| Literature DB >> 16494745 |
Cédric Foucault1, Philippe Brouqui, Didier Raoult.
Abstract
Bartonella quintana, a pathogen that is restricted to human hosts and louse vectors, was first characterized as the agent of trench fever. The disease was described in 1915 on the basis of natural and experimental infections in soldiers. It is now recognized as a reemerging pathogen among homeless populations in cities in the United States and Europe and is responsible for a wide spectrum of conditions, including chronic bacteremia, endocarditis, and bacillary angiomatosis. Diagnosis is based on serologic analysis, culture, and molecular biology. Recent characterization of its genome allowed the development of modern diagnosis and typing methods. Guidelines for the treatment of B. quintana infections are presented.Entities:
Mesh:
Year: 2006 PMID: 16494745 PMCID: PMC3373112 DOI: 10.3201/eid1202.050874
Source DB: PubMed Journal: Emerg Infect Dis ISSN: 1080-6040 Impact factor: 6.883
Figure 1Pediculus humanus corporis, the human body louse, viewed with electron microscope at magnification ×120.
Figure 2Human body lice in clothes.
Figure 3Lesions from scratching induced by body lice infestation.
Figure 4Western blot and cross-adsorption results in a patient with Bartonella quintana endocarditis. A) Nonadsorbed. B) Adsorbed with B. quintana. C) Adsorbed with B. henselae. Lane 1, B. quintana; lane 2, B. henselae; lane 3, B. elizabethae; lane 4, B. vinsonii subsp. Berkhoffi; lane 5, B. vinsonii subsp. Arupensis. Before adsorption (A), antibodies are detected against all species (1, 2, 3, 4, and 5). After adsorption with B. quintana antigen (B), all antibodies disappear. After adsorption with B. henselae antigen (C), antibodies against B. quintana () persist. This reaction shows B. quintana infection.
Available primers for Bartonella spp. Amplification
| Microorganism | Gene | Direction* | Primer | Sequence |
|---|---|---|---|---|
| Bartonella clarridgeiae | ribC | F | PBC5 | TACATAACGAGCCAATT |
| B. clarridgeiae | ribC | R | PBC15 | TAGCTTTAGAACAATATGGT |
| B. henselae | ribC | F | PBH-L1 | GATATCGGTTGTGTTGAAGA |
| B. henselae | ribC | R | PBH-R1 | AATAAAAGGTATAAAACGCT |
| B. bacilliformis | ribC | F | PBH-L1 | GATATCGGTTGTGTTGAAGA |
| B. bacilliformis | ribC | R | PBB-R1 | AAAGGCGCTAACTGTTC |
| B. quintana | ribC | F | PBH-L1 | GATATCGGTTGTGTTGAAGA |
| B. quintana | ribC | R | PBQ-R1 | AAAGGGCGTGAATTTTG |
| All Bartonella | ribC | F | PBH3 | CCAAGTGCTACATAACCATC |
| All Bartonella | ribC | R | PBH4 | CGGGTTGTTATTGCTCTTAC |
| All (except B. bacilliformis) | 16s-23s spacer | F | 16SF | AGAGGCAGGCAACCACGGTA |
| All (except B. bacilliformis) | 16s-23s spacer | R | 23S1 | GCCAAGGCATCCACC |
| All Bartonella | 16s-23s spacer | F | QHVE1 | TTCAGATGATGATCCCAA |
| All Bartonella | 16s-23s spacer | R | QHVE2 | TTGGGATCATCATCTGAA |
| All Bartonella | 16s-23s spacer | F | QHVE3 | GATATATTCAGACATGTT |
| All Bartonella | 16s-23s spacer | R | QHVE4 | AACATGTCTGAATATATC |
| B. bacilliformis | 16s-23s spacer | F | BABF | CTGGATCACCTCCTTTCTAA |
| B. bacilliformis | 16s-23s spacer | R | BABR | ATGCCCTTAAGACACTTGAT |
| B. quintana | 16s-23s spacer | F | BQF | CTCCACCATTTTAGGTCATC |
| B. quintana | 16s-23s spacer | R | BQR | GGTTTTGAGAATTCCCTTGC |
| All Bartonella | 16s-23s spacer | F | 16s1 | (C/T)CTTCGTTTCTCTTTCTTCA |
| All Bartonella | 16s-23s spacer | R | 16s2 | GGATAAACCGGAAAACCTTC |
| All Bartonella | 16s-23s spacer | F | 16s3 | (C/T)CTTCGTTTCTCTTTCTTCA |
| All Bartonella | 16s-23s spacer | R | 16s4 | AACCAACTGAGCTACAAGCC |
| All Bartonella | 16s-23s spacer | F | 16s5 | CTCTTTCTTCAGATGATGATCC |
| All Bartonella | 16s-23s spacer | R | 16s6 | AACCAACTGAGCTACAAGCCCT |
| All Bartonella | ribC | F | BARTON-1F | TAACCGATATTGGTTGTGTTGAAG |
| All Bartonella | ribC | R | BARTON-2R | TAAAGCTAGAAAGTCTGGCAACATAACG |
| All Bartonella | 16s | S | probe | ATTTGGTTGGGCACTCTAGGGG |
| All Bartonella | 16s | Rp2a | ACGGCTACCTTGTTAGGACTT | |
| All Bartonella | 16s | F | 357f | TACGGGAGGCAGCAG |
| All Bartonella | 16s | R | 357ra | CTGCTGCCTCCCGTA |
| All Bartonella | 16s | F | 536F | CAGCAGCCGCGGTAATAC |
| All Bartonella | 16s | R | 536R | GTATTACCGCGGCTGCTG |
| All Bartonella | 16s | F | 800F | ATTAGATACCCTGGTAG |
| All Bartonella | 16s | R | 800R | CTACCAGGGTATCTAAT |
| All Bartonella | 16s | F | 1050F | TGTCGTCAGCTCGTG |
| All Bartonella | 16s | R | 1050R | CACGAGCTGACGACA |
| All Bartonella | 35KD | F | 35KD1fa | GTCGCTAAAGGCTGATGA |
| All Bartonella | 35KD | R | 35KD2ra | GACTGATATCGTGCGTGTG |
| All Bartonella | 35KD | F | 35KDs1f | GGTACGACGACAGTAATTGTT |
| All Bartonella | 35KD | R | 35KDs2r | GATTTAAGAGATACCAACCA |
| All Bartonella | PAP | F | PAP1fa | CTTTAATGACGACTTCTGTT |
| All Bartonella | PAP | R | PAP4ra | CCGAAATCTGAGTAACGGTA |
| All Bartonella | PAP | R | PAP2r | CCCTAAATGTTTCAAGTTCA |
| All Bartonella | PAP | F | PAP3f | GCTGACAGAGAAGACGCAA |
| All Bartonella | groEL | F | BbHs233.p | CGTGAAGTTGCCTCAAAAACC |
| All Bartonella | groEL | R | BbHs1630.n | AATCCATTCCGCCCATTC |
| All Bartonella | rpoB | F | QVE1 | TTCAGATGATGATCCCAAGC |
| All Bartonella | rpoB | R | QVE3 | AACATGTCTGAATATATCTTC |
| All Bartonella | Bfp1 | ATTAATCTGCAYCGGCCAGA | ||
| All Bartonella | Bfp2 | ACVGADACACGAATAACACC | ||
| All Bartonella | Bfs3 | TTACAAAAATCYGTTGATAC | ||
| All Bartonella | Bfs4 | GTATCAACRGATTTTTGTAA | ||
| All Bartonella | ftsZ | F | BaftsZF | GCTAATCGTATTCGCGAAGAA |
| All Bartonella | ftsZ | R | BaftsZR | GCTGGTATTTCCAAYTGATCT |
| B. henselae, B. clarridgeiae | ftsZ | BhftsZ 1393.n | GCGAACTACGGCTTACTTGC | |
| B. henselae, B. clarridgeiae | ftsZ | Bh ftsZ 1247.p | CGGTTGGAGAGCAGTTTCGTC | |
| B. quintana | ftsZ | F | Bq ftsZseqF | GCACATATTCTTGATGAGAT |
| B. quintana | ftsZ | R | Bq ftsZseqR | CCCCTATCATCTCATCAAG |
| B. bacilliformis | ftsZ | F | Bb ftsZseqF | GCGCATGTTCTTAGTGAAAT |
| B. bacilliformis | ftsZ | R | Bb ftsZseqR | CCTGTATACGTGATGCATTT |
| All Bartonella | ftsZ | FTS1p | GCCTTCTCATCCTCAACTT | |
| All Bartonella | ftsZ | FTS2p | CAGCCTCTTCACGATGTG | |
| All Bartonella | pap31 | PAPn1 | TTCTAGGAGTTGAAACCGAT | |
| All Bartonella | pap31 | PAPn2 | GAAACACCACCAGCAACATA | |
| All Bartonella | pap31 | PAPns2 | GCACCAGACCATTTTTCCTT | |
| All Bartonella | pap31 | PAPns1 | CAGAGAAGACGCAAAAACCT | |
| All Bartonella | groEL | HSPps1 | CAGAAGTTGAAGTGAAAGAAAA | |
| All Bartonella | groEL | HSPps2 | GCNGCTTCTTCACCNGCATT | |
| All Bartonella | groEL | HSPps4 | GCTGGNGGTGTTGCNGTTA | |
| All Bartonella | groEL | HSPps3 | GCTGTNGAAGANGGNATTGT |
*F, forward; R, reverse.
Figure 5Immunohistochemical demonstration of Bartonella sp. in a cardiac valve of a patient with endocarditis. Magnification ×400.
Figure 6Laser confocal microscopy showing the intraerythrocytic location of Bartonella quintana. Magnification ×400.