available, searchable database and form the basis for an oligonucleotide microarray that can be used as a tool to study gene expression in this economically important aquacultured fish.

Entities:  

Mesh:

Substances:

Year:  2007        PMID: 17547761      PMCID: PMC1924502          DOI: 10.1186/1471-2164-8-144

Source DB:  PubMed          Journal:  BMC Genomics        ISSN: 1471-2164            Impact factor:   3.969


Background

Atlantic halibut is a cold-water flatfish native to the North Atlantic that shows excellent potential for production in aquaculture due to its highly prized white flesh. Flatfish have long been a choice food fish, with many members of the group e.g., halibuts, flounders, soles, turbot, and plaice, having great commercial value especially in Asia. With the general worldwide decline in the wild fishery, and the predicted global collapse of all currently fished species by the year 2048 [1], it is crucial that alternatives such as aquaculture be pursued. Investigations into producing flatfish by aquaculture have been underway for the last fifteen to twenty years. Aquaculture production of Japanese flounder, turbot, Atlantic halibut and others has now been successfully achieved, although improvements in efficiency are still clearly required. Production of Atlantic halibut is relatively recent and is currently underway in Norway, Iceland, Scotland and Canada. Significant hurdles must still be overcome, particularly with regard to judging when to spawn females, reproduction and sex determination [2], nutrition [3,4], and enhancing disease resistance. The application of genomics technologies to thoroughly characterize the biological processes of reproduction, development, nutrition, and immunity promises to improve our knowledge of this poorly understood fish and provide for long-term enhancements in aquaculture production. Flatfish, members of the order Pleuronectiformes, comprise a biologically interesting group of fish. During development, in a process known as metamorphosis, these fish reorient themselves to lie on one side, the body flattens, and the eye migrates to the other side of the body. This settling of the fish on the side vacated by the migrating eye requires a complex reorganization of skeletal, nervous and muscle tissues [5]. Significant losses due to mortality in the early larval stages, as well as developmental abnormalities such as malpigmentation [6,7], bone deformities [8], and incomplete eye migration [8], have hampered the successful production of flatfish. A better understanding of these processes at the molecular level and the impact that rearing conditions have on survival, metamorphosis, and growth will improve the commercial feasibility of flatfish aquaculture. Expressed sequence tag (EST) surveys of species of interest provide a great deal of information-rich data on the expressed portion of an organism's genome [9] and are invaluable in comparative genomics [10]. In addition, they can be an important source of microsatellites and single nucleotide polymorphisms (SNPs) that can be used for genetic mapping [11]. EST surveys in teleosts have been performed from both non-normalised cDNA libraries and libraries generated by suppression subtractive hybridisation [12] in order to elucidate genes involved in immunity [13-28], muscle formation [29], endocrinology [30-32], and toxin production [33]. The most highly represented teleost in dbEST is the zebrafish, Danio rerio, with over 1.3 million ESTs. Salmonids are also well-represented with over half a millions ESTs. Economically important fish species such as catfish, cod, Japanese flounder, sea bream and sea bass have increasingly been the subject of genomic studies and these species are now represented by several thousand or even tens of thousands of ESTs. Among the flatfish, considerable effort has been made to determine ESTs for Japanese flounder [13,17,22]. There are currently 8842 ESTs for this species, although most are unannotated. Furthermore, the majority of these sequences arise from non-normalised cDNA libraries or those constructed from immune-stimulated fish; few ESTs have been sequenced from non-immune tissues or different developmental stages of flatfish. For turbot, the other main commercially relevant flatfish, there are no published EST studies and most of the sequences from this species in GenBank are microsatellites or rRNA. As a first step towards developing genomics tools for Atlantic halibut, a large-scale EST survey was performed, annotations undertaken where possible, and a searchable database set up. Considerable effort has been made to annotate these ESTs and associate them with Gene Ontology (GO) terms to facilitate subsequent microarray analyses. The species-independent structured GO vocabulary [34] is widely accepted and used in most large scale genome annotation projects.

Results

cDNA libraries and ESTs

Normalized cDNA libraries were constructed from eight Atlantic halibut tissues and five developmental stages. For all libraries, the percentage of clones with inserts was high, ranging from 91 to 98%, with average insert sizes between 1.3 and 1.6 kb (Table 1). After trimming and vector removal, 12675 good sequences were obtained. Average read length after trimming for each library was approximately 600–700 bp with the majority of reads compiled from all 13 libraries being between 700 and 800 bp (Figure 1). Clustering of the sequences using Paracel transcript assembler yielded 7738 unique sequences (redundancy factor of 1.6), demonstrating the excellent normalization achieved by this approach. Twenty-eight ESTs or EST clusters, mostly from later larval stages, had matches to food organisms such as Artemia and were removed from the database. The 7710 remaining unique ESTs consisted of 2556 unique clusters and 5154 singletons. The normalization of the libraries precludes an accurate analysis of transcript abundance, although sequences present multiple times in the normalized libraries presumably correspond to high abundance transcripts. Of the clones that were represented 5 times or more in a given library, the most common were a lectin-like protein, a 14 Kda apolipoprotein, tropomyosin, parvalbumin, and apolipoprotein A1 (Table 2). Parvalbumin, lectin-like protein and the 14 Kda apolipoprotein were each over-represented in two libraries.
Table 1

Characteristics of Atlantic halibut normalised cDNA libraries

Redundancy

LibraryRecom. Eff.# ClonesAvg. insert size (kb)2345 to 15
TissueGill959331.442501
Head Kidney949321.423200
Intestine919101.345900
Liver959061.3691343
Ovary9816091.51542764
Skin979451.432611
Spleen918981.429400
Testis9515321.5841110

LarvalHatching969531.667913
Mouth-opening979501.439535
Midway to Metamorphosis979151.641010
Premetamorphosis949291.447300
Postmetamorphosis969151.530513

The recombination efficiency represents the number of clones containing inserts. The number of clones sequenced, the average insert size in kb (based on analysis of 96 clones), and the number of clones represented more than once (redundancy) for each library are presented.

Figure 1

Representation of sequencing read lengths of Atlantic halibut Expressed Sequence Tags (ESTs). Read lengths were binned in 100 base pair (bp) increments. Most of the ESTs fall into the 700–800 bp bin.

Table 2

Most highly represented clones found in each cDNA library

LibraryGeneAccession ## hits
Gilllectin-like proteinAAI15054.17
Liverepoxide hydrolaseNP_957362.15
14 kDa apolipoproteinCAH57705.116
Ovaryribosomal protein L3CAF95545.15
transaldolase 1AAH68191.15
fish eggshell proteinAAS55644.15
unknown ESTAW012936.16
Skinlectin-like protein;AAI15054.17
HatchNAD(P)H dehydrogenase quinone 1ABD43173.15
lipocalin familyCAF97961.16
Mouth-openingparvalbumin betaAAK63087.15
myosin heavy chainBAB12571.15
14 kDa apolipoproteinCAH57705.16
apolipoprotein AI precursorCAH59609.18
tropomyosinBAB20881.113
Post-metamorphosisalpha actin 1AAH45406.15
myosin light chain 2CAD32552.16
parvalbumin betaAAK63087.110

Genes that were represented more than five times in a given cDNA library are listed.

Characteristics of Atlantic halibut normalised cDNA libraries The recombination efficiency represents the number of clones containing inserts. The number of clones sequenced, the average insert size in kb (based on analysis of 96 clones), and the number of clones represented more than once (redundancy) for each library are presented. Most highly represented clones found in each cDNA library Genes that were represented more than five times in a given cDNA library are listed. Representation of sequencing read lengths of Atlantic halibut Expressed Sequence Tags (ESTs). Read lengths were binned in 100 base pair (bp) increments. Most of the ESTs fall into the 700–800 bp bin. Screening of EST sequences for short tandem repeats (2 – 5 bp) identified 129 that contained microsatellite sequences. Of these, 60 had 2 bp repeats (mostly GT or GA), 58 had 3 bp repeats, 7 had 4 bp repeats and 4 had 5 bp repeats. Sixty of these loci were polymorphic and were incorporated into our halibut linkage map (D. Reid, C. Smith, D. Martin-Robichaud, M. Reith, unpublished). All EST data have been deposited in GenBank (accession numbers EB029285–EB041700 &EB080851–EB080975), and preliminary annotations are available on the Pleurogene website [35].

Annotation

All ESTs and clusters were initially annotated with AutoFACT, which carries out a series of Blast analyses to identify the EST and attempts to assign function and/or pathway information. AutoFACT provided product or gene names for 4786 sequences (62%) and 254 additional sequences had domain names associated with them (Table 3). Of the remaining sequences, 28 matched ribosomal RNAs, 824 matched unassigned proteins, 802 matched unknown ESTs, and 1016 had no database hits ("unclassified").
Table 3

Classification of Atlantic halibut unique sequences

ClassificationClassification MethodGO sourceNumber of Sequences
UnclassifiedNo BLAST hit1016
Ribosomal RNArRNA hit28
Unassigned proteinBLAST hit >e-10 to unknown protein824
Unknown ESTBLAST hit >e-10 to unknown EST802
Functionally annotated proteinBLAST hit >e-10 to known protein5040
Informative terms4786
Domain name-containing protein254
Gene Ontology (107)3878
AutoFACT1640
Goblet1736
InterPro605
KEGG (185)578
COG (22)1191

Total77105040

Numbers of sequences associated with AutoFact classification. The method of classifying functionally annotated proteins is indicated and the numbers of categories identified by GO, KEGG and COG are given in brackets. GO classifications were obtained using Goblet and Interpro information as well as AutoFACT.

Classification of Atlantic halibut unique sequences Numbers of sequences associated with AutoFact classification. The method of classifying functionally annotated proteins is indicated and the numbers of categories identified by GO, KEGG and COG are given in brackets. GO classifications were obtained using Goblet and Interpro information as well as AutoFACT. Of the 5040 functionally annotated and domain name-containing sequences, Gene Ontology (GO) classifications were found for 3878 using AutoFACT, Goblet and InterPro. The distribution of sequences among GO classifications are represented in Figures 2, 3, 4. Sequences with GO terms corresponding to cellular component fell into 27 categories (Figure 2), molecular function into 34 categories (Figure 3) and biological process into 46 categories (Figure 4). Clusters of Orthologous Groups (COG; [36]) categories were determined for 1191 sequences, and Kyoto Encyclopedia of Genes and Genomes (KEGG; [37]) categories were found for 578 sequences. Sequences assigned to COG fell into 22 categories and those assigned to KEGG fell into 185 pathways (Table 3).
Figure 2

Classification of Atlantic halibut unique sequences according to Gene Ontology (GO) category: cellular component.

Figure 3

Classification of Atlantic halibut unique sequences according to Gene Ontology (GO) category: molecular function.

Figure 4

Classification of Atlantic halibut unique sequences according to Gene Ontology (GO) category: biological process.

Classification of Atlantic halibut unique sequences according to Gene Ontology (GO) category: cellular component. Classification of Atlantic halibut unique sequences according to Gene Ontology (GO) category: molecular function. Classification of Atlantic halibut unique sequences according to Gene Ontology (GO) category: biological process. We also performed a similar analysis on the 4110 partially annotated Atlantic halibut sequences deposited in GenBank by other groups. After assembly, a unigene set of 2337 sequences was obtained of which 40 were rRNA, 781 were unclassified, 80 matched unassigned proteins and 1436 were informative annotations. However, of the informative annotations, 531 fell into five clusters: nuclease diphosphate kinase B (73), cytochrome c oxidase subunit III (109), cytochrome c oxidase subunit II (182), cytochrome c oxidase subunit I (62) and cytochrome b (105). Similarly, of the 788 sequences that received COG annotations, over half (487) were associated with energy production and conversion, and were predominantly of mitochondrial origin. When the complete EST set of 12675 sequences was searched for GO terms using the GOSLIM classification, two libraries were substantially more enriched in GOSLIM terms than others: the ovary library had 4496, and the testis library had 3371 hits to GOSLIM terms, respectively. Some of this enrichment can be explained by the increased number of ESTs sequenced from these libraries (50%), but even taking this into account, there are still many more GOSLIM terms in each of these libraries than the other tissue-specific libraries, which have between 1017 (gill) and 1871 (liver) terms. Of the larval libraries, that from the mouth-opening stage had 2415 hits to GOSLIM terms. Interestingly, the library constructed from larvae midway to metamorphosis had only 443 hits to GOSLIM terms. The remainder of the libraries had between 1444 and 1788 GOSLIM terms.

Functional categories of cDNAs

The functional categories included in the COG and GO classification schemes are not entirely congruent and thus not directly comparable. Broadly speaking, the COG classification gave a good overview of the cellular processes represented in the EST library. As can be seen from Table 4, approximately one third of the ESTs are associated with a COG category related to transport, metabolism and energy, 44% of the ESTs are associated with nucleic acid processes, and 4% of the ESTs are associated with cell structure. The remainder of the classified ESTs represent genes involved in signal transduction, defense and intracellular trafficking. KEGG annotations were found for 578 different sequences, the most common pathways represented are shown in Table 5.
Table 4

Classification of Atlantic halibut unique sequences according to COG

Category#%
Amino acid transport and metabolism726.05
Carbohydrate transport and metabolism615.12
Coenzyme transport and metabolism221.85
Inorganic ion transport and metabolism272.27
Lipid transport and metabolism423.53
Nucleotide transport and metabolism433.61
Secondary metabolites biosynthesis, transport and catabolism131.09
Energy production and conversion12810.75
 Total metabolism and energy40834.26
Cell cycle control, cell division, chromosome partitioning100.84
Chromatin structure and dynamics141.18
Replication, recombination and repair413.44
RNA processing and modification60.50
Transcription514.28
Translation, ribosomal structure and biogenesis18815.79
Posttranslational modification, protein turnover, chaperones21117.72
 Total nucleic acid processes52143.74
Cell wall/membrane/envelope biogenesis62.14
Cytoskeleton403.36
 Total cell structure463.86
Intracellular trafficking, secretion, and vesicular transport373.11
Signal transduction mechanisms332.77
Defense mechanisms40.34
General function prediction only13211.08
Function unknown100.84
 Total1191100.00

Categories were broadly grouped into metabolism and energy, nucleic acid processes and cell structure. The number (#) and percent (%) of ESTs in each category is shown.

Table 5

Most commonly represented KEGG classifications of Atlantic halibut unique sequences

Category#%
Oxidative phosphorylation10117.5
Ribosome5810.0
Purine & pyrimidine metabolism417.1
Proteasome274.6
Cell communication213.6
SNARE interactions and vesicular transport172.9
Arginine and proline metabolism162.8
Transcription factors162.8
Complement and coagulation cascades132.2
Glycan structures122.1
Arachidonic acid metabolism111.9

Categories with more than ten sequences out of a total of 578 are listed. The number (#) and percent (%) of ESTs in each category is shown.

Classification of Atlantic halibut unique sequences according to COG Categories were broadly grouped into metabolism and energy, nucleic acid processes and cell structure. The number (#) and percent (%) of ESTs in each category is shown. Most commonly represented KEGG classifications of Atlantic halibut unique sequences Categories with more than ten sequences out of a total of 578 are listed. The number (#) and percent (%) of ESTs in each category is shown.

Discussion

To improve our understanding of flatfish biology and the problems associated with their development and rearing, a comparative genomics program focusing on Atlantic halibut and Senegal sole (Solea senegalensis) has been initiated (see [35]). As a prelude to construction of a DNA microarray, the EST survey reported here has been carried out. Two previous EST surveys have been conducted in Atlantic halibut: one from a study of the effect of vaccination [28], resulting in approximately 1000 sequences, and a second from an investigation of muscle somite formation [38], resulting in approximately 4250 sequences. The study reported here greatly enriches the genomic resources for this commercially important flatfish by adding more than 12,000 ESTs to the partially annotated sequences that had already been deposited. Over 5000 of the 7710 unique transcripts represented by the ESTs have been functionally annotated. These annotations and the development of a searchable database containing all of the information associated with each EST add enormous value to such a study. The main categories of genes represented in the ESTs are involved in binding, catalytic activity, transport, metabolism, response to stimuli, signal transduction, nucleic acid processes, and cellular biogenesis. Again, this adds substantially to the Atlantic halibut sequences from other research groups, many of which were of mitochondrial origin, and which contained slightly over 900 informative AutoFACT annotations. With only modest resources for EST sequencing available, we choose to normalize our cDNA libraries so as to maximize the number of different ESTs sequenced. The normalization method used (Evrogen Trimmer kit) was very effective at reducing the number of highly expressed cDNAs. Since the libraries are well-normalised (redundancy factor of only 1.5), it is not possible to gain insights into the actual abundance of different types of transcripts; however, the enrichment in GO terms in the reproductive tissues and one of the larval libraries indicates that these libraries represent a broad diversity of transcripts, indicative of the high metabolic and proliferative characteristics of ovary and testis tissues. Larvae at the early mouth-opening stage of development are also undergoing tremendous metabolic changes as they transition from the yolk-sac to first-feeding stages. On the other hand, the library made from larvae midway to metamorphosis has very few GO terms associated with it, possibly because a large number of genes associated with the unusual metamorphic process in flatfish have not yet been described. A number of ESTs were restricted to only a single tissue library and as such, may be good tissue-specific markers for in situ hybridisation and aid in tracking the appearance of different tissues during development [39,40]. For example, ESTs for a renal organic ion transporter and nephrosin are only found in the head kidney library. Several transporters (for amino acids and various solutes), binding proteins (for lipid, sterol and lipoproteins) as well as digestive enzymes (elastases, peptidase, aminopeptidase N, carboxypeptidase B, triglyceride lipase) are only found in the intestine library. Various complement components, apolipoproteins, fatty acid binding protein, alpha-2-macroglobulin and biliverdin reductase A are only present in the liver library. A single EST unique to spleen was identified – metaxin 2, similar to the von Willebrand clotting factor. Unique to the ovary library were a number of ESTs specific to reproduction – zona pellucida protein, vitelline envelope protein, chorion protein, choriolytic enzyme, aquaporin, alveolin, estrogen receptor binding protein and luteinizing hormone beta. Similarly, the testis library uniquely contained ESTs specific to reproduction – spindlin protein C, testis intracellular mediator protein, a cysteine and glycine-rich protein, and periostin. The gill library uniquely contained two ESTs involved in chloride transport and the skin uniquely contained keratin, epithelial membrane protein-3, epiplakin and dermatopontin. The liver, head kidney and spleen libraries proved to be an excellent source of genetic information concerning hematopoiesis and immune function in this fish. The head kidney is the major site of hematopoiesis in fish and an EST survey of zebrafish kidney revealed many insights into this process in fish [41]. From our Atlantic halibut EST survey, many complement components, immune type receptors, lectins, defense proteins, MHC I and II components, cytokines, chemokines as well as signal transduction molecules and transcription factors involved in expression of immune genes were identified. It should be noted that ESTs for components of the immune system were also found in other tissue libraries, particularly those exposed to the environment such as skin and gill; these arose from circulating or resident immune cells in these tissues. This new sequence information will greatly enhance our understanding of the immune system of flatfish and provide molecular tools for further studying disease resistance. The identification of microsatellite sequences in the Atlantic halibut ESTs will aid in the completion of a genetic linkage map of Atlantic halibut that is currently being constructed. Since these microsatellites are linked to genes, they are useful as Type I markers.

Conclusion

The addition of over 7700 ESTs, of which 5040 are functionally annotated, significantly enhances the genomic tools available for non-model fish species. Given the high degree of sequence similarity between flatfish species, the Atlantic halibut ESTs will be of great interest to the flatfish researchers in general, as well as the halibut aquaculture research community. The publicly accessible, searchable database also adds substantial value to the genomic data generated in this study. This EST survey has provided a number of microsatellite markers that have been placed on the Atlantic halibut genetic linkage map (Reith, pers. comm.) as well as probes for cellular localisation studies by in situ hybridisation. It has also laid the groundwork for the design and construction of a microarray for studying gene expression under different environmental conditions to better understand the impact of nutrition, stress, and environmental conditions on aquaculture production.

Methods

Fish rearing and sampling

Larvae were reared at Scotian Halibut Limited (Clarks Harbour, NS, Canada) in constant light (approximately 1000 lux at the surface) in 7 m3 tanks with flow-through salt water (32 ppt) maintained at 11 ± 0.2°C using a heat exchanger. Larvae were fed Artemia until weaning onto artificial feed at 65 DPH. The ages and sizes of the larvae at the different stages were as follows: hatching (1 dph; 10 mm), mouth-opening (21 dph;15 mm), midway to metamorphosis (64 dph; 20 mm), premetamorphosis (91 dph; 25 mm), and post-metamorphosis (104 dph; 30–35 mm). Livers were sampled from one male (104 cm; 18 kg) and one female (130 cm; 31 kg) adult broodstock maintained at St. Andrews Biological Station, St. Andrews, NB, Canada. All other tissues were sampled from 3 male and 3 female immature fish (672–945 g) reared at the Institute for Marine Biosciences Marine Research Station (Sambro, NS, Canada). Immediately before sampling, fish were transferred to a bucket containing an overdose of TMS-Aqua MS-222 (Syndel, Vancouver, BC, Canada). Ovaries from 3 females were pooled, as were testes from 3 males. Gill, head kidney, intestine, skin, and spleen samples from each group of 6 fish were pooled, and all tissue samples preserved in RNALater (Ambion, Austin, TX, USA), and stored at -80°C until use. Larvae were pooled and preserved in RNALater, and stored at -80°C until use. All animal procedures were approved by the NRC Institute for Marine Biosciences Animal Care Committee.

cDNA library construction

For liver, mRNA was extracted from one female and one male halibut using the FastTrack kit (Invitrogen, Burlington, ON, Canada) and equal amounts of mRNA were combined. For spleen, total RNA was extracted from pooled tissues using Trizol Reagent (Invitrogen). For other tissues, mRNA was extracted from pooled tissues using the Micro-FastTrack kit (Invitrogen). For larval libraries, RNA was extracted from pooled samples (~20 larvae each for post-hatch and mouth-opening stages, 15 larvae for midway to metamorphosis, and 5 larvae each for pre- and post-metamorphosis) using Trizol Reagent. All RNA isolation kits were used according to the manufacturer's protocols. First strand cDNA was prepared from 0.25–0.4 μg mRNA or 2 μg total RNA using the Creator SMART cDNA method (Clontech, Palo Alto, CA, USA) and PowerScript reverse transcriptase (Clontech). The CDS-3M adaptor, included in the TRIMMER-DIRECT kit (Evrogen, Moscow, Russia), was used instead of the SMART CDSIII primer. cDNA was amplified by LD-PCR according to the Creator SMART cDNA method (Clontech) using the 5' PCR primer as the forward and reverse primer. The optimal number of cycles to yield sufficient cDNA for normalisation, but remain within the exponential phase of amplification, was determined by analysing aliquots of the PCR reaction after every second cycle on agarose gels. In all cases, sufficient cDNA was obtained in 18 cycles or less, ensuring even the rarest messages were represented. Amplified cDNA was purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA, USA), quantitated using a NanoDrop® ND-1000 spectrophotometer (NanoDrop® Technologies Inc, Wilmington, DE, USA) and normalized using the TRIMMER-DIRECT protocol (Evrogen). After digestion with SfiI, products smaller than 500 bp were removed using the Chroma Spin-400 column column as described in the Creator SMART protocol. The resulting cDNAs were directionally cloned into the SfiI sites of pDNR-LIB (Clontech) and transformed into ElectroMAX DH10B T1 phage-resistant cells (Invitrogen) by electroporation using the Cell Porator and Voltage Booster system (Gibco BRL). The Cell Porator settings were 400 V, 330 μF capacitance, low Ω impedance and fast charge rate, and the Voltage Booster was set at 4 kΩ. For each library, 106 primary transformants were amplified by the semi-solid amplification method described in Stratagene's pBluescript XR cDNA library construction kit manual. Randomly picked clones (96 from each library) were screened for insert size by protoplasting [42] or by PCR using the M13 forward and reverse primers flanking the multiple cloning site of the vector.

Sequencing

Individual bacterial colonies were picked into 96- or 384-well plates containing LB/glycerol using the QPix colony picker (Genetix Ltd., New Milton, Hampshire, UK). A 96-well test plate was prepared from each library for sequencing and if the quality of the library was good, clones were sequenced from two additional 96-well and two 384-well plates, giving a total of 1056 reads. Two additional 384-well plates were sequenced from each of the ovary and testis libraries. Plates were incubated overnight at 37°C. The resulting bacterial suspensions were inoculated into lysis buffer and denatured at 95°C for 5 minutes. DNA from each clone was amplified using TempliPhi™ DNA polymerase (GE Healthcare, Baie d'Urfe, QC, Canada) according to manufacturer's instructions. DNA sequencing was performed using ET terminator chemistry (GE Healthcare) in the 5' direction (primer sequence GGCCGCATAACTTCGTATAGC). Reactions were processed using Sera-Mag™ magnetic carboxylate-modified microparticles (Seradyn™, Indianapolis, IN, USA) to remove excess fluorescent terminators before loading onto GE Healthcare MegaBACE 4000 capillary DNA sequencers. Clones from each library were replicated into glycerol stocks and stored at -80°C.

ESTs and annotation

ESTs were clustered using Paracel Transcript Assembler 3.0 (Paracel Inc., Pasadena, CA), which is based on the CAP4 clustering algorithm [43]. Annotation was performed using AutoFACT [44] and the default parameters with UniProt's UniRef90, NCBI's nr, KEGG, COG, PFAM, LSU, SSU and, for contigs, est_others. AutoFACT summary results are stored in our database [35]. Each sequence has one or more AutoFACT results associated with it. Each AutoFACT result is related to the most informative BLAST hit from each of the queried set of databases. Those hits are also stored in the Pleurogene database. GO annotations associated with either the contributing hits or the AutoFACT results are stored in a separate table. Due to the low level of GO annotation obtained with AutoFACT (1640 sequences out of 7710), we chose to run the unannotated sequences through Goblet [45] using the vertebrate database and a BLAST cutoff of e-10. This increased the annotation level by 1736 sequences. Because the default criteria for a match in Goblet is lower than in AutoFACT and these sequences had already passed through AutoFACT, these GO annotations should be regarded as less reliable. GO terms were also identified for an additional 502 sequences by searching InterPro. Functionally annotated ESTs with GO annotations were classified using GOSlim and each category with more than 5 hits was plotted. Individual ESTs in each library (13,000 total) were also searched for GOSLIM terms and compiled by library.

Identification of microsatellite sequences

Short tandem repeats (2 – 5 bp) were detected using Tandem Repeats Finder [46].

Authors' contributions

SED and MER conceived of and designed the project. LCK constructed cDNA libraries. JK and MER carried out bioinformatic analyses. SED wrote the manuscript. MER and SED edited the manuscript. All authors read and approved the manuscript.
  32 in total

1.  Impacts of biodiversity loss on ocean ecosystem services.

Authors:  Boris Worm; Edward B Barbier; Nicola Beaumont; J Emmett Duffy; Carl Folke; Benjamin S Halpern; Jeremy B C Jackson; Heike K Lotze; Fiorenza Micheli; Stephen R Palumbi; Enric Sala; Kimberley A Selkoe; John J Stachowicz; Reg Watson
Journal:  Science       Date:  2006-11-03       Impact factor: 47.728

2.  Tandem repeats finder: a program to analyze DNA sequences.

Authors:  G Benson
Journal:  Nucleic Acids Res       Date:  1999-01-15       Impact factor: 16.971

3.  A survey of expressed genes in the leukocytes of Japanese flounder, Paralichthys olivaceus, infected with Hirame rhabdovirus.

Authors:  B H Nam; E Yamamoto; I Hirono; T Aoki
Journal:  Dev Comp Immunol       Date:  2000-01       Impact factor: 3.636

4.  The analysis of expressed genes in the kidney of Japanese flounder, Paralichthys olivaceus, injected with the immunostimulant peptidoglycan.

Authors:  T Kono; M Sakai
Journal:  Fish Shellfish Immunol       Date:  2001-05       Impact factor: 4.581

5.  Somite formation and expression of MyoD, myogenin and myosin in Atlantic halibut (Hippoglossus hippoglossus L.) embryos incubated at different temperatures: transient asymmetric expression of MyoD.

Authors:  Trina F Galloway; Tora Bardal; Sylvia N Kvam; Stine W Dahle; Gaute Nesse; Markus Randøl; Elin Kjørsvik; Oivind Andersen
Journal:  J Exp Biol       Date:  2006-07       Impact factor: 3.312

6.  Asymmetrical development of bones and soft tissues during eye migration of metamorphosing Japanese flounder, Paralichthys olivaceus.

Authors:  N Okada; Y Takagi; T Seikai; M Tanaka; M Tagawa
Journal:  Cell Tissue Res       Date:  2001-04       Impact factor: 5.249

7.  Identification of viral induced genes in Ig+ leucocytes of Japanese flounder Paralichthys olivaceus, by differential hybridisation with subtracted and un-subtracted cDNA probes.

Authors:  T Aoki; I Hirono; M G Kim; T Katagiri; Y Tokuda; H Toyohara; E Yamamoto
Journal:  Fish Shellfish Immunol       Date:  2000-10       Impact factor: 4.581

8.  Transcriptome analysis of channel catfish (Ictalurus punctatus): genes and expression profile from the brain.

Authors:  Z Ju; A Karsi; A Kocabas; A Patterson; P Li; D Cao; R Dunham; Z Liu
Journal:  Gene       Date:  2000-12-31       Impact factor: 3.688

9.  Transcriptional activities in the pituitaries of channel catfish before and after induced ovulation by injection of carp pituitary extract as revealed by expressed sequence tag analysis.

Authors:  A Karsi; P Li; R A Dunham; Z J Liu
Journal:  J Mol Endocrinol       Date:  1998-10       Impact factor: 5.098

10.  Transcriptome analysis of expressed sequence tags from the venom glands of the fish Thalassophryne nattereri.

Authors:  G S Magalhães; I L M Junqueira-de-Azevedo; M Lopes-Ferreira; D M Lorenzini; P L Ho; A M Moura-da-Silva
Journal:  Biochimie       Date:  2006-01-27       Impact factor: 4.079

View more
  29 in total

1.  Transcriptomic characterization of the larval stage in gilthead seabream (Sparus aurata) by 454 pyrosequencing.

Authors:  Manuel Yúfera; Silke Halm; Sergi Beltran; Berta Fusté; Josep V Planas; Gonzalo Martínez-Rodríguez
Journal:  Mar Biotechnol (NY)       Date:  2011-12-14       Impact factor: 3.619

2.  Development of EST derived SSRs and SNPs as a genomic resource in Indian catfish, Clarias batrachus.

Authors:  Vindhya Mohindra; Akanksha Singh; A S Barman; Ratnesh Tripathi; Neeraj Sood; Kuldeep K Lal
Journal:  Mol Biol Rep       Date:  2011-12-30       Impact factor: 2.316

3.  Global analysis of gene expression in mineralizing fish vertebra-derived cell lines: new insights into anti-mineralogenic effect of vanadate.

Authors:  Daniel M Tiago; Vincent Laizé; Luca Bargelloni; Serena Ferraresso; Chiara Romualdi; M Leonor Cancela
Journal:  BMC Genomics       Date:  2011-06-13       Impact factor: 3.969

4.  Functional annotation and analysis of expressed sequence tags from the hepatopancreas of mitten crab (Eriocheir sinensis).

Authors:  Hui Jiang; Yi-Mei Cai; Li-Qiao Chen; Xiao-Wei Zhang; Song-Nian Hu; Qun Wang
Journal:  Mar Biotechnol (NY)       Date:  2008-09-25       Impact factor: 3.619

5.  Maternal gene expression in Atlantic halibut (Hippoglossus hippoglossus L.) and its relation to egg quality.

Authors:  Maren Mommens; Jorge Mo Fernandes; Teshome T Bizuayehu; Sylvie L Bolla; Ian A Johnston; Igor Babiak
Journal:  BMC Res Notes       Date:  2010-05-24

6.  Identification and analysis of immune-related transcriptome in Asian seabass Lates calcarifer.

Authors:  Jun Hong Xia; Gen Hua Yue
Journal:  BMC Genomics       Date:  2010-06-04       Impact factor: 3.969

7.  Development of an oligo DNA microarray for the European sea bass and its application to expression profiling of jaw deformity.

Authors:  Serena Ferraresso; Massimo Milan; Caterina Pellizzari; Nicola Vitulo; Richard Reinhardt; Adelino V M Canario; Tomaso Patarnello; Luca Bargelloni
Journal:  BMC Genomics       Date:  2010-06-03       Impact factor: 3.969

8.  Evaluation of potential reference genes for real time RT-PCR studies in Atlantic halibut (Hippoglossus Hippoglossus L.); during development, in tissues of healthy and NNV-injected fish, and in anterior kidney leucocytes.

Authors:  Aina-Cathrine Øvergård; Audun Helge Nerland; Sonal Patel
Journal:  BMC Mol Biol       Date:  2010-05-11       Impact factor: 2.946

9.  Design and performance of a turbot (Scophthalmus maximus) oligo-microarray based on ESTs from immune tissues.

Authors:  Adrián Millán; Antonio Gómez-Tato; Carlos Fernández; Belén G Pardo; José A Alvarez-Dios; Manuel Calaza; Carmen Bouza; María Vázquez; Santiago Cabaleiro; Paulino Martínez
Journal:  Mar Biotechnol (NY)       Date:  2009-10-21       Impact factor: 3.619

10.  Genomic resources for a commercial flatfish, the Senegalese sole (Solea senegalensis): EST sequencing, oligo microarray design, and development of the Soleamold bioinformatic platform.

Authors:  Joan Cerdà; Jaume Mercadé; Juan José Lozano; Manuel Manchado; Angèle Tingaud-Sequeira; Antonio Astola; Carlos Infante; Silke Halm; Jordi Viñas; Barbara Castellana; Esther Asensio; Pedro Cañavate; Gonzalo Martínez-Rodríguez; Francesc Piferrer; Josep V Planas; Francesc Prat; Manuel Yúfera; Olga Durany; Francesc Subirada; Elisabet Rosell; Tamara Maes
Journal:  BMC Genomics       Date:  2008-10-30       Impact factor: 3.969

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.