BACKGROUND: The bZIP class Abscisic acid Responsive Element (ABRE)-binding factor, OSBZ8 (38.5 kD) has been considered to regulate ABA-mediated transcription in the suspension cultured cells of japonica rice. Still, nothing is known about the expression of OSBZ8 at protein level in vegetative tissue of salt sensitive and salt tolerant rice plants. In our previous study, Electrophoretic Mobility Shift Assay (EMSA) of [32P]ABRE-DNA and nuclear extracts prepared from the lamina of Pokkali rice plants has detected the presence of an ABRE-binding factor. Northern analysis has also detected salinity stress induced accumulation of transcripts for bZIP class of factor. Therefore, OSBZ8 was considered to play an important role in the regulation of transcription in the vegetative tissue of rice. The aim of this study is to find out whether OSBZ8 has any role in regulating the NaCl-stress induced gene expression in vegetative tissue and whether the expression of OSBZ8 factor directly correlates with the stress tolerance of different varieties of indica type rice. RESULTS: Northern analysis of total RNA from roots and lamina of salt-sensitive M-I-48 and salt-tolerant Nonabokra, when probed with the N-terminal unique region of OSBZ8 (OSBZ8p, without the highly conserved basic region), a transcript of 1.3 kb hybridized and its level was much higher in tolerant cultivar. EMSA with Em1a, the strongest ABA Responsive Element till reported from the upstream of EmBP1, and the nuclear extracts from laminar tissue of untreated and salt-treated seedlings of three salt sensitive, one moderately sensitive and two salt tolerant indica rice cultivars showed specific binding of nuclear factor to ABRE element. Intensity of binding was low and inducible in salt sensitive rice cultivars while high and constitutive in salt tolerant cultivars. EMSA with 300 bp 5'upstream region of Rab16A gene, a well known salt stress and ABA-inducible gene of rice, showed formation of two complexes, again very weak in salt sensitive and strong in salt tolerant rice cultivar. CONCLUSION: The bZIP factor OSBZ8 was found to be present in the ABRE-DNA: protein complex as shown by the supershift of the complex by the purified antiserum raised against OSBZ8p. Treatment of the seedlings with NaCl was found to enhance the complex formation, suggesting the regulation of OSBZ8 gene at both transcriptional and post-translational steps. Comparative EMSA with different varieties of rice suggests a positive correlation with the expression pattern of OSBZ8 and salt tolerance in rice cultivars.
BACKGROUND: The bZIP class Abscisic acid Responsive Element (ABRE)-binding factor, OSBZ8 (38.5 kD) has been considered to regulate ABA-mediated transcription in the suspension cultured cells of japonica rice. Still, nothing is known about the expression of OSBZ8 at protein level in vegetative tissue of salt sensitive and salt tolerant rice plants. In our previous study, Electrophoretic Mobility Shift Assay (EMSA) of [32P]ABRE-DNA and nuclear extracts prepared from the lamina of Pokkali rice plants has detected the presence of an ABRE-binding factor. Northern analysis has also detected salinity stress induced accumulation of transcripts for bZIP class of factor. Therefore, OSBZ8 was considered to play an important role in the regulation of transcription in the vegetative tissue of rice. The aim of this study is to find out whether OSBZ8 has any role in regulating the NaCl-stress induced gene expression in vegetative tissue and whether the expression of OSBZ8 factor directly correlates with the stress tolerance of different varieties of indica type rice. RESULTS: Northern analysis of total RNA from roots and lamina of salt-sensitive M-I-48 and salt-tolerant Nonabokra, when probed with the N-terminal unique region of OSBZ8 (OSBZ8p, without the highly conserved basic region), a transcript of 1.3 kb hybridized and its level was much higher in tolerant cultivar. EMSA with Em1a, the strongest ABA Responsive Element till reported from the upstream of EmBP1, and the nuclear extracts from laminar tissue of untreated and salt-treated seedlings of three salt sensitive, one moderately sensitive and two salt tolerant indica rice cultivars showed specific binding of nuclear factor to ABRE element. Intensity of binding was low and inducible in salt sensitive rice cultivars while high and constitutive in salt tolerant cultivars. EMSA with 300 bp 5'upstream region of Rab16A gene, a well known salt stress and ABA-inducible gene of rice, showed formation of two complexes, again very weak in salt sensitive and strong in salt tolerant rice cultivar. CONCLUSION: The bZIP factor OSBZ8 was found to be present in the ABRE-DNA: protein complex as shown by the supershift of the complex by the purified antiserum raised against OSBZ8p. Treatment of the seedlings with NaCl was found to enhance the complex formation, suggesting the regulation of OSBZ8 gene at both transcriptional and post-translational steps. Comparative EMSA with different varieties of rice suggests a positive correlation with the expression pattern of OSBZ8 and salt tolerance in rice cultivars.
Although rice (Oryza sativa) is a non-halophyte, the indica varieties Pokkali and Nonabokra are classified as salt tolerant based on various physiological parameters [1] in comparison to the high yielding rice cultivars, which are salt sensitive. Changes in gene expression are the underlying fact behind all the biochemical changes [2-5] that occur in response to salinity stress. Extensive effort to monitor and clone salinity stress induced genes, subtractive hybridization followed by EST, resulted in cloning and identification of 1400 cDNAs from Pokkali rice plants [6]. Several such abiotic stress inducible genes, also inducible in vegetative tissues by exogenous application of the plant hormone abscisic acid (ABA) have been cloned and characterized from different plant species; e.g. Em from wheat [7], Osem, Rab16A-D, SalT from rice [8-10], LEA, Dehydrin from cotton and barley [11,12], Rab17 from maize [13], etc. Salinity or low water status enhances ABA level in many plants including rice [14,15]. On the other hand, several abiotic stress inducible genes are not responsive to exogenous ABA treatment, suggesting the existence of both ABA-dependent and ABA-independent pathways [4,5].Since most promoters of ABA-inducible genes contain ACGTGGC motifs within 300 bp upstream of the transcription start sites, the motif was predicted to be an ABA response element or ABRE. Several functional T/CACGTGGC-based ABREs with a core ACGT [G-box, [17]] have been identified, two of such homologous motifs e.g. Em1a from Em gene of wheat and motif I from Rab16A gene of rice were considered as strong ABREs [18]. In addition to ABRE, other GC-rich elements called as Coupling Element (CE) were also detected from barley gene HVA22 and considered as important in making the gene responsive to ABA [19]. Multiple copies of ABREs or related cis-elements generally occur in the upstream of ABA/abiotic stress inducible genes. The presence of ABRE and/or ABRE-CE together as ABA-Responsive Complex or ABRC are essential for abiotic stress inducibility through ABA-dependent pathway, and the trans-acting factor(s) that strongly bind to ABRE, play necessary role in the expression of those genes [20].Using the ABRE-DNA as probe and screening the expression cDNA library, the cDNA of several basic leucine zipper (bZIP) factors that bind ABREs have been cloned as candidates for ABA-responsive transcription factors. EmBP1, expressing in the mature wheat embryo and binding to Em1a motif, was cloned by screening expression cDNA library using [32P]-labeled Em1a as probe. From the analysis of its primary structure, EmBP1 protein was found to be a bZIP class of DNA binding protein [16]. Similarly, binding of nuclear factors to motif I, IIa, IIb present in the upstream of Rab16A gene was also reported, but the binding factors were not cloned [21]. RITA-1 mainly expresses in developing seeds of rice [22]. osZIP-1a and osZIP-2a in vegetative parts [23], OSBZ8 expresses normally in developing rice embryo and inducible by dehydration or salinity stress in vegetative tissues [24], TRAB1 expresses in developing seeds but also at low level in vegetative tissues of young rice plants [25].Although the basic amino acid rich DNA-binding domain of all these factors is highly conserved, binding to ABRE was demonstrated only with OSBZ8 and TRAB1. TRAB1 was found to mediate ABA-regulated transcription after interacting with the seed specific factor viviparous-1 [vp1; [26]]. So, TRAB1 has been considered as the key player in ABA inducible gene expression in developing seeds where VP1 is also expressed. The bZIP factor osZIP-1a binds to ABRE but its abundance was significantly reduced in presence of exogenous ABA. The expression of the factor OSBZ8 in vegetative tissue of Nipponbare rice plants has been studied in detail [24]. It was reported that its transcript accumulation in response to NaCl or ABA treatment preceded induction of other ABA-responsive genes like Rab16A and Osem and their expression was cycloheximide insensitive. However, the bZIP factor that plays the most important role in ABA as well as NaCl-stress induced gene expression in vegetative parts of rice still remains unknown.In order to understand ABA-regulated gene expression during NaCl stress, we have done a comparative EMSA study among different indica type rice varying in salt tolerance. Based on the activity and expression patterns of OSBZ8, we have proposed that the expression pattern of OSBZ8 directly correlates with the ability of the cultivar to tolerate salt stress. So, it was hypothesized that OSBZ8 can be considered as a key factor interacting with ABRE-based promoter and thereby regulating the ABA or abiotic stress inducible genes in vegetative tissues. We have demonstrated that the specific DNA-protein complex was enhanced in response to salinity stress and also by the addition of spermidine or GTP in the control nuclear extract [27]. Although the factor(s) involved in the complex formation were not identified, OSBZ8 was considered as the probable candidate. The presence of OSBZ8 in the DNA-protein complex was proved by the identification of the band by antiserum against OSBZ8.
Results
Northern blot analysis with GC19, OSBZ8p and Rab16A full length probe
Ten-day-old Pokkali plants were treated with NaCl or ABA or NaCl along with cycloheximide and total RNA was extracted from the roots and lamina. Northern analysis of 30 μg of total RNA with GC19 (partial cDNA of EmBP1 encoding the highly conserved basic DNA-binding domain) identified transcripts of two different sizes (2.2 kb and 1.3 kb) and their accumulation was cycloheximide insensitive (Fig. 1A). The size of the upper transcript matches well with the reported size of TRAB1 [25] and that of the lower one (1.3 kb) matches well with the reported size of OSBZ8 [24]. Since both TRAB1 and OSBZ8 are bZIP class of factors, presence of well-conserved sequence encoding basic DNA-binding domain in the GC19 probe was the cause of hybridization with two different transcripts.
Figure 1
Northern blot analysis of total RNA from different varieties of rice. A. Blot with equal amount of total RNA isolated from roots of Pokkali plants probed with [32P]-GC19 (encoding highly conserved basic domain), showed hybridization with two transcripts of size 2.2 kb and 1.3 kb, both of which appeared after treatment of plants either with 200 mM NaCl (lane 2) or with 100 μM ABA (lane 3) or with NaCl and cycloheximide (Ch, lane 4), together. B. Physical map of the entire ORF for OSBZ8 showing the positions of the primers used in the amplification of full length OSBZ8 or OSBZ8p. C. Northern blot with total RNA from roots (R) and lamina (L) of M-I-48 and Nonabokra probed with the unique region of OSBZ8. Transcript abundance is shown both in control and treatment with 200 mM NaCl (lane 1, 2, 3 and 4 in M-I-48; and lane 5, 6, 7 and 8 in Nonabokra). D. Northern blot with total RNA from lamina of M-I-48 (lane 1 and 2), and Nonabokra (lane 3 and 4), probed with Rab16A full length. Histogram drawn from the values obtained by the densitometric scanning of each lane is shown under each autoradiogram. Mean values ± SD of three independent experiments are shown.
The full-length cDNA for OSBZ8 was amplified from the poly A+ RNA of 150 mM NaCl-treated Pokkali roots by RT-PCR using primers (OSBZ85 and OSBZ83) designed from the two extreme ends of the ORF of OSBZ8 cDNA (Fig. 1B) made according to the published sequence [24]. Sequence analysis revealed that ORFs of OSBZ8 from both japonica var. Nipponbare and indica var. Pokkali and Nonabokra were 1083 bp long. They matched quite well except at five positions and all the amino acid changes are outside the DNA-binding domain of the factor. The basic amino acid rich DNA-binding domain of the bZIP factors is highly conserved [28]. The N-terminal end of OSBZ8 was found to be unique as little homology was detected with other known bZIP factors from rice at both nucleotide and amino acid level. Therefore, the 5'end of the cDNA encoding the N-terminal part of OSBZ8 was further amplified by OZBZ85 and OSBZ83A primers. Northern analysis with equal amount of total RNA from salt sensitive M-I-48 and salt tolerant Nonabokra rice plants with OSBZ8p (420 bp cDNA encoding the N-terminal unique region of OSBZ8), hybridization with the lower transcript (1.3 kb) only was visible (Fig. 1C). As the probe is partial without the region coding for DNA-binding basic amino acid rich domain, the larger transcript (2.2 kb) did not hybridize. Densitometric scanning of the autoradiograms revealed that the level of 1.3-kb transcript of OSBZ8 in the NaCl-treated roots of Nonabokra was 4.5 times than that in M-I-48, whereas in lamina it was 5 times in Nonabokra. The expression is higher in the roots of both the cultivars than in the laminar tissue. The salinity stress induced accumulation of the transcript was more pronounced in M-I-48 than in Nonabokra, suggesting a regulation of expression of OSBZ8 gene at transcription level. Transcripts of OSBZ8 may be present in so little amount in control roots and shoots of M-I-48 that it is almost undetectable by Northern analysis.Comparable results were obtained in the expression pattern of Rab16A-one of the important target genes for OSBZ8. Here also, the transcript for Rab16A was detected only from Nonabokra rice plants and very little or none from the salt sensitive M-I-48 (Fig 1D). Comparison among untreated and salt treated (200 mM NaCl, 16 hr) plants showed constitutive expression in Nonabokra rice plants. Thus, a positive correlation in the expression of Rab16A gene with that of OSBZ8 in Nonabokra was observed.
EMSA with [32P]-labeled ABRE-DNA and laminar nuclear extracts of salt sensitive and tolerant rice cultivars
The active form of trans-acting factor that interacts with ABRE cis-element was compared between well-known salt sensitive and salt tolerant rice cultivars by EMSA. Equal amount of nuclear extract (20 μg/lane on protein content basis) of control and salt-treated M-I-48, IR-29, IR-72 (salt sensitive); IR-8 (moderately tolerant) and Pokkali and Nonabokra (salt tolerant) was mixed with equal amount of [32P]-ABRE-DNA probe (26 bp) and EMSA was performed (Fig. 2B, C). Mobility shift of the probe was detected due to the formation of one distinct complex. The binding of the nuclear factor to the probe was found to be specific as the complex disappeared due to the competition with 100 fold molar excess of non-radioactive 1X ABRE or 4X ABRE or 2X ABRC but not with 4X Dehydration Responsive Element [DRE, [29]] or 2X Ethylene Responsive Element [ERE, [30]] oligo-duplexes (Fig. 2A). Since ABRC contained ABRE and Coupling Element [19], 2X ABRC oligo-duplex showed competition with the probe. As DRE or ERE cis-acting-elements are not homologous to ABRE, competition did not occur. So, the shifted DNA-protein complex in EMSA was found to be highly specific and therefore use of 1X ABRE as probe in EMSA, was considered as a faithful way to compare the level of active form (ability to bind in native form) of trans-acting factor in nuclear extracts.
Figure 2
EMSA of 26 bp [32P]-ABRE (Em1a) with the nuclear extract (NE) prepared from lamina of different rice plants & demonstration of the specificity of binding of DNA-protein complex formation. A. 100 fold molar excess of non-radioactive 1X ABRE-DNA (lane 2) or 4X ABRE-DNA (lane 3) or 2X-ABRC-DNA (lane 4) or 4X DRE-DNA (lane5) or 2X ERE-DNA (lane 6) was added in the nuclear extracts from Pokkali plants before the addition of probe and incubated for 30 minutes at 25°C. In lane 1, no competitor was added as control. Equal amount of NE was incubated with amount of probe (1μl = 90,000 cpm) at R.T. in all cases. B. Comparative EMSA of the laminar nuclear extract of two salt sensitive, M-I-48 (lane 2, 3) and IR 72 (lane 4, 5) and two salt tolerant, Pokkali (lane 6, 7) and Nonabokra (lane 8, 9) rice plants with [32P]-ABRE-DNA; and the effect of salinity stress to the plants. C. EMSA with nuclear extracts prepared from laminar tissue of control and salt-treated IR-29 (salt sensitive) and IR-8 (moderately salt tolerant) rice cultivars. Histogram drawn from the values obtained by the densitometric scanning of each lane is shown under the autoradiogram. Mean values ± SD of four independent experiments are shown. D. Protein profile of the nuclear extracts (NE) separated by SDS-PAGE followed by staining with Coomassie Brilliant Blue G-250. Molecular weight marker (broad range from New England Biolabs) was loaded in the extreme right side lane.
EMSA was repeated to compare the level of ABRE-binding-factor present in the nuclear extracts of laminar tissue from control and salt-treated plants of different rice cultivars. EMSA done with equal amount of nuclear extracts (20 μg) and [32P]-labeled 1X ABRE-DNA, clearly shows that the level of ABRE-binding-factor was very low and inducible by salinity stress in salt sensitive cultivars (Fig 2B); whereas, very high and constitutive in salt tolerant cultivars (4 to 5 fold higher). In IR-8, a moderately tolerant variety, expression of the factor is also in-between (Fig. 2C, almost 2 fold than M-I-48 or IR-72). Nonabokra has higher level of the factor than Pokkali (1.4 times). Comparison of the protein profile of the nuclear extracts run on 12% SDS-PAGE used in the EMSA experiments, as visible by staining with Coomassie blue, showed no qualitative or quantitative differences within cultivars (Fig. 2D). The experiment was repeated four times, autoradiograms from four independent experiments were scanned and statistical analysis was done. The competition experiment (Fig. 2A) and the comparative EMSA experiment (Fig. 2B, C) were found to be reproducible, as all of them showed similar difference within salt sensitive and salt tolerant indica rice cultivars.
EMSA with the antiserum against the N-terminal end of OSBZ8
The 420 bp N-terminal unique region of OSBZ8 was cloned in pGEX 3X to produce a 40 kD GST: OSBZ8p (p = partial) fusion protein. Perfect matching of the reading frames of GST with that of OSBZ8partial was verified by sequencing using GST primer. Antiserum developed in rabbit, was further enriched and used at 1 to 1000 dilution in a primary immunoblot analysis to determine the titre.To investigate the presence of OSBZ8 in the ABRE-DNA: nuclear protein complex in EMSA, the diluted antiserum was added in the EMSA reaction mixture. Since, a conformational change in tertiary or quaternary structure of DNA-binding polypeptide may be expected during its interaction with other protein or nucleic acid, the antibody-recognizing domain of OSBZ8 factor may or may not be accessible to the antibody when OSBZ8 is in the native form or bound to DNA (as EMSA complex) [31]. A preliminary experiment was done, by adding the antiserum to the rice nuclear extract either before or after incubation with [32P]ABRE-DNA. Supershift was visible only when the antiserum was added after the incubation of ABRE-DNA probe with the laminar nuclear extracts of both IR-72 and Pokkali (Fig 3A), suggesting the presence of OSBZ8 factor in the [32P]ABRE-DNA: nuclear protein complex.
Figure 3
Antiserum against unique region of OSBZ8 factor recognizes OSBZ8 from the ABRE-EMSA complex by either causing supershift or in western analysis after elution of the EMSA complex from the dried gel. A. The nuclear extracts from IR-72 (lane 1) and Pokkali (lane 2 to 5) were incubated with the purified antibody before and after the addition of the probe. Super shift was only detected in post-incubation of the antiserum (lane 1, 2 and 5) and not in pre-incubation (lane 4). In lane 3, antiserum was not added. B. Western blot analysis of protein extracted from dried gel with shifted complex shown in fig. 3A. The nuclear factor was eluted from the [32P]ABRE: protein complex or [32P]ABRE: protein: Ab complex from dried native polyacrylamide gel. It was analyzed by silver staining (IR-72 in Lane 1; Pokkali in Lane 2 and Pokkali-Ab complex in Lane 3, Panel I); recognition by the antiserum against N-terminal end of OSBZ8 (38-kD) factor (Panel II) but not by the preimmune serum (Panel III) after SDS-PAGE.
To identify the polypeptide that binds to [32P]ABRE-DNA probe in EMSA, the shifted and the supershifted band from the dried gel were cut and polypeptide was eluted. The eluted fractions were analyzed by SDS-PAGE followed by silver staining (Fig. 3B) and immunoblot analysis. Silver staining confirmed the presence of a 38-kD polypeptide (Panel I) as the only major band, which was recognized by the antiserum (Panel II) but not by the preimmune serum (Panel III). The result indicates that the 38-kD polypeptide that makes complex with the [32P]ABRE-DNA is OSBZ8 and its level is higher in salt tolerant rice cultivars than in the salt sensitive rice cultivars.Addition of spermidine or proline or GTP to the control nuclear extract from Pokkali enhanced the intensity of the complex [27]. So, effect of addition of S80 fraction or ATP or some kinase inhibitors to the nuclear extract was checked. Nonabokra nuclear extracts was pre-incubated with Nonabokra root soluble extract, a preparation we call S80 and EMSA was performed. Enhancement of complex formation was observed with the Nonabokra control nuclear extract when pre-incubated with S80 prepared from salt-treated (200 mM NaCl, 16 hr) Nonabokra plants (Fig. 4A). No shift was obtained with S80 fraction only (data not shown). Addition of ATP alone was found to slightly enhance complex formation, whereas pre-incubation of nuclear extract with heparin, a potent inhibitor of Casein Kinase II, was found to be inhibitory. Addition of R24571 (a potent inhibitor of CDPK) or an indirect inhibitor of MAP kinase [phenyl arsine oxide, [32]] did not show any inhibition (Fig. 4B).
Figure 4
EMSA showing enhancement of binding activity of Nonabokra NE with 32P-1X ABRE-DNA after addition of the S80 fraction. A. Enhancement of the binding intensity by pre-incubation of control NE from Nonabokra with S80 fraction prepared from Nonabokra (200 mM NaCl for 16 hrs; lane 2). In lane 1, no S80 fraction was added. B. EMSA showing enhancement of complex formation after addition of ATP (lane 1). Partial inhibition of binding was obtained with heparin (a potent inhibitor of casein kinase II, lane 2), whereas no inhibition was obtained with phenyl arsine oxide (an indirect inhibitor of MAP kinase, lane 3) or R24571 (a potent inhibitor of CDPK, lane 4).
Similar EMSA experiment was repeated with M-I-48 control nuclear extracts and the same result was obtained (data not shown), suggesting similar mechanism of action in both sensitive and tolerant cultivars, only difference between them being the level of ABRE-binding-factor.
EMSA with upstream of Rab16A and rice nuclear extracts
When EMSA of rice nuclear extracts were repeated with [32P]-Rab16A upstream DNA (300 bp) as probe containing motif I, motif IIa and motif IIb, formation of two distinct complexes CI and CII was detected (Fig 5A). The expression level of the binding factors was very high in Nonabokra and salinity stress has little or no effect. Intensity of both the complexes was undetectable in the untreated samples of salt sensitive M-1-48 and can be detected only in response to salinity stress, supporting the observations obtained from the EMSA using ABRE-DNA as probe. Binding was specific as competition was observed with non-radioactive homologous DNA, but complex CII was visible even with 250 fold excess of non radioactive ABRE-DNA (Fig. 5B). Addition of antiserum against OSBZ8p to the EMSA reaction mixture of Nonabokra nuclear extract caused the disappearance of the CI complex and had no effect on CII complex formation, suggesting the involvement of OSBZ8 in CI complex formation. Formation of both complexes was undisturbed when pre-immune serum was added (Fig. 5C). Binding of E.coli expressed full length OSBZ8 to the Rab16A probe, probably to motif I site, was observed and the rOSBZ8FL: Rab16A complex migrated to the same position as that of CI complex (Fig. 5D).
Figure 5
Comparative EMSA of nuclear extracts with [32P]-Rab16A promoter (300 bp natural promoter, containing motif I, motif IIa and IIb) as probe. A. Formation of two different complexes, C1 and CII (arrow marked) differing in their mobility was observed when equal amount of nuclear extract (20 μg) from M-1-48 and Nonabokra were incubated with equal amount of [32P]-labeled Rab16A promoter (80,000 CPM) as probe. Complex formation was extremely low and inducible in M-1-48 (lane 2 and 3) whereas both complexes were high and constitutive in Nonabokra (lanes 4 and 5). B. Specificity of the complexes formed in EMSA, as shown by the competition by non-labeled Rab16A at 100 fold molar excess for CI complex (lane 3) and at 250 fold molar excess for CII complex. 100 fold excess of 1XABRE (lane 4) showed competition with CI complex formation, suggesting motif I is equivalent to ABRE. C. Nuclear extract (20 μg) from Nonabokra control lamina showed the formation of CI and CII with [32P]Rab16A promoter (lane 2). The figure shows that both pre- and post-incubation (lane 4 and 5) with antiserum (before and after the addition of [32P]-Rab16A promoter) abolished CI, the faster migrating complex. Incubation with equal concentration of pre-immune serum shows no such effect (Lane 3). D. EMSA of [32P]Rab16A promoter with the 43 kD recombinant 6X His-OSBZ8FL protein shows the formation of a single complex and the shift was equal to CI formed by the nuclear extract and [32P]Rab16A (Lane 3). Lane 2 shows the usual formation of CI and CII with Nonabokra laminar nuclear extract.
Discussion
Comparative EMSA experiment between different cultivars showed distinct quantitative difference in the level of ABRE-binding-factor in lamina of salt sensitive and salt tolerant rice cultivars. It is believed that high level of ABA contributes to the mechanism of salt tolerance through physiological changes and by regulation of many genes. It was demonstrated that at about 16 hours of imposition of osmotic shock (150 mM NaCl), peak ABA concentration varies within cultivars. It is 30-fold and 5.8-fold higher in roots and shoots of Nonabokra and 6-fold and 1.6-fold in roots and shoots of Pokkali, in comparison to roots and shoots of salt sensitive TN-1 [33]. Though Pokkali is more commonly known as to be a more tolerant variety, the difference is not so prominent at seedling stage. Results of EMSA consistently showed that the level of ABRE-binding factor is highest in Nonabokra and it has the highest capacity to accumulate endogenous ABA. The role of other factors, probably involved in the ABA-independent pathway [3-5], cannot be ruled out in the mechanism of salt-tolerance in case of Pokkali. Although larger area was covered by the shifted complex in EMSA by nuclear extracts from Nonabokra and Pokkali, autoradiogram prepared from shorter exposure did not show multiple complexes or any qualitative difference within shifted complex (data not shown). Similar observations were made from the EMSA experiments done with Rab16A upstream DNA as probe. Moreover, disappearance of CI complex due to the competition by 1X ABRE, but not of CII complex, clearly proves that the CI complex was due to the binding of the nuclear factor to motif I which is an ABRE. Antiserum when added to the EMSA showed disappearance of CI complex, also suggesting that the motif I is the target site of OSBZ8. Since experiments with higher amount of Rab probe and nuclear extracts were not repeated, it is difficult to predict why supershift was not observed. In fact, full length bacterially expressed OSBZ8 also binds to the Rab16A probe and formed a complex, mobility of which is similar to that of the CI complex, suggesting that CI complex is actually formed by OSBZ8 present in nuclear extracts. Data shows that the level of ABRE-binding-factor is 6 fold and 4 fold in Nonabokra and Pokkali respectively than in the salt sensitive rice cultivars. Salinity stress enhances the level of ABRE-binding factor by 1.05 fold in Nonabokra, 1.1 fold in Pokkali, 1.5 fold in IR-72 and 2.5 fold in M-I-48.The ABA-induced enhancement of complex formation in the EMSA using [32P]ABRE (Em1a sequence) was compared using nuclear extract prepared from rice suspension-cultured cells treated with or without ABA [16,24]. Binding of nuclear factors to Rab16A upstream region, especially to motif I-ABRE and also to motif IIa and IIb (GC elements) were also shown by EMSA when nuclear extract was used from 9-day-old young rice plants [21]. In all these studies, the in vivo ABRE-binding factor was not identified. We considered OSBZ8 as the factor present in the nuclear extract that binds to ABRE probe in EMSA, as the level of OSBZ8 transcript was shown to be ABA inducible and precedes the expression of other abiotic stress inducible genes through ABA-dependent pathway in vegetative tissues like lamina.Southern analysis of OSBZ8 has already indicated that there are no other genes closely related to OSBZ8, but several genes are present in the rice genome distantly related to OSBZ8 [24]. The N-terminal 140-aa sequence of OSBZ8 was found to be unique for the indica variety since using the N-terminal 140-aa sequence of OSBZ8 to BLAST the Swiss-Prot database, no other factors were found to have significant homology from indica variety. Only two other bZIP factors from japonica rice have over 90% homology with this 140-aa sequence (Q5SN21 and Q6AUN3). But, they are reported only as putative G-box binding factors and nothing was reported conclusively for them to bind the Em1a element. We have also cloned and sequenced Rab16A gene from IR-29, Pokkali and Nonabokra. Alignment of all three sequences again showed no significant difference at the nucleotide level (data not shown). So, the difference only appears as varietal difference within cultivars. Such varietal difference among cultivars is not uncommon as it was also found previously for other rice genes [Osem, Em homologue of rice, 8]. Moreover, analysis of the protein eluted from the EMSA complex yielded only one major band of 38-kD with a few minor bands (of very high molecular weight) even after silver staining; indicating the presence of only one major protein in the ABRE-DNA complex. Thus, choice of this N-terminal portion of OSBZ8 can be justified both in raising antibody that recognizes OSBZ8 from the EMSA complex and also in the Northern blot analysis. OSBZ8 polypeptide requires post-translational modification to attain conformation that favors binding to ABRE. In fact, addition of the cytosolic fraction to the EMSA reaction mixture enhances the intensity of the complex, suggesting the presence of either the DNA-binding factor also in the S80 fraction or an activator that triggers OSBZ8 to bind to ABRE. EMSA with S80 alone did not show any shifted complex, thus nullifying the first probability (data not shown). Pre-incubation with different kinase inhibitors indicated the involvement of a Casein Kinase II-like kinase activity. ABA-as well as salinity stress-inducible kinase activity was detected from 3-day-old rice seedlings, the level of which was found to be highest in Nonabokra (unpublished result). So, S80 fraction prepared from Nonabokra was used as the source of activator (kinase/phosphatase/any other organic compound). The transcription factor activation may be through phosphorylation directly to ABRE-binding factor or indirectly to another factor.Cloning and sequencing of the factor TRAB1, which interacts with the seed specific factor VP1 and ABRE was reported [25]. Since we do not have antibody against TRAB1 or VP1, we could not check the presence of TRAB1 or VP1 or their analogue in the EMSA complex. Therefore, the presence of TRAB1 factor in the EMSA complex cannot be ruled out. The activation of TRAB1 by phosphorylation [34] also suggests the mechanism of post-translational modification.The results of Northern blot consistently reported that Nonabokra plants have 4–5 times higher level of OSBZ8 transcript in comparison to M-1-48. These results strongly support our previous observation [27] that, in addition to induction by salinity stress at transcriptional level, mechanism of post-translational activation of OSBZ8 exists. Question, therefore, arises whether salinity stress inducible accumulation in salt sensitive rice cultivars and constitutive expression of OSBZ8 in salt tolerant rice cultivars indicates a positive role of OSBZ8 towards tolerance to salinity. The expression of Rab16A-one of the most common target genes of OSBZ8, correlates well with that of OSBZ8, i.e., its expression is also high (3 times) and constitutive in salt tolerant Nonabokra, and undetectable in case of M-I-48. Transport proteins like plasma membrane H+-ATPases involved in ion homeostasis are also constitutively expressed in tolerant or halophytes whereas inducible in salt sensitive cultivars [35].The presence of high level of OSBZ8 in salt tolerant rice cultivars in comparison to salt sensitive rice cultivars may be required for regulation of genes in lamina in ABA mediated pathway necessary to adjust against salinity or water stress. Overexpression of OSBZ8 in salt sensitive rice cultivar or down regulation of OSBZ8 in salt tolerant rice cultivars will answer whether OSBZ8 has any role in tolerance to salinity or water stress.
Conclusion
The results of the Northern blot and EMSA clearly shows that the level of expression of the bZIP factor OSBZ8 (both at the transcript and protein level) is in the following ratio: Nonabokra: Pokkali: M-I-48: IR-72 = 6: 4: 2: 1. The expression pattern of the target gene Rab also correlates well with the expression of OSBZ8. Thus, this study lays the foundation for overexpressing OSBZ8 in salt sensitive high yielding rice varieties, which would firmly establish the role of OSBZ8 in regulation of abiotic stress inducible gene expression in vegetative tissue of rice.
Methods
Plant material, growth conditions and stress treatments
Seeds of Oryza sativa L cv. M-I-48 and Pokkali were obtained from International Rice Research Institute (Manila, Philippines), and IR-72 and Nonabokra seeds were from Chinsura Rice Research Institute (West Bengal, India). Seeds were surface sterilized with 0.1% (w/v) HgCl2 for 10 min, rinsed thoroughly and imbibed in deionized water for 6 to 8 hr and spread over a sterile gauge soaked with sterile water in a Petridish and was kept in dark at 37°C for 3 days. The germinated seedlings were grown in presence of 0.25 X MS medium (Murashige and Skoog complete media, Sigma, St. Louis, USA) at 32°C at 16 hr light and 8 hr dark cycle in a growth chamber (NIPPON, LHP-100-RDS, Tokyo, Japan) for 10 days. Plants were then treated with 200 mM NaCl in fresh 0.25 X MS medium for 16 hr. Plants were washed thoroughly with deionized water and root, sheath and lamina were harvested; samples of equal fresh weight were frozen in liquid nitrogen and immediately homogenized for preparation of nuclei.
Isolation of total RNA, RT-PCR and Northern blot analysis
RNA was isolated from about 10 g of roots and lamina of control and salt treated 10-day-old seedlings of M-I-48, Nonabokra and Pokkali by GITC method [36]. RT was done using Superscript RT (Life technologies, USA) to produce 1st strand cDNA at 42°C for 50 min from PolyA+ RNA of Pokkali roots using oligo dT cellulose (Amersham Pharmacia Biotech, NJ, USA). PCR was done with OSBZ85 and OSBZ83 primers (Table 1) in two steps: First 10 cycles at 94°C for 1 min, 65°C for 2 min, 72°C for 2 min; followed by 20 cycles at 94°C for 1 min, 55°C for 2 min and 72°C for 2 min in a Thermocycler (Perkin Elmer, 2400, USA). The 1 kb product of OSBZ8 was purified through cartridge (Qiagen, Valencia, CA, USA), digested with Bgl II (Roche, Germany) and cloned into Bam HI site of pBSKS and sequenced with OSBZ85 and OSBZ85A primers. To amplify the 5'end unique region of OSBZ8, PCR was done with OSBZ85 and OSBZ83A primers, having an in-frame stop codon using pBSKS: OSBZ8 (full length) as template. After 30 cycles of PCR at 94°C for 1 min, 63°C for 1 min and 72°C for 1 min, the PCR product (OSBZ8p, 420 bp) was purified, cloned in pBluescript (Stratagene, La Jolla, CA, USA) and verified by sequencing. DNA-probe for Northern analysis was prepared from GC19, OSBZ8p and Rab16A full length using Prime It II Multiprime DNA labeling kit (Stratagene), [alpha-32P]dCTP (5000 Ci/mmole; JONAKI, BRIT, INDIA) and specific activity of 2 × 109 cpm/μg DNA was obtained. Total RNA (30 μg) from root of 10-day-old Pokkali seedlings and root and lamina of M-I-48 and Nonabokra were separated in 1.2% formaldehyde-agarose gel and Northern transfer was given to Hybond-XL membrane (Amersham Pharmacia Biotech) [31]. Hybridization was carried out for 36 hr at 42°C with either GC19 or OSBZ8p or RabFL probe in a solution containing 6X SSC, 0.5% (w/v) SDS, 5X Denhardt solution, 50% (v/v) formamide, 100 μg/ml sheared, denatured salmon sperm DNA and 10 % (w/v) Dextran Sulphate. Finally, the blots were washed with 2X SSC, 0.1% SDS, 1X SSC, 0.1% SDS, 0.5X SSC, 0.1% SDS at room temperature and at 42°C for 30 min. Autoradiogram was prepared by exposing a film (X-Omat, Kodak) to the semidried NYTRAN filter covered with Saran wrap for 50 hr at -70°C.
Table 1
Sequence of oligonucleotides used either to prepare double stranded DNA for EMSA or for RT-PCR and PCR:
Name
Sequence
Size
Use
1. ABRE5
5'AGCTTGCCGGACACGTGGCGCTCTAG3'
26 mer
Annealed with ABRE3 to form 1X ABRE used in EMSA as probe or competitor
Amplification of Rab16A promoter by PCR from genomic DNA
14. RAB3B
5'ATAGAGCTCTGGATCCTCAGTGCTGGCCGGGCAGCTT3'
37 mer
Amplification of Rab16A full length by PCR from genomic DNA
Preparation of nuclei, nuclear extracts and cytosolic fraction
Nuclei were prepared from equal amount of tissue from different rice cultivars (100 g lamina) according to [27]; except that the crude nuclear pellet was washed with washing buffer (25 mM Tris.Cl pH 7.5, 0.44 M sucrose, 10 mM MgCl2, 10 mM βME). Each pellet was resuspended in high salt buffer (2 ml/100 g fresh weight lamina), containing 100 mM KCl, 15 mM HEPES.KOH pH 7.6, 5 mM MgCl2, 1 mM EDTA pH 8.0, 1 mM DTT, 5 μg/ml leupeptin and lysed by incubating on ice for 45 min with vigorous shaking. 3 M KCl was added drop wise to a final concentration of 485 mM with occasional stirring of the tubes kept on ice. Then it was centrifuged for 20 min at 15,000 × g at 4°C. The final supernatant was dialyzed against 1000 volumes of dialysis buffer [27], centrifuged at 15,000 × g at 4°C, the sup was lyophilized at -50°C, aliquoted and kept at -70°C.For preparation of cytosolic fraction, roots from 72 hr grown seedlings were harvested and protein was homogenised in 1:4 extraction buffer (NIB, [27]). The homogenate was centrifuged at 15,000 × g for 20 min and the supernatant was ultracentrifuged at 80,000 × g for 30 minutes. The supernatant comprising of the cytosolic protein was termed as S80.
Preparation of [32P]-DNA-probe, non-radioactive DNA competitors and EMSA
Sequence of all primers used to prepare probe or competitor is given in Table 1. Twenty pmoles of each ABRE5 and ABRE3 oligo, containing the sequence of the EmIa [7], were labeled at the 5' termini by T4 Polynucleotide Kinase (New England Biolabs, MA, USA) using [gamma-32P]-ATP (100 μCi for each oligo of sp. activity 6000 Ci/mmole from JONAKI, BRIT, INDIA), by incubating at 37°C for 45 min. They were then heated to 68°C to inactivate the PNK, the two mixtures were mixed and again heated to 75–80°C for 10 min and allowed to cool slowly to room temperature so that the two oligos hybridize to make double stranded DNA probe. For preparation of competitor DNA, either 4X ABRE/4X DRE/2X ABRC was annealed with 17 LS and filled in by Klenow fragment of DNA polymerase I (Life Technologies) at 37°C. The filled-in products were individually cloned in Hind III and Bam HI site of pBSKS (Stratagene), purified from LMP agarose gel after restriction digestion with Hind III and Bam HI. For preparation of Rab16A probe for EMSA, the upstream region of Rab21 [now Rab16A, 21] was amplified by PCR from the genomic DNA of Nonabokra rice seedlings using gene specific primers Rab5 and Rab3A (Table 1). The 300 bp DNA product was cloned in pBluescript, verified by sequencing from one end, and purified from LMP agarose gel after restriction digestion with Hind III and Xba I. The purified insert was then dephosphorylated with Calf Intestinal Alkaline Phosphatase (Roche) followed by 5'-end labeling using T4 Polynucleotide kinase (NEB) and [gamma-32P] ATP (BRIT, JONAKI). All the probes were purified using Sephadex G-50 spin column (Roche) and incorporation was measured by Scintillation Counter (Beckman, CA, USA).EMSA was done [37] with equal amount of nuclear proteins (as measured by Bradford Reagent, BioRad, Hercules, CA, USA) from treated and untreated samples of four different rice cultivars. Nuclear extract (20 μg protein) was mixed with 2 μg poly (dI-dC), 80 mM MgCl2, 10 mM NaPi/1 mM EDTA (pH 8.0) and volume made to 20 μl with dialysis buffer. It was incubated on ice for 20 min, radioactive probe was added (80,000 cpm per reaction) and incubated at room temperature (25°C) for 20 min. Whenever necessary, the nuclear extract was preincubated with 100 to 250 fold molar excess of different non radioactive competitors for 20 min at room temperature before the addition of radioactive DNA probe. The DNA: protein complex was separated from free probe by carrying out electrophoresis in native 6% PAGE at constant 100 V for 4 hr for ABRE-probe, or in 4% native PAGE for 6 to 7 hr for Rab probe at room temperature. The gel was dried and X-Omat film (Kodak) was exposed for autoradiography for 24 hr. The autoradiograms were scanned by Gel-Doc 1000 (BioRad).
Supershift assay: EMSA with purified antibody
The nuclear extract was incubated with the purified antibody or preimmune serum before and after the addition of the probe i.e., pre and post-incubated for 45 min at R.T. and was separated by 6% native PAGE. In addition, concentration kinetics of the antibody was done [31].
Antibody production against partial OSBZ8
OSBZ8p (420 bp) was cloned into Bam HI-Eco RI sites of pGEX 3X (Amersham Pharmacia Biotech) and the recombinant clone was selected by transforming into E coli strain BL21. The GST fusion protein was purified using Glutathione-sepharose affinity resin (Amersham Pharmacia Biotech) following manufacturer's protocol. Minor contamination of other polypeptide was visible, therefore, a preparatory SDS-PAGE was done and the band of the fusion protein was cut from the unstained 12% SDS-PAGE, macerated in Downs' homogenizer with a little 1X Phosphate-buffered saline (PBS). The crushed gel slurry was injected into rabbit to raise polyclonal antibody against OSBZ8p following proper immunization schedule and antiserum was prepared [38].
Enrichment of the crude antiserum
The crude antiserum was incubated at 1 to 10 dilution several times with immunoblots (14 lanes, 40 μg protein per lane), with bacterial protein extract containing non-recombinant pGEX 3X induced by IPTG i.e., having the bands of E. coli protein and GST only. The enriched antiserum was used at 1 to 1000 dilution in immunoblot analysis and supershift assay.
Overproduction of full length OSBZ8
The sequence of the full length OSBZ8 cDNA has been reported to GenBank (Accession number AY606941). The cDNA (1083 bp), covering the entire coding sequence, was subcloned in pRSETA (Invitrogen) and 43-kD polypeptide was produced after 1 mM IPTG-mediated induction. The 6X His tagged protein was purified with Nickel-nitrilotriacetic acid agarose affinity resin (Qiagen) and concentrated using microcentrifuge filters (Whatman) and estimated by Bradford reagent (BioRad). Binding reactions were performed using 200 ng of semipurified protein.
KM designed and performed all gel shift experiments with ABRE probe, the cloning of OSBZ8 and raising of antibody and super-shift assay, and drafted the manuscript. ARC performed the gel shift experiments and Northern blot with Rab probe, BG performed the cloning, bacterial over-expression and purification of full length OSBZ8, and Northern blot of OSBZ8. SG performed the Northern blot of GC19. DNS participated in design of experiment, coordinated the study and helped to draft the manuscript. All authors read and approved the manuscript.
Authors: S Kawasaki; C Borchert; M Deyholos; H Wang; S Brazille; K Kawai; D Galbraith; H J Bohnert Journal: Plant Cell Date: 2001-04 Impact factor: 11.277
Authors: Clarisa E Alvarez; Mariana Saigo; Ezequiel Margarit; Carlos S Andreo; María F Drincovich Journal: Photosynth Res Date: 2013-05-07 Impact factor: 3.573
Authors: Showkat Ahmad Ganie; Kutubuddin Ali Molla; Robert J Henry; K V Bhat; Tapan Kumar Mondal Journal: Theor Appl Genet Date: 2019-02-13 Impact factor: 5.699