Literature DB >> 17466472

Molecular epidemiology of bovine noroviruses in South Korea.

Sang-Ik Park1, Cheol Jeong, Ha-Hyun Kim, Sung-Hee Park, Su-Jin Park, Bang-Hun Hyun, Dong-Kun Yang, Sang-Ki Kim, Mun-Il Kang, Kyoung-Oh Cho.   

Abstract

Since the prevalence of bovine norovirus (BNoV) and their genetic diversity have only been reported in the USA, England, Germany and The Netherlands, this study examined the prevalence and genetic diversity of BNoVs in diarrheic calves in South Korea using 645 diarrheic fecal specimens from calves by RT-PCR and nested PCR assays. Overall, 9.3% of the diarrheic fecal samples tested positive for BNoVs by either RT-PCR or nested PCR, of which 5.9% samples also tested positive for other enteric pathogens including the bovine coronavirus, bovine viral diarrhea virus, bovine torovirus, bovine groups A, B and C rotaviruses, bovine enteric Nebraska-like calicivirus and Escherichia coli. The genetic diversity was determined by direct sequencing of the partial RdRp region of 12 BNoVs detected from the fecal samples by nested PCR. Among the BNoVs examined, one Korean BNoV strain had the highest nucleotide (86.8%) and amino acid (99.1%) identity with the genotype 1 BNoV (GIII-1) strain, while the remaining 11 Korean BNoVs shared a higher nucleotide (88.0-90.5%) and amino acid (93.5-99.1%) identity with the genotype 2 BNoV (GIII-2) strains. The phylogenetic data for the nucleotide and amino acid sequences also demonstrated that one Korean BNoV strain clustered with GIII-1 but the remaining eleven strains clustered with GIII-2. In conclusion, BNoV infections are endemic and there are two distinct genotypes with GIII-2 being the main genotype circulating in the calf population in South Korea.

Entities:  

Mesh:

Year:  2007        PMID: 17466472      PMCID: PMC7117243          DOI: 10.1016/j.vetmic.2007.03.010

Source DB:  PubMed          Journal:  Vet Microbiol        ISSN: 0378-1135            Impact factor:   3.293


Introduction

Caliciviruses are nonenveloped, single-stranded RNA viruses with positive-sense genomes of 7.4–8.3 kb (Green et al., 2000). Based on the genomic organization and genetic analysis (Green et al., 2000), the family Caliciviridae is divided into at least four genera: Vesivirus, Lagovirus, Norovirus (NoV), and Sapovirus (SaV) with a new proposed genus, NB-like (Oliver et al., 2006, Smiley et al., 2002). The NoV genome is organized into three open reading frames (ORFs) that encode the nonstructural proteins (ORF1), the major capsid protein (ORF2) and the minor capsid protein (ORF3) (Jiang et al., 1993, Lambden et al., 1993). Based on the genetic divergence in the RNA-dependent RNA polymerase (RdRp) and capsid genes, the NoVs have been tentatively assigned to five genogroups (G) with multiple genotypes (Zheng et al., 2006). The strains of three genogroups, GI, GII, and GIV, are found in humans (GII-11 and GII-19 are porcine), and GIII and GV strains are found in cows and mice (Zheng et al., 2006). Enteric caliciviruses, morphologically indistinguishable from the human NoVs, were first reported in association with calf diarrhea in the United Kingdom in 1978 and in Germany in 1980 (Almeida et al., 1978, Günther et al., 1984, Woode and Bridger, 1978). In recent years, genomic data has been obtained from the two viruses, Bo/Jena/80/DE and Bo/Newbury2/76/UK, and these strains were assigned into the prototype bovine NoVs (BNoVs) of genotype 1 (GIII-1) and genotype-2 (GIII-2) within GIII, respectively. Further isolates of the genotype 1 or genotype 2 BNoVs have been identified in the United Kingdom, The Netherlands, and United States (Liu et al., 1999, Oliver et al., 2003, Oliver et al., 2004, Smiley et al., 2003, van der Poel et al., 2003, Wise et al., 2004), which have confirmed the existence of the two distinct genotypes. Although there are reports of the widespread occurrence of divergent human NoV strains, there are only a few reports of the prevalence and genetic diversity of BNoVs from England (Oliver et al., 2003, Woode and Bridger, 1978), Germany (Liu et al., 1999), The Netherlands (van der Poel et al., 2000, van der Poel et al., 2003) and the USA (Smiley et al., 2003, Wise et al., 2004). The aim of this study was to examine the prevalence and genetic diversity of BNoVs in diarrheic calves in South Korea.

Materials and methods

Specimens

From 2004 to 2005, a total of 645 fecal specimens obtained from diarrheic calves in 629 bovine beef herds were collected in South Korea during the spring (407 samples/406 herds), summer (107 samples/98 herds), autumn (73 samples/69 herds) and winter (58 samples/56 herds). The ages of the calves tested ranged from 2 to 90 days. The fecal samples were examined for common bacterial enteric pathogens including Salmonella spp., Clostridium spp., Campylobacter spp. using specific agar media, and any suspect colonies were identified using biochemical tests. The shiga-toxin-producing Escherichia coli was detected using a PCR assay, as described elsewhere (Asakura et al., 1998). For the viral assays, fecal suspensions of each sample were prepared immediately by diluting the feces 1:10 in 0.01 M phosphate-buffered saline (PBS), pH 7.2. The suspensions were then vortexed for 30 s, centrifuged (1200 ×  g for 20 min), and the supernatants were collected and stored at −80 °C for further testing.

RNA extraction

The RNA was extracted from a 200 μl starting volume of the centrifuged 10% fecal suspensions using the Trizol-LS (Gibco-BRL, Life Tech, Grand Island, USA) procedure. The total RNA recovered was suspended in 50 μl of RNase free water and stored at −80 °C until needed.

RT-PCR and nested PCR

The BNoV, bovine coronavirus (BCoV), groups A, B and C bovine rotaviruses (BRV A–C), bovine enteric Nebraska-like calicivirus (BEC-NBV), bovine torovirus (BToV) and bovine viral diarrhea virus (BVDV) were detected using standard one-step RT-PCR with different specific primer sets (Table 1 ) using the RNA extracted from the fecal samples, as described previously (Cho et al., 2001, Park et al., 2006). The mixture for RT-PCR was incubated at 42 °C for 60 min, preheated at 94 °C for 5 min, subjected to 35 cycles of 1 min at 94 °C, 1 min at the required temperature for each primer pair (Table 1), 2 min at 72 °C and a final 7 min incubation at 72 °C. Nested PCR assays with the primer pairs specific to BNoV, BCoV, BRV A, BToV and BEC-NBV were performed in order to increase the sensitivity and specificity of the RT-PCR as described previously (Cho et al., 2001, Park et al., 2006). The mixture for nested PCR was preheated at 94 °C for 5 min, subjected to 30 cycles of 1 min at 94 °C, 1 min at the required temperature for each primer pair (Table 1), 2 min at 72 °C and a final 7 min incubation at 72 °C. As a negative control, the RNA was extracted from the normal feces of a colostrums-deprived calf that had been inoculated with 50 ml sterile PBS. The amplification products were analyzed using 1.5% or 2% agarose gel electrophoresis and visualized by irradiating the ethidium bromide stained samples with UV.
Table 1

RT-PCR and nested PCR primers for the detection of the bovine norovirus (BNoV), bovine enteric Nebraska-like calicivirus (BEC-NBV), bovine groups A, B and C rotaviruses (BRV A–C), bovine coronavirus (BCoV), bovine torovirus (BToV) and bovine viral diarrhea virus (BVDV) in the fecal specimens from the diarrheic calves

Target virusesTarget genesSequence (5′ → 3′)aRegionProduct size (bp)Annealing temp (°C)Source or references
BNoVRdRpF: AGTTAYTTTTCCTTYTAYGGBGA4543–507453254Smiley et al. (2003)
R: AGTGTCTCTGTCAGTCATCTTCAT



nF: GTCGACGGYCTKGTSTTCCT4690–501532650Park et al. (2006)
nR: CACAGCGACAAATCATGAAA



BEC-RdRpF: TTTCTAACYTATGGGGAYGAYG4518-506654952Smiley et al. (2003)



NBV-MCPR: GTCACTCATGTTTCCTTCTCTAAT
nF: CGCTCCGTGTGGGATCACGA4788–498119450Park et al. (2006)
nR: GCACGGGCTTCTTCTAGAGA



BRV AVP7F: GCCTTTAAAAGCGAGAATTT3–1062106044Chang et al. (1996)
R: GGTCACATCATACAAYTC TA
nF: TTTCTAACATCAACACT274–93065739Park et al. (2006)
nR: TTGCCACCATTTTTTCCAAT



BRV BVP7F: GGAAATAATCAGAGATG1–79579542Barman et al. (2004)
R: CTACTCGTTTGGCTCCCTCC



BRV CVP6F: TCAAGAAATGGWATGCAACC334–91858550Park et al. (2006)
R: CATAGCMGCTGGTCTWATCA



BCoVNF: GCAATCCAGTAGTAGAGCGT13–71270050Cho et al. (2001)
R: CTTAGTGGCATCCTTGCCAA



nF: GCCGATCAGTCCGACCAATG152–55140052Cho et al. (2001)
nR: AGAATGTCAGCCGGGGTAG



BToVMF: TTCTTACTACACTTTTTGGA98–70060349Park et al. (2006)
R: ACTCAAACTTAACACTAG AC



nF: TATGTACTATGTTTCCAGCT152–56040949Park et al. (2006)
nR: CCAACACAAATCCGCAACGC



BVDV5′-UTRF: GCTAGCCATGCCCTTAG107–39629047Givens et al. (2003)
R: CCATGTGCCATGTACAG

F: forward primer for RT-PCR; R: reverse primer for RT-PCR; nF: forward primer for nested PCR; nR: reverse primer for nested PCR.

RT-PCR and nested PCR primers for the detection of the bovine norovirus (BNoV), bovine enteric Nebraska-like calicivirus (BEC-NBV), bovine groups A, B and C rotaviruses (BRV A–C), bovine coronavirus (BCoV), bovine torovirus (BToV) and bovine viral diarrhea virus (BVDV) in the fecal specimens from the diarrheic calves F: forward primer for RT-PCR; R: reverse primer for RT-PCR; nF: forward primer for nested PCR; nR: reverse primer for nested PCR.

DNA sequencing

The nested PCR products for a portion of the RdRp gene (326 bp) were selected from different test reactions and sequenced to verify the reaction specificity as well as to obtain the genomic data for phylogenetic analysis. The nested PCR products were purified using a GenClean II kit (BIO 101, Inc., LaJolla, USA) according to the manufacturer's instructions. DNA sequencing was carried out using an automated DNA sequencer (ABI system 3700, Applied Biosystem Inc., Foster City, USA).

Molecular analysis

The nucleotide (nt) and deduced amino acid (aa) sequences of the partial BNoV RdRp region were compared with those of other known caliciviruses using the DNA Basic module (DNAsis MAX, Alameda, USA) (Table 2 ). Phylogenetic analysis based on the nt and aa alignments were constructed using the neighbor-joining method and the unweighted-pair group method with the average linkages of Molecular Evolutionary Genetics Analysis (MEGA, Version 3.1) with a pairwise distance (Kumar et al., 2004). A sequence similarity search was carried out for the bovine calicivirus the RdRp protein using the LALIGN Query program of the GENESTREAM network server at Institut de Génétque Humaine, Montpellier, FRANCE (http://www.eng.uiowa.edu/∼tscheetz/sequence-analysis/examples/LALIGN/lalign-guess.html).
Table 2

Name and its Genbank accession numbers of the reference norovirus strains and the other caliciviruses used in phylogenetic analysis

G_ClusterNameSourceG_ClusterNameSource
G1_1NV/USAM87661G3_2Bo/Dumfries/UKAY126474
G1_2SOV/UKL07418G3_2Bo/Aberystwyth24/UKAY126475
G1_3DSV/USAU04469G3_2Bo/MA8/KORDQ912788
G1_4Chiba/JPNAB042808G3_2Bo/MA60/KORDQ912787
G1_5AB318/USAAF414406G3_1Bo/MA88/KORDQ912789
G1_6Hesse/DEAF093797G3_2Bo/MA135/KORDQ912790
G2_1Hawaii/USAU07611G3_2Bo/MA140/KORDQ912791
G2_2Msham/UKX81879G3_2Bo/MA156/KORDQ912792
G2_3Toronto/CANU02030G3_2Bo/MA242/KORDQ912793
G2_3BB321/USAAF414415G3_2Bo/MA259/KORDQ912794
G2_4VA98387/USAAY038600G3_2Bo/MA271/KORDQ912795
G2_5MOH99/HUNAF397156G3_2Bo/SA296/KORDQ912796
G2_6SU17/JPNAB039779G3_2Bo/MA302/KORDQ912797
G2_7GN273/USAAF414409G3_2Bo/MA421/KORDQ912798
G2_11Sw43/JPNAB074892G4_1FLD560/USAAF414426
G2_19QW218/USAAY823307G4_1SCD624/ USAAF414427
G3_1Bo/Jena/DEAJ011099G5Murine1/USAAY228235
G3_2Bo/Newbury2/UKAF097917Human sapovirusSaVU65427
G3_2Bo/CV95-OH/USAAF542083NB-like virusNBVAY082891
G3_2Bo/CV186-OH/USAAF542084LagovirusRHDVM67473
G3_2Bo/Penrith55/UKAY126476VesivirusFCVM86379
Name and its Genbank accession numbers of the reference norovirus strains and the other caliciviruses used in phylogenetic analysis

Results

Prevalence of BNoVs in calves with diarrhea in South Korea

Eighteen (2.8%) out of 645 fecal samples (18/629 herds; 2.9%) tested positive using a 1-step RT-PCR assay, targeting a 532 bp fragment of the RdRp region of the BNoV. Nested PCR, targeting a 326 bp fragment of the RdRp region of the BNoV, detected 60 (9.3%) positive fecal samples from 60 herds (9.4%).

Other enteric pathogens

Of the 60 BNoV-positive fecal specimens from 60 calf herds with diarrhea, 22 fecal samples (3.4%) from 22 herds (3.5%) tested positive for the BNoV alone, while the 38 fecal samples (5.9%) from the other 38 herds (5.9%) also tested positive for other enteric pathogens (Table 3 ). Of the concurrent infections of the BNoV with the other enteric pathogens, BRV A was the most common [15 fecal samples (2.2%) from 15 herds (2.3%)]. Interestingly, one diarrheic fecal sample tested positive for four enteric pathogens including BNoV, BEC-NBV, BRV A and BVDV. In addition, 397 fecal specimens from 395 herds that tested negative for BNoV also tested positive for other enteric pathogens (Table 3). No enteric pathogens were detected in 189 fecal samples from 175 herds.
Table 3

Summary of the enteric pathogens present in diarrheic fecal specimens obtained from calves

Enteric pathogens presentaNo. of farms (%)bNo. of calves (%)c
BNoV alone22 (3.5)22 (3.4)
BNoV plus BEC-NBV4 (0.6)4 (0.6)
BNoV plus BRV A15 (2.4)15 (2.3)
BNoV plus BRV B1 (0.2)1 (0.2)
BNoV plus BRV C3 (0.5)3 (0.5)
BNoV plus BCoV1 (0.2)1 (0.2)
BNoV plus BToV3 (0.5)3 (0.5)
BNoV plus BVDV3 (0.5)3 (0.5)
BNoV plus BRV A, BRV C1 (0.2)1 (0.2)
BNoV plus BRV A, BVDV2 (0.3)2 (0.3)
BNoV plus, BRV C, BcoV1 (0.2)1 (0.2)
BNoV plus BcoV, BVDV1 (0.2)1 (0.2)
BNoV plus BToV, BVDV1 (0.2)1 (0.2)
BNoV plus BEC-NBV, BRV A, BVDV1 (0.2)1 (0.2)
BNoV plus BRV C, E. coli (STX)1 (0.2)1 (0.2)
Other enteric pathogens detected395 (62.8)397 (61.6)
No enteric pathogens detected175 (27.8)189 (29.3)
Total629 (100)645 (100)

BNoV: bovine norovirus; BEC-NBV: bovine enteric Nebraska-like calicivirus; BRV A–C: groups A–C bovine rotaviruses; BCoV: bovine coronavirus; BToV: bovine torovirus; BVDV: bovine viral diarrhea virus.

Number of positive herds.

Number of positive calves.

Summary of the enteric pathogens present in diarrheic fecal specimens obtained from calves BNoV: bovine norovirus; BEC-NBV: bovine enteric Nebraska-like calicivirus; BRV A–C: groups A–C bovine rotaviruses; BCoV: bovine coronavirus; BToV: bovine torovirus; BVDV: bovine viral diarrhea virus. Number of positive herds. Number of positive calves.

Genetic diversity of BNoVs

The genetic diversity of the BNoVs and their genetic similarity to the other genogroup strains were investigated by sequencing 326 bp of the nt 4690 to nt 5015 RdRp region from the 12 BNoVs detected from the diarrheic fecal samples. The alignment indicated that the Korean Bo/MA88/KOR strain clustered with the GIII-1 prototype, the Bo/Jena/DE strain, whereas the remaining 11 Korean BNoVs clustered with the GIII-2 prototype, the Bo/Newbury2/UK strain (Fig. 1 ). Among the 11 Korean BNoVs, 10 Korean BNoVs clustered together on a separate branch within GIII-2, whereas the Bo/MA156/KOR, which belongs to GIII-2, clustered with the Bo/Dumfries/UK strain (Fig. 1). Among the BNoVs examined, the Korean Bo/MA88/KOR strain had the highest nt (86.8%) and aa (99.1%) identity with the GIII-1 prototype, the Bo/Jena/DE strain, but shared 75.2–78.2% nt and 85.2–90.7% aa identity with the GIII-2 BNoVs. The remaining 11 Korean BNoVs shared a higher nt (88.0–90.5%) and aa (93.5–99.1%) identity with the GIII-2 prototype, Bo/Newbery2/UK strain, than those from the GIII-1 prototype, Bo/Jena/DE strain, sharing a 73.6–79.1% nt and 84.3–89.8% aa identity. In addition, the GIII-1 BNoV strains, one Korean strain Bo/MA88/KOR and one German strain (Bo/Jena/DE; Liu et al., 1999), showed a low aa identity with the human sapovirus (SaV) (24.1%), BEC-NBV (18.5%), rabbit hemorrhagic disease virus (RHDV) (21.3%), and feline calicivirus (FCV) (27.8%) strains, whereas there was slightly higher aa identity with the human GI, GII and GIV NoV (56.5–72.2%), porcine GII-2 NoV (59.3–60.2%), and murine GV NoV (50.0–50.9%) strains. The GIII-2 strains (Bo/MA88/KOR and Bo/Jena/DE) also had a low aa identity with the human SaV (22.2–23.1%), BEC-NBV (17.6–18.5%), RHDV (22.2–23.1%), and FCV (25.9%) strains, whereas there was slightly higher aa identity with the human GI, GII and GIV NoV (53.7–75.0%), porcine GII-2 NoV (56.5–60.2%), and murine GV NoV (52.8–54.6%) strains.
Fig. 1

The phylogenetic trees of the partial nucleotide (A) and amino acid (B) sequences of the RNA dependent RNA polymerase of caliciviruses were constructed using the neighbor-joining method of Molecular Evolutionary Genetics Analysis (Kumar et al., 2004). Table 3 gives the name and GenBank accession numbers of each virus.

The phylogenetic trees of the partial nucleotide (A) and amino acid (B) sequences of the RNA dependent RNA polymerase of caliciviruses were constructed using the neighbor-joining method of Molecular Evolutionary Genetics Analysis (Kumar et al., 2004). Table 3 gives the name and GenBank accession numbers of each virus.

Discussion

Based on a comparison of the aa and nt sequences of the partial RdRp region, the 12 BNoV strains that was detected in diarrheic fecal samples from calves in South Korea were classified as Norovirus GIII/1 (Bo/Jena/DE strain-like, 1 strain) and GIII/2 (Bo/Newbury2/UK strain-like, 11 strains). These results highlight the existence of the two distinct genotypes within the group and confirming the genotype 2 as the main genotype (Oliver et al., 2003, Smiley et al., 2003, van der Poel et al., 2000, van der Poel et al., 2003, Wise et al., 2004). The phylogenetic data for the nt and aa sequences of the partial RdRp region also support the findings (Oliver et al., 2003, Smiley et al., 2003, van der Poel et al., 2000, van der Poel et al., 2003, Wise et al., 2004) that the Korean BNoVs were classified as Norovirus GIII with the main genotype being GIII/2. These results, along with other reports (Oliver et al., 2003, Smiley et al., 2003, van der Poel et al., 2000, van der Poel et al., 2003, Wise et al., 2004), suggest GIII/2 to be the dominant genotype of BNoVs. The aa identity within the GIII/2 BNoVs ranged from 93.5% to 99.1% (88.0–90.5% nt identity), in which genetic divergence was observed not only in the Korean BNoVs but also between the Korean BNoVs and BNoVs reported in the other countries, which indicates the genetic variability in the BNoVs belonging to GIII/2. This aa identity is similar to findings reported by Oliver et al. (2003) and Wise et al. (2004) who showed that the aa identity within the GIII BNoVs in England and USA shared a 92–100% and 91.2–100% homology with the other known strain in the partial RdRp region. Like the other RNA viruses, the NoVs show broad genomic sequence diversity between the circulating strains, which is partly due to the poor template fidelity of their RNA polymerases (Zheng et al., 2006). Therefore, it is expected that more genetic clusters will be identigied within GIII in the future when more sequence data of the BNoVs circulating in cattle becomes available. The fecal prevalence of BNoV infections in diarrheic calves have been reported to be 8.0% in England (Oliver et al., 2003), 31.1% in The Netherlands, and 72.0% in the Ohio, USA (Smiley et al., 2003). Based on the nested PCR assay, the BNoVs were detected in 9.3% of the fecal samples examined in this study. This suggests that BNoV infection are endemic in diarrheic calves in South Korea in a similar manner to the prevalence of BNoV infections in England (Oliver et al., 2003). Although it was reported that BNoVs induce diarrhea in experimental calves (Bridger et al., 1984), the pathogenicity and mechanisms of BNoVs infections are largely obscure. Therefore, other bovine enteric pathogens might play a role in the clinical and pathological presentation of this disease because many other enteric viruses have been found to be associated with diarrhea in cattle and cause lesions of villous atrophy (BRVs, BCoVs, BToVs, BEC-NBV, etc.). In this study, 5.9% of the diarrheic fecal samples testing positive to the BNoVs also tested positive to other pathogens including the BEC-NBV, BRVs A, B and C, BCoV, BToV, BVDV and shiga-toxin-producing E. coli. This suggests that a number of enteric pathogens, either singly or in combination, can influence the clinical course of BNoV infections (Almeida et al., 1978, Reynolds et al., 1986, Woode and Bridger, 1978). In summary, this study identified the existence of two distinct genotypes of BNoVs within the GIII, and confirmed the GIII/2 BNoVs to be the principal genotype, which is analogous to the previously reported BNoV genogroup and genotypes. In addition, these BNoVs cause endemic infections in diarrheic calves in South Korea.
  24 in total

1.  Norovirus classification and proposed strain nomenclature.

Authors:  Du-Ping Zheng; Tamie Ando; Rebecca L Fankhauser; R Suzanne Beard; Roger I Glass; Stephan S Monroe
Journal:  Virology       Date:  2005-12-15       Impact factor: 3.616

2.  Molecular characterization of a bovine enteric calicivirus: relationship to the Norwalk-like viruses.

Authors:  B L Liu; P R Lambden; H Günther; P Otto; M Elschner; I N Clarke
Journal:  J Virol       Date:  1999-01       Impact factor: 5.103

3.  Characterization of an enteropathogenic bovine calicivirus representing a potentially new calicivirus genus.

Authors:  J R Smiley; K O Chang; J Hayes; J Vinjé; L J Saif
Journal:  J Virol       Date:  2002-10       Impact factor: 5.103

4.  Analytical sensitivity of assays used for detection of bovine viral diarrhea virus in semen samples from the Southeastern United States.

Authors:  M D Givens; A M Heath; R L Carson; K V Brock; M S D Edens; J G W Wenzel; D A Stringfellow
Journal:  Vet Microbiol       Date:  2003-10-17       Impact factor: 3.293

5.  Reverse transcription-PCR assays for detection of bovine enteric caliciviruses (BEC) and analysis of the genetic relationships among BEC and human caliciviruses.

Authors:  J R Smiley; A E Hoet; M Tråvén; H Tsunemitsu; L J Saif
Journal:  J Clin Microbiol       Date:  2003-07       Impact factor: 5.948

6.  Norwalk-like calicivirus genes in farm animals.

Authors:  W H van Der Poel; J Vinjé; R van Der Heide; M I Herrera; A Vivo; M P Koopmans
Journal:  Emerg Infect Dis       Date:  2000 Jan-Feb       Impact factor: 6.883

7.  Characterization of a calici-like virus (Newbury agent) found in association with astrovirus in bovine diarrhea.

Authors:  J C Bridger; G A Hall; J F Brown
Journal:  Infect Immun       Date:  1984-01       Impact factor: 3.441

8.  Microbiology of calf diarrhoea in southern Britain.

Authors:  D J Reynolds; J H Morgan; N Chanter; P W Jones; J C Bridger; T G Debney; K J Bunch
Journal:  Vet Rec       Date:  1986-07-12       Impact factor: 2.695

9.  Cross-protection studies between respiratory and calf diarrhea and winter dysentery coronavirus strains in calves and RT-PCR and nested PCR for their detection.

Authors:  K O Cho; M Hasoksuz; P R Nielsen; K O Chang; S Lathrop; L J Saif
Journal:  Arch Virol       Date:  2001-12       Impact factor: 2.574

10.  Molecular characterization of noroviruses detected in diarrheic stools of Michigan and Wisconsin dairy calves: circulation of two distinct subgroups.

Authors:  Annabel G Wise; Stephan S Monroe; Lora E Hanson; Daniel L Grooms; Donald Sockett; Roger K Maes
Journal:  Virus Res       Date:  2004-03-15       Impact factor: 3.303

View more
  26 in total

1.  Infection of calves with bovine norovirus GIII.1 strain Jena virus: an experimental model to study the pathogenesis of norovirus infection.

Authors:  Peter H Otto; Ian N Clarke; Paul R Lambden; Omar Salim; Jochen Reetz; Elisabeth M Liebler-Tenorio
Journal:  J Virol       Date:  2011-08-31       Impact factor: 5.103

Review 2.  A review of known and hypothetical transmission routes for noroviruses.

Authors:  Elisabeth Mathijs; Ambroos Stals; Leen Baert; Nadine Botteldoorn; Sarah Denayer; Axel Mauroy; Alexandra Scipioni; Georges Daube; Katelijne Dierick; Lieve Herman; Els Van Coillie; Mieke Uyttendaele; Etienne Thiry
Journal:  Food Environ Virol       Date:  2012-11-03       Impact factor: 2.778

Review 3.  Potential use of rumen digesta as ruminant diet-a review.

Authors:  Anusorn Cherdthong
Journal:  Trop Anim Health Prod       Date:  2019-07-20       Impact factor: 1.559

4.  Bovine norovirus: carbohydrate ligand, environmental contamination, and potential cross-species transmission via oysters.

Authors:  Maha Zakhour; Haifa Maalouf; Ilaria Di Bartolo; Larissa Haugarreau; Françoise S Le Guyader; Nathalie Ruvoën-Clouet; Jean-Claude Le Saux; Franco Maria Ruggeri; Monique Pommepuy; Jacques Le Pendu
Journal:  Appl Environ Microbiol       Date:  2010-08-13       Impact factor: 4.792

5.  Improved detection of F-specific RNA coliphages in fecal material by extraction and polyethylene glycol precipitation.

Authors:  Tineke H Jones; Michael W Johns
Journal:  Appl Environ Microbiol       Date:  2009-07-31       Impact factor: 4.792

6.  Self-assembly of the recombinant capsid protein of a swine norovirus into virus-like particles and evaluation of monoclonal antibodies cross-reactive with a human strain from genogroup II.

Authors:  Horacio Almanza; Carolina Cubillos; Iván Angulo; Francisco Mateos; José R Castón; Wim H M van der Poel; Jan Vinje; Juan Bárcena; Ignacio Mena
Journal:  J Clin Microbiol       Date:  2008-10-08       Impact factor: 5.948

7.  Possible novel nebovirus genotype in cattle, France.

Authors:  Jerome Kaplon; Eric Guenau; Philippe Asdrubal; Pierre Pothier; Katia Ambert-Balay
Journal:  Emerg Infect Dis       Date:  2011-06       Impact factor: 6.883

Review 8.  An overview of calf diarrhea - infectious etiology, diagnosis, and intervention.

Authors:  Yong-Il Cho; Kyoung-Jin Yoon
Journal:  J Vet Sci       Date:  2013-12-27       Impact factor: 1.672

9.  Feline calicivirus- and murine norovirus-induced COX-2/PGE2 signaling pathway has proviral effects.

Authors:  Mia Madel Alfajaro; Eun-Hyo Cho; Jun-Gyu Park; Ji-Yun Kim; Mahmoud Soliman; Yeong-Bin Baek; Mun-Il Kang; Sang-Ik Park; Kyoung-Oh Cho
Journal:  PLoS One       Date:  2018-07-18       Impact factor: 3.240

10.  Detection and Molecular Analysis of Bovine Enteric Norovirus and Nebovirus in Turkey.

Authors:  Turhan Turan; Hakan Işıdan; Mustafa Ozan Atasoy; Bünyamin Irehan
Journal:  J Vet Res       Date:  2018-10-24       Impact factor: 1.744

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.