Literature DB >> 17187664

Identification of potential CepR regulated genes using a cep box motif-based search of the Burkholderia cenocepacia genome.

Catherine E Chambers1, Erika I Lutter, Michelle B Visser, Peggy P Y Law, Pamela A Sokol.   

Abstract

BACKGROUND: The Burkholderia cenocepacia CepIR quorum sensing system has been shown to positively and negatively regulate genes involved in siderophore production, protease expression, motility, biofilm formation and virulence. In this study, two approaches were used to identify genes regulated by the CepIR quorum sensing system. Transposon mutagenesis was used to create lacZ promoter fusions in a cepI mutant that were screened for differential expression in the presence of N-acylhomoserine lactones. A bioinformatics approach was used to screen the B. cenocepacia J2315 genome for CepR binding site motifs.
RESULTS: Four positively regulated and two negatively regulated genes were identified by transposon mutagenesis including genes potentially involved in iron transport and virulence. The promoter regions of selected CepR regulated genes and site directed mutagenesis of the cepI promoter were used to predict a consensus cep box sequence for CepR binding. The first-generation consensus sequence for the cep box was used to identify putative cep boxes in the genome sequence. Eight potential CepR regulated genes were chosen and the expression of their promoters analyzed. Six of the eight were shown to be regulated by CepR. A second generation motif was created from the promoters of these six genes in combination with the promoters of cepI, zmpA, and two of the CepR regulated genes identified by transposon mutagenesis. A search of the B. cenocepacia J2315 genome with the new motif identified 55 cep boxes in 65 promoter regions that may be regulated by CepR.
CONCLUSION: Using transposon mutagenesis and bioinformatics expression of twelve new genes have been determined to be regulated by the CepIR quorum sensing system. A cep box consensus sequence has been developed based on the predicted cep boxes of ten CepR regulated genes. This consensus cep box has led to the identification of over 50 new genes potentially regulated by the CepIR quorum sensing system.

Entities:  

Mesh:

Substances:

Year:  2006        PMID: 17187664      PMCID: PMC1766932          DOI: 10.1186/1471-2180-6-104

Source DB:  PubMed          Journal:  BMC Microbiol        ISSN: 1471-2180            Impact factor:   3.605


Background

Burkholderia cenocepacia, belongs to a group of nine related species with common phenotypes, but distinct genotypes collectively named the "Burkholderia cepacia complex" (Bcc) [1,2]. The Bcc are opportunistic pathogens in immunocompromised and cystic fibrosis (CF) patients but have also been isolated from plant rhizopheres as well as urban and suburban soils [1-3]. The ability of bacteria to adapt to diverse environments is dependent on the coordinate regulation of factors required to survive and proliferate in each niche. The CepIR quorum sensing system is one regulatory network that contributes to the response of B. cenocepacia to environmental signals (reviewed in [4,5]). Quorum sensing allows bacterial populations to coordinate gene expression in response to population density. CepIR belongs to a group of more than 50 quorum sensing systems that are homologous to the LuxIR system of Vibrio fishceri [6,7]. LuxI homologs are N-acyl homoserine lactone (AHL) synthases that generate AHL signal molecules that are released into the environment. LuxR homologs are transcriptional regulators that complex with AHL and typically bind to a lux-box overlapping the -35 sequence of a promoter to regulate transcription. The lux-box consensus sequence recognized by LuxR homologs typically consists of an inverted repeat with significant consensus among quorum sensing systems [6,8-10]. The CepIR system was originally identified in B. cenocepacia (formerly B. cepacia) K56-2 [11] and has subsequently been shown to be widely distributed throughout the Bcc [12,13]. CepI directs the synthesis of N-octanoyl homoserine lactone (OHL) and N-hexanoyl homoserine lactone (HHL) and cepR encodes for the transcriptional regulator [11-14]. CepR has been shown to negatively regulate its own expression, but positively regulate cepI expression at the transcriptional level [14]. The cepIR genes are involved in the regulation of the pvdA gene required for ornibactin biosynthesis [14], the zmpA and zmpB extracellular metalloproteases [15,16], the aidA gene involved in virulence in Caenorhabditis elegans [17-20], swarming motility and in at least some systems a functional CepIR quorum sensing system is necessary for biofilm formation [21-23]. The CepIR system has been shown to contribute to virulence in both plant and animal models. In B. cepacia ATCC 25416 mutations in cepI and cepR attenuated maceration in the onion-rot model [24]. The contribution of CepIR to the severity of B. cenocepacia infections has been demonstrated in two different animal models, a chronic respiratory infection model in rats and an acute intranasal infection model in Cftrmice [16]. CepIR have also been shown to be important for virulence in C. elegans [25]. Proteomics and promoter based approaches have been used to identify genes regulated by the CepIR quorum sensing system. Proteome analysis was used to compare the protein profiles of B. cenocepacia strain H111 and an H111 cepI mutant [19]. Differences in expression were observed for 55 out of 585 proteins and partial N-terminal amino acid sequences were determined for peptide fragments of 11 proteins including AidA, FimA, and SodB. A promoter trap approach was used to identify positively regulated OHL-CepR dependent promoters in B. cepacia ATCC 25416 [17]. A library of ATCC 25416 fragments cloned upstream of a promoterless lacZ gene in a vector that also contained cepR was screened in E. coli in the presence and absence of OHL. Twenty-eight clones with genes upregulated in the presence of OHL were identified. The genes belonged to several functional classes; however, the only overlap in genes identified between the two studies was aidA [17,19]. Mutagenesis with a transposon containing a promoterless lacZ reporter was used to identify seven genes positively regulated by the cepIR quorum sensing system in B. cenocepacia strain K56-2, including cepI and aidA [20]. Identification of genes directly and indirectly regulated by CepR is a key step to understanding this regulatory system and the regulatory hierarchies that mediate the adaptation B. cenocepacia to the diverse environments it encounters. The above approaches search for genes regulated under defined in vitro conditions and therefore may not identify genes induced only in specific environmental niches including the plant or animal host. Only the study by Aguilar et al. [17] attempted to identify genes that are regulated by the direct interaction of CepR at the promoter. LuxR homologs have been shown to bind to specific sequences referred to as lux boxes or the boxes for the gene designation of the respective luxR homolog such as tra boxes in the case of recognition sequences for Agrobacterium tumefaciens TraR [26-28]. These sequences have dyad symmetries and generally overlap the -35 RNA polymerase binding site. Lewenza et al. demonstrated that CepR was required for the expression of cepI in B. cenocepacia [11,14] and identified a putative lux-box like sequence with imperfect repeats that overlapped the -35 region of the putative cepI promoter [11]. Weingart et al. [20] demonstrated that CepR directly bound to a DNA fragment that contained the cepI promoter using electrophoretic mobility shift assays. They also mapped the transcriptional start site of cepI and using DNAase I footprinting experiments localized the CepR binding site to a region that closely corresponded to the cep box predicted by Lewenza et al[11]. In the present study, we used a functional genomics approach to identify genes in the B. cenocepacia J2315 sequence with a cep box-like sequence in their promoters. We confirmed by site-directed mutagenesis the cep box sequence located upstream of the cepI gene that is necessary for cepI transcription. Using selected B. cenocepacia CepR regulated genes we predicted a consensus cep box motif sequence and used that motif to search the B. cenocepacia J2315 genome to identify promoters potentially regulated by CepR.

Results

Functional analysis of the CepR binding site

Lewenza et al. identified a potential cep box sequence upstream of cepI [11]. Weingart et al. demonstrated using DNAaseI footprinting of the cepI promoter that CepR protected a region of DNA that corresponded to the predicted cep box [20]. To confirm that the cep box is required for cepI transcription, eleven mutations, each with a 4 bp substitution, were introduced into the region -59 bp to -18 bp from the transcriptional start site of cepI (Fig. 1A). BamHI-XhoI fragments containing the mutations were subcloned into pMS402 directly upstream of the promoterless luxCDABE operon [29]. The luxCDABE fusions (pCPI302 to pCPI313) were introduced into K56-2 and expression determined by measuring luminescence (Fig. 1B). The K56-2 cepI::luxCDABE fusions with mutations within the 24 bp inverted repeat (pCPI304-310) had luminescence levels below 20% of the wild type K56-2 (pCPI301), whereas promoter fusions containing mutations flanking the inverted repeat (pCPI303, and pCPI311-314) expressed at levels either similar to or higher than wild-type.
Figure 1

Functional analysis of the CepR binding site. A. Site directed mutagenesis was used to determine the effects of mutations on the luminescence activity of a cepI::luxCDABE fusion. The sequence upstream of the CepI ORF is shown. The ATG start codon is indicated by bold lettering and the predicted -10 hexamer is underlined. A series of 4 bp substitutions used to mutate the promoter region are indicated as bx303-313 and the cep box consensus sequence is enclosed in the rectangle. B. Expression of the cepI::luxCDABE fusions in B. cenocepacia K56-2. Luminescence (CPM) was measured at 22 hours and is represented as CPM/O.D. The numbers on the x axis indicate K56-2 (pCPI303-313) respectively. WT is K56-2 (pCPI301) and the vector control is K56-2 (pMS402).

Identification of CepR regulated genes by transposon mutagenesis

Nine Tn5-OT182 transposon insertion mutants in K56-I2 were identified with differences in β-galactosidase activity on TSB-DC agar with AHL extract and TSB-DC agar without AHL extract. Expression of β-galactosidase activity was increased in the presence of OHL in six mutants and, expression was decreased in three mutants. To locate the Tn5-OT182 insertions in these mutants, the flanking genomic DNA was cloned, sequenced and the sequence obtained was used to search the B. cenocepacia J2315 genome with BlastN to identify the gene containing the insertion (Table 1). A total of 7 distinct genes in 5 regions of the genome were identified. K56-I2-P12, K56-I2-2PB2 and K56-I2-P9 had three distinct insertions within a few hundred base pairs of each other. The P12 transposon inserted into a hemin specific ATPase similar to the phuV gene of Pseudomonas aeruginosa involved in heme iron acquisition [30]. The phuV homolog was predicted to be in an operon with phuR and phuSTUV homologs to of P. aeruginosa. The phuR gene has been shown to be positively regulated by quorum sensing in P. aeruginosa [31]. The insertion in K56-I2-2PB2 transposon was also located in phuV; however, in this case the lacZ fusion was in the opposite orientation to that of the gene. K56-I2-P9 had an insertion in a hypothetical protein which appears to be in an operon and located directly downstream of a pbp1 homolog. K56-2-P1 and P2 were sibling insertions within a predicted acyltransferase that may be involved in lipid metabolism (COG1835). Directly upstream of the acyltransferase is a class D β-lactamase, likely an oxacillin hydrolase. The insertion in K56-I2-P3 was located in a gene, subsequently designated scpB, which belongs to the serine-carboxyl proteinase family [32]. K56-I2-P5 and K56-I2-P10 contained insertions located in aidA, which was also identified in the transposon mutagenesis screen used by Weingart et al. [20]. K56-I2-NB12 contained an insertion in an ORF that has a conserved domain (COG4774) shared with several outer membrane receptors involved in uptake of catechol siderophores, although the other genes flanking this insertion do not appear to be involved in iron acquisition. The insertion in K56-2-2PB2 did not appear to be in a gene. This insertion may result in creation of an artificial promoter-lacZ fusion or influence expression of a regulatory RNA.
Table 1

OHL responsive genes identified by Tn5-OT182 mutagenesis of K56-I2

Transposon MutantOrfaPredicted start codonbLocation of insertbGene/domain homologycOHL effect on expressiond
K56-I2-P1, K56-I2-P2BCAM03922:4453572:444971COG1835: Predicted acyltransferases+
K56-I2-P3BCAM09572:10622982:1060868scpB: serine-carboxyl proteinase precursor+
K56-I2-P5, K56-I2-P10BCAS02933:3280373:328810aidA+
K56-I2-P9BCAM26312:29812792:2980753COG2860: predicted membrane protein-
K56-I2-P12BCAM26302:29797942:2980345phuV: hemin specific ATP-binding protein+
K56-I2-2PB2no gene2:2980336-
K56-I2-NB12BCAM11872:12980852:1297891COG4774, Outer membrane receptor-

a Open reading frame designation from the unpublished annotation of the B. cenocepacia J2315 genome.

b Locations reported as chromosome:nucleotide.

c Gene and domain homologies determined using BLASTP.

d Effect of OHL on expression of the lacZ fusion created by insertion of the transposon. +, positive regulation or greater expression in the presence of OHL; -, negative regulation or lower expression in the presence of OHL.

To confirm the observations in the plate assay, expression of the unique AHL responsive lacZ fusions was examined over a 24 hr time course in the presence and absence of OHL extract. The growth rates for each mutant were similar to the parent strain K56-I2 (Fig. 2A), indicating that the insertions did not result in growth defects that might influence lacZ expression. Expression of the Tn5-OT182 fusions in K56-I2-P1 (Fig. 2C) and K56-I2-P10 (Fig. 2D) were similar to that observed for a cepI-lacZ fusion (Fig. 2B). There was little expression in the absence of OHL and expression increased in the presence of OHL. The expression of the K56-I2-P12 fusion was also increased by the presence of OHL in the culture medium but expression started slightly earlier in growth and decreased after 10 hr (Fig. 2E). Three of the insertions appear to be negatively regulated by cepR since their expression was higher in the absence of OHL and decreased markedly when OHL was added to the culture medium (Fig. 2FGH). Positive regulation of β-galactosidase activity was observed for the K56-I2-P3 insertion in the presence of AHL on the plate assay; however, this fusion expressed very poorly in liquid medium (data not shown). When K56-I2-P3 grown on agar plates was analyzed for β-galactosidase activity, expression was significantly higher in cultures from plates supplemented with AHL (data not shown).
Figure 2

Effect of OHL on β-galactosidase activity in K56-I2 Tn. A: Growth curves for strains shown in panels B-H. (●) CLW101; (▲) K56-I2-P1; (▼) K56-I2-P3; (□) K56-I2-P9; (◊) K56-I2-P10; (■) K56-I2-P12; (○) K56-I2-NB12; and (*) K56-I2-2PB2. Panels B-H: β-galactosidase activity with (■) and without (□) OHL. Fifty μl of OHL obtained from extracts from a 50 ml culture purified by FPLC and resuspended in 1 ml were added to 10 ml broth. This volume of OHL was shown to restore cepI expression to maximum levels. B: CLW101, C: K56-I2-P1, D: K56-I2-P10, E: K56-I2-P12, F: K56-I2-NB12, G: K56-I2-P9 and H: K56-I2-2PB2.

The predicted promoter regions for the three positively regulated genes containing the Tn5-0T182 insertions, phuV, aidA and the acyltransferase, were cloned into pMS402 and expression of the resulting promoter-luxCDABE fusions was determined in K56-2, K56-R2 (cepR) and K56-dI2 (cepI) with and without OHL in the medium. The aidA promoter fusion, pAID301, had an expression pattern similar to the cepI promoter with significant activity in K56-dI2 only when OHL was added to the medium (Fig. 3A and 3B). This expression pattern was similar to the chromosomal Tn5-OT182 lacZ fusion. Expression of the acyltransferase was increased in K56-dI2 in the presence of OHL; however, expression of this fusion in K56-R2 was intermediate between that in K56-dI2 and the parent strain (Fig. 3C). The phuV homolog was predicted to be in an operon with the promoter upstream of a phuR homolog and therefore the phuR promoter was cloned into pMS402. Expression of the phuR promoter was similar to K56-2 until early stationary phase where expression was significantly lower in K56-R2 and K56-dI2 in the absence of OHL (Fig. 3D). Expression of phuR::luxCDABE was slightly enhanced in the presence of OHL in stationary phase. The pattern of expression of the phuR::luxCDABE was similar to that of the phuV::lacZ chromosomal fusion (compare Fig. 2E and Fig. 3D). Expression of the scpB promoter was very weak in both the presence and absence of OHL suggesting different growth conditions are required for scpB expression (data not shown).
Figure 3

Expression of promoter::. The promoter fusions in pMS402 were introduced into strains K56-2 (●), K56-dI2 with no OHL (▼), K56-dI2 with 25 nM OHL (▲) and K56-R2 (■). Strains were grown in triplicate in 96 well microtitre plates for 24 hours. Luminescence and optical density were measured at various timepoints and the activity of the promoter was calculated as CPM/O.D. A. pCPI301 (cepI), B. pAID301 (aidA), C. pAYL301(acyltransferase), and D. pHMV301(phuR).

Construction of the first generation cep box motif and search of the B. cenocepacia genome for match sequences

To identify a consensus cep box motif to search the B. cenocepacia genome for potential CepR regulated genes, promoter regions from cepI, aidA, phuR, the acyltransferase gene identified in K56-I2P2, scpB, and zmpA, which was previously shown to be CepR regulated [16], were analyzed using MEME to identify common motifs. Only positively regulated promoters were analyzed in case there were differences in cep box consensus sequences for positively and negatively regulated promoters. A motif that recognized the defined cep box upstream of the cepI gene was identified using these promoters as the input file (Table 2). The motif included bp 2–19 of the 24 bp palindrome required for transcription that contained the cep box for the cepI promoter. A single copy of the motif was found in all six of the promoters submitted. The most conserved nucleotides in the 18 bp motif were position 2 (T), 6 (A), 9 (G) and 18 (T). The position specific scoring matrix was then used to search the B. cenocepacia J2315 genome using the MAST program. The search returned 148 hits (numbered consecutively starting from MST001) including the 6 original input sequences (data not shown). The surrounding sequence for each hit was annotated and 49 were located upstream of predicted ORFs. The remaining hits were either within the coding sequence of an ORF or found in non-coding regions.
Table 2

Identification of a cep box consensus motif.

Genep-valuebdirectionSequencecbp to ORFd
First Generation Motif Sequencesa

cepI2.23E-11+CACCCTGTAAGAGTTACCAGTTACAGGCTC72
phuR6.53E-10+TACACTGTTAAAGTTGTCAGTTGCCTTTCA116
aidA2.24E-09-GAAGCTGTAAAAGTAAACAGGTCGGGAAAA159
zmpA2.60E-09+TCTTGTTTAAAAGTCATCACTTGATGCATT54
Acyltransferase1.13E-07-AGGGCTTCAAGTGTAACTCCTTGGAAAGGT3
scpB1.25E-07-CCAGTTTCCATAGCTGTCAGTTCTGACAAC115
consensusCTGTAAAAGTTACCAGTTe

Second Generation Motif Sequencesf

cepI4.79E-11+CACCCTGTAAGAGTTACCAGTTACAGGCTC72
phuR6.11E-11+TACACTGTTAAAGTTGTCAGTTGCCTTTCA116
MST0724.01E-09+AAAATTGACAAAGTTATCAGTTATGACTTT56
aidA2.16E-08-GAAGCTGTAAAAGTAAACAGGTCGGGAAAA159
MST0285.32E-07-CTTTCGGCAATAGTTGCCTGTTTCGATTGA140
zmpA2.60E-09+TCTTGTTTAAAAGTCATCACTTGATGCATT54
MST0051.24E-06+CAACCAGTAAAACTTGCGCATTCCGGTCGA206
MST0681.60E-06-CGTTCGCTTAGAGTTGTTCGATATTTCGAA138
MST0111.80E-06+TGTCAAGTCAGACTTGACAGCTTGTAAAGG76
MST0592.41e-06+ATGGTTGAAAGTGTCATCCGGTGCTACACT118
consensusCTGTAAAAGTTACCAGTTg

a The promoter regions of 6 genes experimentally determined to be positively regulated by CepR used to search for common motifs with the MEME (Multiple EM for Motif Elicitation) program.

b The p-value of a site is computed from the the match score of the site with the position specific scoring matrix for the motif. The p-value gives the probability of a random string (generated from the background letter frequencies) having the same match score or higher. (This is referred to as the position by the MAST algorithm.)

c The boxed region represents the region determined to be required for cepI expression as determined in Fig. 1. Bold lettering represents the motif predicted by the MEME program. In the case of cepI the motif matches the CepR binding site [20].

d The number of base pairs to the start codons predicted by alignment with homologous genes.

e Underlined bases are conserved in at least 4 of 6 sequences.

f The promoter regions of 10 genes experimentally determined to be positively regulated by CepR used to search for common motifs with MEME.

g Underlined bases are conserved in at least 7 of 10 sequences.

To determine if the putative cep box sequences identified were potentially involved in CepR regulation of downstream genes, eight of the promoter regions identified that were located within 40–250 bp upstream of a predicted ORF were cloned into pMS402 and expression of the resulting luxCDABE fusions was compared in K56-2, K56-dI2 and K56-R2. The three matching motifs with the lowest E-values and five arbitrarily selected motif matches were selected for analysis. When the motifs were located between two putative divergent promoters, one promoter region was chosen for further analysis. The predicted promoters containing putative cep box motifs were located upstream of the following orfs: BCAL0340, a TPR repeat protein (MST005); BCAL0715, a LysR-type transcriptional regulator (MST011); BCAL1354, a conserved hypothetical protein (MST028); BCAL2739, fusA (MST052); BCAL3191, caiA (MST059); BCAM0009, a transcriptional regulator (MST068); BCAM077, hydroxylase (MST072); and BCAM1943, a transcriptional regulator (MST112). The luxCDABE fusions containing the MST005, MST011, MST028, MST059 and MST072 sequences had expression patterns similar to cepI in that expression was higher in K56-2 than in K56-dI2 or K56-R2 and expression was increased in K56-dI2 in the presence of OHL (Fig. 4A,4B,4C,4E and 4G), although expression varied for some fusions depending on the stage of growth. For example, expression of the MST028 fusion peaked at 6 hours and decreased over the remainder of the assay (Fig. 4C). Expression of MST068 was only decreased in K56-R2 in stationary phase although expression was lower in K56-dI2 than in K56-2 and expression in K56-dI2 increased when the medium was supplemented with OHL (Fig. 4F). MST112, did not appear to be affected by the cepR mutation although expression was lower in K56-dI2 without OHL (Fig. 4H). MST052 did not demonstrate any regulation by CepR in the conditions examined (Fig. 4D).
Figure 4

Expression of promoter::. The promoter fusions in pMS402 were introduced into strains K56-2 (○), K56-dI2 with no OHL (▼), K56-dI2 with 25 nM OHL (▲) and K56-R2 (■). A. MST005, B. MST011, C. MST028, D. MST052, E. MST059, F. MST068, G. MST072, H. MST112. Strains were grown in triplicate in 96 well microtitre plates for 24 hours. Luminescence and optical density were measured at various timepoints and the activity of the promoter was calculated as CPM/O.D.

Construction of the second generation cep box motif and search of the B. cenocepacia genome for potential cep boxes

To improve the specificity of the cep box motif the six promoters with cep box motifs identified by the MAST program with expression patterns similar to that expected for cepIR regulated genes (MST005, MST011, MST028, MST059, MST068 and MST072) were used with the promoters for cepI, phuR, aidA and zmpA to generate a second generation cep box consensus motif using MEME (Table 2). The promoters for scpB, the acyltransferase, MST052 and MST112 did not share the same expression pattern, and therefore were not included. The resulting second generation cep box had the same sequence as the original motif; however the specific score for each position had changed (Fig. 5). The most conserved residues in the second generation motif were in positions 6 (A), 8 (A), 10 (T), 16 (G) and 18 (T).
Figure 5

Graphical representation of the . Nucleotide sequence logos are derived from the sequences in Table 2. The relative sizes of the letters indicate their likelihood of occurring at a particular position. The upper logo is based on the six sequences used in the first generation consensus search and the lower logo is based on the ten sequences used in the second generation consensus search.

The new PSSM file was used to search the B. cenocepacia J2315 genome, resulting in 72 sequences matching the motif. Fifty-five of these matches (76%) were potentially within a promoter region although it must be noted that the transcriptional start sites of these genes have not been experimentally determined. The genes or operons predicted to be downstream of these matching sequences are listed in Table 3. Both MST designations are included in Table 3 for the six first generation MSTs used in the second generation motif search. Several of the cep boxes identified in the second search had more significant E-values than at least one of the input sequences (data not shown). A cep box was identified upstream of cepR (MST2058), using the second motif. This was the only gene previously determined to be regulated by CepR identified. MST112, which was identified with the first motif, but did not appear to be CepR regulated (Fig. 4H), was not identified with the second motif. Potential cep box sequences were identified on all three chromosomes and the plasmid, suggesting that CepR regulated genes are distributed throughout the genome. Genes downstream of promoters containing cep boxes were classified into seven categories: cell surface or membrane protein genes, genes encoding hypothetical proteins, phage genes, regulatory genes, genes involved in secretion or transport, and genes encoding proteins of unknown function (Table 3). In ten cases the putative cep boxes were located between predicted divergent promoters. In these situations orfs located both downstream and upstream of the cep box are included in Table 3 since it would be possible that cepR regulates genes in both directions. An alignment of the putative cep boxes for each of the MST sequences listed in Table 3 is shown in Fig. 6. The most conserved residues are in position six (A), eight (A), ten (T), sixteen (G) and eighteen (T) which correlates with the motif used in the MEME input file. Further studies are needed to determine if the genes downstream of these predicted promoters and cep box motifs are regulated by CepR.
Table 3

B. cenocepacia J2315 genes identified using the second generation cep box motif

Motif nameaPositionbbpcgenedGene/domain and predicted functione(Adjacent downstream genes possibly in operon)
Cell Surface or Membrane

MST2008 (-)1:80616145BCAL0738(-)COG0793: Periplasmic protease; cell envelope biogenesis
MST2009 (+)1:901874295BCAL0831 (+)phaP: phasin-like protein
MST2031 (-)1:2662911104BCAL2406(-)COG0859, rfaF, LPS heptosyltransferase (rfaL,rfaG; LPS biosynthesis genes)
MST2048 (-)2:211218106BCAM0183 (+)COG3468, autotransporter type V secretion, shdA homolog: adhesin
MST2050 (+)2:1129604172BCAM1015(-)COG3203: Outer membrane protein
MST2068 (-)3:174253153BCAS0156(+)COG1680: ampC, β-lactamase class C

Hypothetical Protein

MST2014 (-)1:1228119131BCAL1124 (+)Conserved hypothetical protein
MST2020 (+) MST028f1:1484174140BCAL1354(-)COG4104: conserved hypothetical protein (vgrG: vgr related protein)
MST2030 (-)1:256730841BCAL2313 (+)hypothetical protein
MST2052 (+)2:1249946118BCAM1149 (+)hypothetical protein
MST2056 (-)2:166731257BCAM1502 (+)hypothetical protein (Chemoreceptor mcpA)
MST2063 (-)2:2720454-19BCAM2417 (+)hypothetical protein
MST2067 (+)2:3070180254BCAM2713(-)hypothetical protein
MST2071 (+)3:83611063BCAS0753(+)hypothetical protein

Metabolism

MST2002 (-)1:27324321BCAL0232 (+)Elongation factor Tu
MST2005 (+)1:39096247BCAL0358 (-)COG0308: Aminopeptidase N
MST2007 (+) MST0111:778996101BCAL0716 (+)COG1250: fadB, 3-hydroxyacyl-CoA dehydrogenase; lipid metabolism
MST2010 (-)1:96349559BCAL0886 (+)COG0183: paaJ, Probable beta-ketoadipyl CoA thiolase (caiD; lipid metabolism)
MST2022 (-)1:160204350BCAL1448(-)COG0525: valS, Valyl-tRNA synthetase
MST2023 (-)1:1626201104BCAL1468(-)COG0644: fixC, electron transfer flavoprotein-ubiquinone oxidoreductase
MST2027 (+)1:246561432BCAL2229(-)Hypothetical signal peptide protein (COG3000: Sterol desaturase, lipid metabolism)
MST2029 (-)1:2554533153BCAL2302(-)COG0556,uvrB: Helicase subunit of the DNA excision repair complex
MST2029 (-)1:2554533106BCAL2303 (+)COG1448, tyrB: aspartate/tyrosine/aromatic aminotransferase
MST2034 (+)1:290304055BCAL2638 (+)COG0165,argH: Argininosuccinate lyase, arginine biosynthesis
MST2035 (+) MST0521:30093299BCAL2739 (+)COG0480, fusA: Translation elongation factor
MST2038 (+)1:3351536-15BCAL3058 (+)COG0043, ubiD: 3-polyprenyl-4-hydroxybenzoate decarboxylase (rhtB, Putative threonine efflux or homoserine/homoserine lactone efflux)
MST2039(+) MST059f1:3488874117BCAL3191(+)COG1960: caiA, acyl CoA dehydrogenase
MST2043 (+)1:374536960BCAL3419 (+)COG0757: aroQ: 3-dehydroquinate dehydratase II
MST2045 (+)2:11142137BCAM0010(+)kbl homolog, AKB ligase
MST2046 (+) MST072f2:8484755BCAM0077(-)COG0654: ubiH or mhpA, hydroxylase
MST2055 (+)2:1564008139BCAM1405(-)sacB: Levansucrase (sacC: Levanase precursor)
MST2059 (+)f2:208811371BCAM1870 (+)cepI: homoserine lactone synthase
MST2061(+)2:2134837112BCAM1922(+)repA: replication protein
MST2064 (-)2:283979344BCAM2502(-)COG0757: aroQ: 3-dehydroquinate dehydratase II (aroE: Shikimate 5-dehydrogenase)
MST2064 (-)2:2839793125BCAM2503(+)COG3185: hppD, 4-hydroxyphenylpyruvate dioxygenase
MST2065 (-)2:293811348BCAM2588(-)menG: putative S-adenosylmethionine:2 demethylmenaquinone methyltransferase

Phage genes

MST2024 (+)1:173544671BCAL1564 (-)Hypothetical proteins Mup46, Mup47 and Mup48 [phage tail protein]
MST2060 (+)2:209667728BCAM1879 (+)Phage antirepressor

Regulatory gene

MST2006 (-)1:61690988BCAL0562(-)COG2747, flgM: Negative regulator of flagellin synthesis (flgN; Flagellar biosynthesis/type III secretory pathway)
MST2007 (+) MST011f1:77899659BCAL0715(-)COG0583: LysR-type transcriptional regulator
MST2013 (+)1:108598140BCAL0999 (+)COG3073: RseA; Negative regulator of sigma E activity (RseB or MucB, negative regulator for alginate biosynthesis)
MST2019 (-)1:1437591385BCAL1318 (+)COG3707, nasR: nitrate-and nitrite-responsive positive regulator
MST2026 (+)1:2016418259BCAL1826 (+)gltF: regulator of gltBDF operon, glutamate synthaseenzymes
MST2036 (-)1:315303018BCAL2871(-)COG3073, rseA: Negative regulator of sigma E activity (mucB/rseB, mucD)
MST2039 (+) MST0591:3488874102BCAL3190(-)COG1414: Transcriptional regulator, IclR family
MST2040 (-)1:350238136BCAL3205(-)COG1396: hipB homolog, Putative transcription regulator
MST2045 (+) MST068f2:1114222BCAM0009(-)COG1396: hipB homolog, Predicted transcriptional regulator
MST2046 (+) MST0722:8484758BCAM0076(-)COG1309: ArcR domain: Bacterial regulatory proteins, tetR family
MST2055(+)2:156400864BCAM1406(+)COG: aglR, HTH-type transcriptional regulator
MST2057 (+)2:195987636BCAM1750 (+)COG1846: Transcriptional regulator, MarR family
MST2058f (+)2:208748731BCAM1868(-)cepR: Transcriptional regulator, LuxR family
MST2071 (+)3:83611040BCAS0752(-)COG0583: LysR type Transcriptional regulator

Secretion or secreted product

MST2003 (+)1:35130625BCAL0321 (+)COG3671: Predicted membrane protein (tatA, tatB, tatC secretion pathway)
MST2004 (+) MST005f1:366026206BCAL0340 (+)COG0457: TPR repeat, (evpA and evpB, evpC, evpE, evpF, and evpG virulence and possible secretion)
MST2070(-)f3:478440108BCAS0409 (+)zmpA: extracellular zinc metalloprotease

Transport

MST2001 (-)1:61816272BCAL0051 (+)COG0834: ABC-type amino acid transport/signal transduction systems
MST2066 (+)f2:2974227115BCAM2626 (+)phuR: Haem/Haemoglobin uptake outer membrane receptor precursor (phuS, phuT, phuU phuV
MST2072 (+)P:55610113PBCA053 (-)COG1638,dctP homolog: TRAP-type C4-dicarboxylate transport system,

Unknown

MST2004 (+) MST0051:366026181BCAL0339(-)COG3521: Uncharacterized protein conserved in bacteria
MST2025 (+)1:1979817274BCAL1791 (-)COG2606: Uncharacterized conserved protein
MST2047 (-)2:16954086BCAM0148 (+)Putative vgr-related protein (pldA: Phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthases)
MST2051 (-)2:1150388-37BCAM1044(-)no homology (COG1536: Flagellar motor switch protein)
MST2053 (-)2:146779228BCAM1328-329 (+)Unknown proteins
MST2061 (+)2:213483759BCAM1921-919 (-)no homologs
MST2069 (+)f 3:329197160BCAS0293(-)aidA, intracellular protein of unknown function involved in nematode virulence; (second aidA)

a MSTs were identified by searching the B. cenocepacia J2315 genome with the position specific scoring matrix (PSSM) from the second generation motif. Only genes with a motif match within a potential promoter and within 300 bp of the predicted start codon are reported.

b The location center of the predicted motif is reported as chromosome:nucleotide. (+) or (-) refers to the DNA strand encoding the motif sequence. The motif names in bold were used to generate the PSSM file.

c Number of base pairs between the centre of the motif and the predicted translational start site.

d Open reading frame number from the unpublished annotation of the B. cenocepacia J2315 genome. (+) and (-) refer to the DNA strand.

e Gene and domain homologies were obtained using the standard protein-protein BlastP program as described in the methods. Genes in parantheses are downstream of the first orf following the motif and may be in the same operon.

f Confirmed to be CepR regulated by either lux or lacZ transcriptional fusions.

Figure 6

Alignment of the putative . The MST sequences listed are described in Table 3. Bases conserved in at least 70% of the sequences are shown in red and indicated by an upper case letter in the consensus sequence at the bottom of the alignment, and those conserved in at least 50% of the sequences are shown in blue and indicted by a lower case letter in the consensus sequence. Other bases are indicated in black.

Discussion

In this study we used a computational genome screen and experimental approaches to identify cepR regulated genes in B. cenocepacia. Transposon mutagenesis was used to identify OHL responsive genes in an approach similar to that described by Weingart et al[20]. Since we had previously determined that genes involved in production of the siderophore ornibactin were cepIR regulated [14], we performed our screen in low iron medium in an attempt to identify other iron regulated genes that were responsive to OHL. We also had previously determined that cepR could both positively and negatively regulate gene expression, and therefore, the transposon library was screened for insertion mutants in which β-galactosidase activity was either turned on or off in the presence of exogenous AHLs. Four unique positively regulated and three negatively regulated lacZ fusions were identified. We identified two genes potentially involved in iron transport, a putative outer membrane receptor (BCAM1187) and phuV, a hemin ATP binding protein (BCAM2630). Interestingly, expression of the outer membrane receptor gene was negatively influenced by OHL, whereas phuV expression was positively influenced. In a screen of approximately 25,000 transposon mutants we only identified six loci with AHL responsive genes. The screening assay was dependent on the visual identification of colonies that were either blue or white in the presence or absence of AHL on medium with X-gal. Although we were able to detect as little as two-fold differences in expression with this assay, we would not detect gene fusions expressed in both the presence and the absence of AHL since we did not attempt to identify mutants with varying shades of blue. For example, although CepR positively regulates zmpA, the CepIR system is not required for its expression since zmpA is expressed at low levels in the absence of AHL and in cepI or cepR mutants [16]. The lacZ fusions in the positively regulated genes identified with transposon insertions were only expressed at significant levels in the presence of OHL. The three negatively regulated fusions had very low expression in the presence of OHL (Fig. 2). It was surprising that we did not identify cepI since CepR tightly regulates cepI expression [14] and cepI appeared to be a hotspot for transposon insertions in the study by Weingart et al. [20]. The aidA gene which is tightly regulated by cepIR was identified in both transposon screens, as well as the proteomics and promoter trap approaches [17,19]. Lewenza et al [11] identified a putative CepR binding site in the cepI promoter. During the course of this current study it was reported that CepR directly interacted with a cep box that overlapped this region and directly bound to a cep box within the aidA promoter [20]. We demonstrated using site directed mutagenesis of the cep box region that a 24 bp sequence that contained the cep box was required for cepI expression. All cepI::luxCDABE promoter fusions with mutations in the 24 bp cep box had levels of expression less than or equal to 20% of K56-2 (pCPI301). Similar mutations constructed flanking the cep box had either no effect or in one case increased transcription. The use of bioinformatics to identify CepIR regulated genes has several advantages that are complementary to the experimental methods used to search for CepIR regulated genes. Procedures such as transposon mutagenesis, promoter libraries, microarray analysis or proteomics are dependent on the transcription and expression levels of the genes and on the conditions used in the study. Furthermore, the genes and proteins identified by these approaches may be regulated directly or indirectly by CepR. The use of a motif in a genome-wide search for CepIR regulated genes may identify niche specific genes that may only be expressed in certain conditions. Identification of a cep box motif may also be used to predict whether CepIR genes are directly regulated by interaction with CepR at the promoter or indirectly by CepR interaction with a promoter for an intermediate regulatory gene. In fact, 14 of the 55 putative cep boxes identified were in the predicted promoter regions for regulatory genes. We are currently characterizing some of these regulatory genes to confirm that they are cepR regulated and to determine their regulatory properties. When searching the genome using the first generation cep box motif we identified some sequences that were not identified with the refined motif used in the second screen of the genome (data not shown). It is possible that these genes are regulated by CepR but have less conserved cep box sequences. Of the eight promoter-lux fusions constructed from sequences identified in the first generation search, six were determined to have cepR regulated expression. There was no difference between the expression of the pMST112 in K56-R2 and K56-2; however, luminescence was increased in K56-dI2 in medium with OHL. The MST112 motif was not detected in the second cep box motif, suggesting that this BCAM1943 may not be cepR regulated. Mutations in cepI or cepR did not influence the expression of pMST052 (BCAL2739). Although this promoter region was excluded from the group used to generate the second motif, this potential cep box was also detected in the second search (MST2035). It is possible that BCAL2739 is, in fact, CepR regulated in different medium or growth conditions. Interestingly, the MEME program identified a cep box motif farther upstream of the aidA cepR binding site identified by Weingart et al. [20]. It is possible that there is more than one CepR binding site upstream of aidA. The additional site might contribute to its tight regulation by CepR and dependency on OHL for expression, features that may have resulted in aidA being detected in all of the approaches to date to identify CepR regulated genes. We identified a cep box in the cepR promoter region that contains all of the most conserved bases. We have previously shown that cepR negatively regulates itself [14]. This is the first confirmed negatively regulated gene identified in the motif search. It is difficult to compare the extent of overlap between the genes identified using the bioinformatics approach to those identified by Aguilar et al. [17] and Weingart et al. [20] since the same annotation of the J2315 sequence was not used, although Aguilar et al. identified in addition to aidA, a lysR regulator and a putative short chain dehydrogenase which may be the same ones we identified. Concurrent with this study, we employed a random promoter library approach to identify promoter::lux fusion clones that were differentially expressed in the presence or absence of OHL in K56-dI2 [33]. Of the 86 promoter clones identified, surprisingly only 4 genes overlapped between the two approaches, BCAM0009, BCAM0010, cepI and zmpA. A putative cep box was identified in the promoter regions of 30/89 OHL responsive genes from the promoter library, but generally with only 50–60% identity to the cep box consensus identified in this study. Therefore, these would not have been identified with the stringency employed in the search. It is surprising that more genes that were identified using the cep box motif were not found in the promoter library, although the promoter library also lacks other known CepR regulated genes indicating that it is not complete. Some of the genes with cep boxes may not be expressed in the conditions used to screen the library. Strains of B. cenocepacia, including K56-2, that contain the cenocepacia island (cci) have a second set of quorum sensing genes [34]. CciI is an AHL synthase that produces predominantly HHL and small amounts of OHL. CciR is the transcriptional regulator. CciIR are co-transcribed and cepR is required for cciIR expression [35]. Little is currently known about the regulatory targets of cciIR, although the zinc metalloproteases zmpA and zmpB are regulated by cciIR, and CciR negatively regulates cepI [35,36]. There is no apparent cep box upstream of cciIR; however, there is one located within the coding sequence 13 bp downstream of the predicted start codon. This putative cep box TTGCTGAAGTTGTTCGGT lacks the conserved A in position 6 present in all the sequences in Table 3 but contains the other conserved bases. It is currently unknown whether CciR binds to a similar site as CepR, but we have determined that some cepR regulated genes are not regulated by cciIR (data not shown). It is possible that some of the cep boxes we have identified might be CciR binding sites. Further studies are in progress to explore the regulatory relationships between these two quorum sensing systems in B. cenocepacia.

Conclusion

We have identified several new CepR regulated genes using transposon mutagenesis and lux promoter fusions. We have also used a cep box consensus sequence to identify several genes or operons potentially regulated by CepR. To confirm that these genes are regulated by cepR or possibly cciR, experimental approaches such as transcriptional fusions, microarrays, or demonstration of direct binding of CepR to their promoter regions will be required. These studies reveal a significant number of genes that may be further studied to increase our understanding of the CepR regulon.

Methods

Reagents, bacterial strains and culture conditions

Unless otherwise stated all molecular biology reagents were purchased from Invitrogen Life Technologies (Burlington, Ontario) and all chemicals purchased from Sigma Chemical Co. (St. Louis, Mo.). The strains and plasmids used in this study are listed in Table 4. For genetic manipulations, B. cenocepacia and Escherichia coli strains were grown at 37°C in Luria-Bertani (LB) broth (Invitrogen) or on 1.5% LB agar plates. Concentration of antibiotics in selective medium for E. coli were 100 μg/ml ampicillin, 1.5 mg/ml trimethoprim and 15 μg/ml tetracycline, and for B. cenocepacia were 200 μg/ml tetracycline and 100 μg/ml trimethoprim. For transcription assays, B. cenocepacia strains were grown in tryptic soy broth (TSB, Difco, Detroit, Mich.) or TSBD-C [37].
Table 4

Bacterial strains and plasmids used in this study.

Strain or plasmidDescription and relevant genotypeSource
E. coli
DH5αφ80dlacZΔM15 (lacZYA-argF) recA1 endA gyrA96 thi -1 hsdR17 supE44 relA1 deoR U169Invitrogen
SM10Mobilizing strain, RP4 tra genes integrated in the chromosome, Kmr[50]
DH10BF-mcrA Δ(mrr-hdsRMS-mcrBC) φ80dlacZΔM15 ΔlacX74 endA1 recA1 deoR Δ(ara, leu)7697 araD139 galU galK nupG rpsL λ-Invitrogen
JM109 F'endA1 recA1 gyrA96 thi hsdR17 (rk- mk+) relA1 supE44 Δ(lac-proAB) [F' traD36 proAB laqIqZΔM15]Promega
B. cenocepacia
K56-2Cystic fibrosis respiratory isolate[51]
K56-R2cepR::Tn5-OT182 derivative of K56-2, Tcr[11]
K56-I2cepI::tp derivative of K56-2, Tpr[11]
K56-dI2cepI deletion mutant of K56-2[35]
CLW101cepI::tp::Tn5-OT182 derivative of K56-2, Tcr, Tpr[20]
K56-I2-P1BCAM03092:: Tn5-OT182 derivative of K56-I2, TcrThis study
K56-I2-P3BCAM0957:: Tn5-OT182 derivative of K56-I2, TcrThis study
K56-I2-P5BCAS0293:: Tn5-OT182 derivative of K56-I2, TcrThis study
K56-I2-P9BCAM2631:: Tn5-OT182 derivative of K56-I2, TcrThis study
K56-I2-P12BCAM2630:: Tn5-OT182 derivative of K56-I2, TcrThis study
K56-I2-2PB2Tn5-OT182 derivative of K56-I2, TcrThis study
K56-I2-NB12BCAM1187:: Tn5-OT182 derivative of K56-I2, TcrThis study
Plasmids
pCR®2.1 TOPOPCR cloning vector, pUC ori, Plac, lacZα, KmR ApRInvitrogen
pOT182pSUP102(GM)::Tn5-OT182, Cmr, Tcr, Gmr, Apr[40]
pALTER®-Ex1mutagenesis plasmid, TcrPromega
pSLS225pUCP26 with 1.5 kb SphI-KpnI fragment containing the cepI gene, Tcr[11]
pCPI101pCR®2.1 TOPO with a 266 bp fragment containing the cepI promoter, Apr, KmrThis study
pCPI201pAlter®-Ex1 with the BamHI-XbaI fragment from pCPI101, TcrThis study
pMS402Broad host range vector with promoterless luxCDABE operon, Tpr, Kmr[29]
pCPI301pMS402 with the BamHI-XhoI fragment containing the wild type cepI promoter region from pCPI101, Tpr, KmrThis study
pCPI303-313pMS402 containing the BamHI-XhoI fragments containing the cepI promoter region with the cep box mutations designated 303-313, Tpr, KmrThis study
pRK2013ColE1 Tra (RK2)+, Kmr[52]
pPHU301pMS402 containing the phuR promoter regionThis study
pAYL301pMS402 containing the acyltransferase promoter regionThis study
pSCP301pMS402 containing the scpB promoter regionThis study
pAID301pMS402 containing the aidA promoter regionThis study
pMST005pMS402 containing the MST005 promoter regionThis study
pMST011pMS402 containing the MST011 promoter regionThis study
pMST028pMS402 containing the MST028 promoter regionThis study
pMST052pMS402 containing the MST052 promoter regionThis study
pMST059pMS402 containing the MST059 promoter regionThis study
pMST068pMS402 containing the MST068 promoter regionThis study
pMST112pMS402 containing the MST112 promoter regionThis study

AHL extraction and OHL purification

AHLs were extracted from culture supernatants of K56-2 as previously described [14]. The extract from 50 ml culture fluid was resuspended in 1 ml distilled water and 20 μl aliquots of this stock solution were spread onto agar plates to screen for mutants in which lacZ expression was altered in the presence of AHL. This quantity of AHL extract was found to restore wild-type protease activity to B. cenocepacia K56-I2 as indicated by the zones of clearing observed on skim milk plates. OHL was purified from culture supernatants of B. cenocepacia K56-I2 (pSLS225), a strain that carries the cepI gene in trans as previously described [38].

Molecular biology and sequence analysis

DNA manipulations were performed generally as described by Sambrook et al. [39]. T4 DNA ligase was purchased from Promega Corporation (Madison, WI) and New England Biolabs Inc. (Beverly, MA). Custom oligonucleotides were synthesized by Invitrogen Life Technologies. DNA sequencing was performed at the Univeristy of Calgary Core DNA Services (Calgary, Canada) using an ABI1371A DNA sequencer or at Macrogen Inc. (Seoul, Korea) on an ABI3730 XL automatic DNA sequencer.

Transposon mutagenesis

Mutagenesis of B. cenocepacia K56-I2 (Tpr) with Tn5-OT182 was performed as described by Lewenza et al. [11]. Tn5-OT182 is a self-cloning transposon with a promoterless lacZ gene that is transcribed from the promoter of a host gene when it is fused in the direction of transcription [40]. Transposon insertion mutants were picked using a robot (Norgren Systems, Palo Alto, CA) into Becton Dickenson microtest flat bottom polystyrene 96 well microtiter plates containing 200 μl medium per well and grown overnight at 37°C with shaking at 200 rpm. Cultures were stamped onto TSBD-C (200 μg/ml tetracycline, 100 μg/ml trimethoprim and 40 μg/ml X-gal) agar with and without the addition of AHL extract and grown for 48 hours at 37°C. β-galactosidase expression was visually monitored at 24 and 48 hours for differences in blue color. Approximately 25,000 tetracycline and trimethoprim resistant transposon insertion mutants from five independent mutagenesis experiments were screened. Positively regulated insertion mutants appeared blue in the presence of AHL and X-gal and white in the absence of AHL. The reverse is true in the case of negatively regulated genes. Nine mutants exhibiting reproducible differences in AHL dependent β-galactosidase expression were chosen for further characterization. The DNA flanking the Tn5-OT182 insertions was self-cloned from XhoI or EcoRI digests of genomic DNA and sequenced using oligonucleotides OT182-LT and OT182-RT [41].

Construction of cepI promoter mutations

The Altered Sites® II in vitro Mutagenesis System (Promega) and the Quick Change® Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) were used to create mutations spanning the proposed cep box in the cepI promoter (Fig. 2). The template used with the Altered Sites® II in vitro Mutagenesis System was created by ligating a BamHI-XbaI fragment containing the cepI promoter region from pCPI101 into pALTER-Ex1 (pCPI201). The Altered Sites® II System was used with mutagenic oligonucleotides CepBx103-106 (Table 5). These oligonucleotides were 5'-phosphorylated using T4 DNA Kinase (Promega) and annealed to single stranded DNA prepared according to the manufacturers instructions from cultures of JM109 F' (pCPI201). The remaining mutagenic oligonucleotides were used with plasmid pCPI101 and the Stratagene Quick Change® Site-Directed Mutagenesis Kit. Mutagenic oligonucleotides were designed with 4 base pair substitutions that resulted in the introduction of a new restriction enzyme site (Table 5). Mutations were confirmed by restriction enzyme analysis and sequencing. To construct the cepI::luxDCABE fusions, the mutated promoter regions were excised from pCPI101 and pCPI201 by digestion with BamHI-XhoI and ligated into the BamHI-XhoI site of pMS402.
Table 5

Oligonucelotide primers

PrimerSequenceRestriction Site or size of product (bp)
PCR Oligonucleotides

cepIforCAGGCGGCGATAGCTTG
cepIrevCACAGATCCGAGGACATCCA
EXcepR3CGGGATCCGAGAAAGAATGGAACTGCGCBamHI
EXcepR2CGGGATCCTTGCGTCAGGGTGCTTCGATGBamHI

oligonucleotides used to clone promotersposition of 5' baseaSize (bp)

aidACAGATTCAATGTCGCG3:329288272
GCACATCGGTAACGCG3:329016
scpBCTGCAACGAACGACGCG2:1062555294
GACGGAAGGGGAAGGGC2:1062261
cepIGCCTGCAGGGCACAACGACGCCTATCATGC2:2087932267
GAACGAAGGTCTGCATGGATG2:2088199
PBPCGTCGGGAACGAGGCCC2:2983704313
CGATGGGTTGGCGGTGGG2:2983391
phuRCGTGTCGATGATCCGCG2:2973940404
CACAGGTGGTCTCCC2:2974344
acyltransferaseCGATACACTGTGAGCCG2:446287336
GTCCTTCAGCACGCCG2:445951
zmpACTCGAGGCTGGCCGGTACTG3:478051638
GGATCCAGACTGAAGGCGGACG3:478689
MST005GCACGCCCGCGTCAGGCG1:366108325
CGCAAGCCACCACTACCCC
MST011CCTTGCTGAGATTGCCGGC1:779005321
GACAGCGCGTTCACGGGCG
MST028CGTGTCGTTGCGGCGCGC1:1484174451
GTCTGGCTGTACGCACGCC
MST052CCGTCATTTGTCGTCGGGC1:3009328341
CCAGTCCATCGTGGCCGC
MST059CGCCTTCGGCAGCCCCG1:3488873315
GCTGGTCGAGCAGCAGCGG
MST068CGTCGAGCGTCAGCTTGCGC2:11203325
GGTCGAGCGTCCCGCGC
MST072GCATCCAGCAGGCGCGC2:84846398
CCGACGGGACCGCAGCCC
MST112GCAGGTCGCCATGCCGGG2:2156170441
ACCACGCGTACGCGGGC

Mutagenic Oligonucleotides

CepBx103GCGTCTTTACGCGTCGACCCTGTAAGAGTTACCSalI
CepBx104GTCTTTACGCCGTCATATGGTAAGAGTTACCAGNdeI
CepBx105CGCCGTCACCCCTGCAGAGTTACCAGTTACAGGPstI
CepBx106GCCGTCACCCTGCTGCAGTTACCAGTTACAGGPstI
CepBx107FACGCCGTCACCCTGTAACTAGTACCAGTTACAGGCTCCTCSpeI
CepBx107RGAGGAGCCTGTAACTGGTACTAGTTACAGGGTGACGGCGTSpeI
CepBx108FCCGTCACCCTGTAAGAGTCTAGAGTTACAGGCTCCTCGTGCXbaI
CepBx108RGCACGAGGAGCCTGTAACTCTAGACTCTTACAGGGTGACGGXbaI
CepBx109FCACCCTGTAAGAGTTACCGTCGACAGGCTCCTCGTGCCGCGCSalI
CepBx109RGCGCGGCACGAGGAGCCTGTCGACGGTAACTCTTACAGGGTGSalI
CepBx110FCCTGTAAGAG TTACCAGTTAAGATCTCCTC GTGCCGCGCG CTGBglII
CepBx110RCAGCGCGCGG CACGAGGAGATCTTAACTGG TAACTCTTAC AGGBglII
CepBx111FAGAGTTACCAGTTACAGGGATATCGTGCCGCGCGCTGTAATGEcoRV
CepBx111RCATTACAGCGCGCGGCACGATATCCCTGTAACTGGTAACTCTEcoRV
CepBx112FGTTACCAGTTACAGGCTCCGTACGCCGCGCGCTGTAATGCACBsiWI
CepBx112RGTGCATTACAGCGCGCGGCGTACGGAGCCTGTAACTGGTAACBsiWI
CepBx113FCCAGTTACAGGCTCCTCGTCGACCGCGCTGTAATGCACGCSalI
CepBx113RGCGTGCATTACAGCGCGGTCGACGAGGAGCCTGTAACTGGSalI

a Locations reported as chromosome:nucleotide

In vitro transcription assays

Putative promoters identified in this study were PCR amplified using the primers listed in Table 5 from K56-2 genomic DNA and cloned into the vector PCR2.1®-TOPO. The promoters were excised from the PCR2.1®-TOPO clones using BamHI-XhoI and ligated into pMS402 to create plasmids pCPI301, pPHU301, pAYL301, pSCP301 and pAID301, respectively. The eight promoters identified in the first genome search for cep box motifs were cloned using the primers listed in Table 5 for each MST promoter as described above and named pMST005, pMST011, pMST028, pMST052, pMST059, pMST068, pMST072, and pMST112, respectively. Five ml overnight cultures of K56-2, K56-dI2 and K56-R2 hosting the luxDCABE fusions were grown in TSB supplemented with 100 μg/ml trimethoprim to maintain pMS402. Overnight cultures were diluted with TSB to an A600 of 0.05 and aliquots of 150 μl were placed in wells of 96 well clear bottom plates (Costar, Corning Incorporated, Corning, NY). The plates were covered and incubated at 37°C with shaking and the luminescence and absorbance was measured in a Victor2™ multilabel counter at various intervals for 24 hours. Each strain was assayed at least three times in triplicate.

Bioinformatics

Nucleotide sequence obtained from DNA flanking the transposon insertions was used with BLASTN to determine the location of the insertion in the unpublished genome sequence of B. cenocepacia J2315 [42], a strain of the same lineage as K56-2. Homologues of open reading frames were predicted using BLASTP [43]. Potential promoter elements were identified using BPROM [44]. The cep box consensus sequence was predicted by analyzing the promoter regions of selected positively regulated genes with the motif discovery tool MEME [45]. The MEME program [46] represents motifs as position-dependent letter-probability matrices which describe the probability of each possible letter at each position in the pattern. The output from the MEME program provides a position-specific scoring matrix (PSSM) for the predicted motif. The PSSM for the predicted cep box consensus sequence was used to search the B. cenocepacia J2315 genome with the motif alignment search tool MAST [45,47]. The cep box motifs identified by MAST were also aligned using Multalin [48,49].

Authors' contributions

CC designed the cep box mutagenesis, performed the analysis of the cep box consensus sequence and screening of the genome, contributed to the promoter fusion expression experiments, and helped draft the manuscript. EL performed the transposon mutagenesis, expression experiments on the mutants, cep box alignments and helped draft the manuscript. MV constructed cep box mutants, analyzed genome sequence data, contributed to promoter fusion assays, and helped draft the manuscript, PL cloned MST promoters and performed lux fusion assays, PS participated in the experimental design and data analysis, coordinated the study and drafted the manuscript. All authors read and approved the final manuscript.
  45 in total

1.  Genetics and regulation of two distinct haem-uptake systems, phu and has, in Pseudomonas aeruginosa.

Authors:  U A Ochsner; Z Johnson; M L Vasil
Journal:  Microbiology       Date:  2000-01       Impact factor: 2.777

2.  Quorum-sensing mutations affect attachment and stability of Burkholderia cenocepacia biofilms.

Authors:  Kerry L Tomlin; Rebecca J Malott; Gordon Ramage; Douglas G Storey; Pamela A Sokol; H Ceri
Journal:  Appl Environ Microbiol       Date:  2005-09       Impact factor: 4.792

Review 3.  Quorum sensing: cell-to-cell communication in bacteria.

Authors:  Christopher M Waters; Bonnie L Bassler
Journal:  Annu Rev Cell Dev Biol       Date:  2005       Impact factor: 13.827

4.  Burkholderia cenocepacia ZmpB is a broad-specificity zinc metalloprotease involved in virulence.

Authors:  C Kooi; B Subsin; R Chen; B Pohorelic; P A Sokol
Journal:  Infect Immun       Date:  2006-07       Impact factor: 3.441

5.  Characterization of the cciIR quorum-sensing system in Burkholderia cenocepacia.

Authors:  Rebecca J Malott; Adam Baldwin; Eshwar Mahenthiralingam; Pamela A Sokol
Journal:  Infect Immun       Date:  2005-08       Impact factor: 3.441

6.  Identification of N-acylhomoserine lactones in mucopurulent respiratory secretions from cystic fibrosis patients.

Authors:  Catherine E Chambers; Michelle B Visser; Ute Schwab; Pamela A Sokol
Journal:  FEMS Microbiol Lett       Date:  2005-03-15       Impact factor: 2.742

7.  Direct binding of the quorum sensing regulator CepR of Burkholderia cenocepacia to two target promoters in vitro.

Authors:  Christine L Weingart; Catharine E White; Suping Liu; Yunrong Chai; Hongbaek Cho; Ching-Sung Tsai; Yuping Wei; Nicholas R Delay; Matthew R Gronquist; Anatol Eberhard; Stephen C Winans
Journal:  Mol Microbiol       Date:  2005-07       Impact factor: 3.501

8.  Identification of genes regulated by the cepIR quorum-sensing system in Burkholderia cenocepacia by high-throughput screening of a random promoter library.

Authors:  Benchamas Subsin; Catherine E Chambers; Michelle B Visser; Pamela A Sokol
Journal:  J Bacteriol       Date:  2006-11-22       Impact factor: 3.490

9.  Replication of an origin-containing derivative of plasmid RK2 dependent on a plasmid function provided in trans.

Authors:  D H Figurski; D R Helinski
Journal:  Proc Natl Acad Sci U S A       Date:  1979-04       Impact factor: 11.205

Review 10.  Quorum sensing in the genus Burkholderia.

Authors:  Leo Eberl
Journal:  Int J Med Microbiol       Date:  2006-02-21       Impact factor: 3.473

View more
  16 in total

Review 1.  Nooks and crannies in type VI secretion regulation.

Authors:  Christophe S Bernard; Yannick R Brunet; Erwan Gueguen; Eric Cascales
Journal:  J Bacteriol       Date:  2010-05-28       Impact factor: 3.490

2.  The Burkholderia cenocepacia LysR-type transcriptional regulator ShvR influences expression of quorum-sensing, protease, type II secretion, and afc genes.

Authors:  Eoin P O'Grady; David T Nguyen; Laure Weisskopf; Leo Eberl; Pamela A Sokol
Journal:  J Bacteriol       Date:  2010-10-22       Impact factor: 3.490

3.  Immune Recognition of the Epidemic Cystic Fibrosis Pathogen Burkholderia dolosa.

Authors:  Damien Roux; Molly Weatherholt; Bradley Clark; Mihaela Gadjeva; Diane Renaud; David Scott; David Skurnik; Gregory P Priebe; Gerald Pier; Craig Gerard; Deborah R Yoder-Himes
Journal:  Infect Immun       Date:  2017-05-23       Impact factor: 3.441

4.  ScmR, a Global Regulator of Gene Expression, Quorum Sensing, pH Homeostasis, and Virulence in Burkholderia thailandensis.

Authors:  Servane Le Guillouzer; Marie-Christine Groleau; Florian Mauffrey; Eric Déziel
Journal:  J Bacteriol       Date:  2020-06-09       Impact factor: 3.490

5.  Saturation mutagenesis of a CepR binding site as a means to identify new quorum-regulated promoters in Burkholderia cenocepacia.

Authors:  Yuping Wei; Gina T Ryan; Ana L Flores-Mireles; Esther D Costa; David J Schneider; Stephen C Winans
Journal:  Mol Microbiol       Date:  2011-02       Impact factor: 3.501

6.  A LysR Family Transcriptional Regulator Modulates Burkholderia cenocepacia Biofilm Formation and Protease Production.

Authors:  Kai Wang; Xia Li; Chunxi Yang; Shihao Song; Chaoyu Cui; Xiaofan Zhou; Yinyue Deng
Journal:  Appl Environ Microbiol       Date:  2021-05-26       Impact factor: 4.792

7.  A unique regulator contributes to quorum sensing and virulence in Burkholderia cenocepacia.

Authors:  Eoin P O'Grady; Duber F Viteri; Pamela A Sokol
Journal:  PLoS One       Date:  2012-05-18       Impact factor: 3.240

8.  Reciprocal regulation by the CepIR and CciIR quorum sensing systems in Burkholderia cenocepacia.

Authors:  Eoin P O'Grady; Duber F Viteri; Rebecca J Malott; Pamela A Sokol
Journal:  BMC Genomics       Date:  2009-09-17       Impact factor: 3.969

9.  Identification of functions linking quorum sensing with biofilm formation in Burkholderia cenocepacia H111.

Authors:  Silja Inhülsen; Claudio Aguilar; Nadine Schmid; Angela Suppiger; Kathrin Riedel; Leo Eberl
Journal:  Microbiologyopen       Date:  2012-06       Impact factor: 3.139

10.  Identification of quorum sensing-controlled genes in Burkholderia ambifaria.

Authors:  Annelise Chapalain; Ludovic Vial; Natacha Laprade; Valérie Dekimpe; Jonathan Perreault; Eric Déziel
Journal:  Microbiologyopen       Date:  2013-02-05       Impact factor: 3.139

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.