| Literature DB >> 16318732 |
Anna Salim1, Ruiting Lan, Peter R Reeves.
Abstract
We resolved the relationships between 2 pandemic clones of Vibrio cholerae. Using 26 housekeeping genes, we showed that the US Gulf clone, the Australian clone, and 3 El Tor strains isolated before the seventh pandemic were related to the seventh pandemic clone. The sixth pandemic clone was well separated from them.Entities:
Mesh:
Substances:
Year: 2005 PMID: 16318732 PMCID: PMC3367346 DOI: 10.3201/eid1111.041170
Source DB: PubMed Journal: Emerg Infect Dis ISSN: 1080-6040 Impact factor: 6.883
Chromosomal location of 26 genes of Vibrio cholerae and primers used*
| Gene | Chromosomal location† (kb) | Forward primer | Sequence (5´→3´) | Position‡ | Reverse primer | Sequence (5´→3´) | Position§ | Amplicon size, bp |
|---|---|---|---|---|---|---|---|---|
|
| 11 | 4876 | TGGTTTTTGAGGTGGTGGAT | 116 | 4877 | CGCTTGATTCTTACGGTTAC | 1330 | 1,214 |
|
| 141 | 4968 | GAAAAAGAGAGCAGTGTAGG | 106 | 4969 | CGTCCCACTTCATAAGGCAC | 1131 | 1,025 |
|
| 280 | 4970 | TCAGCGTATCAGATAAAACC | 35 | 4971 | CTTGCCATTCACCACACTCC | 1118 | 1,083 |
|
| 314 | 4972 | GCCGTTTCTTCACCCTTGTA | 10 | 4973 | GGATTTTTTGCCAGCCATTC | 1416 | 1,406 |
|
| 732 | 4974 | ATGAGCAAACCAATGAAAAT | 1 | 4975 | TTAGGCACTTCAAAGAACAT | 936 | 935 |
|
| 1050 | 4873 | CATCATTCTTCTCGGTGCTC | 6 | 4967 | CACTCACTTCGCTCACTTGC | 620 | 614 |
|
| 1102 | 4878 | CTGAACCCCGAAAAAGATAG | 31 | 4879 | CTGTGGAAATAAACGATGTC | 1050 | 1,019 |
|
| 1209 | 4965 | TTCATTACTGCCGATTATTC | 66 | 4966 | TTTGGTGTCTTTCTGCTTAC | 1129 | 1,063 |
|
| 1602 | 5054 | CACACCTCAAGCCAAATACC | 9 | 5055 | GTACAGCTTCATGCCACGTT | 1219 | 1,210 |
|
| 1684 | 4874 | TTATCAAGCACAAACTCAAC | 66 | 4875 | TCACAGGCAGCATCACATTA | 1079 | 1,013 |
|
| 1835 | 4987 | TTGCTCTTGAAAAATACTGG | 59 | 4988 | GAGAAGACTTACGCGCAACA | 1169 | 1,110 |
|
| 2038 | 4989 | TTGAGGATTGTTGTTGTGAC | 1 | 4990 | GTTTTAATCATGCCGTGCAG | 1242 | 1,241 |
|
| 2177 | 5009 | ATTTAACCGTTGCACTTGAT | 8 | 5010 | GGCTGGGTACTTGTCGTTTC | 980 | 972 |
|
| 2380 | 4991 | GTGAGCGGTAATAATCCATC | 1 | 4992 | GCTTCGTTGCTATTGGCGGC | 1023 | 1,022 |
|
| 2557 | 4993 | CAGATGGTATTTCCGTCGGT | 65 | 4994 | AAAGTGGTCAAACAGCGGTG | 1111 | 1,046 |
|
| 2627 | 4995 | GCGGGGTTGTATCCTCTCTA | 29 | 4996 | TATTTGGTGTTTTTATTGAA | 1230 | 1,201 |
| 12 | 5056 | GAAACCTACTCAACAGAAAC | 3 | 5057 | CAGAGTGTGGTTGGTGTAAG | 1090 | 1,087 | |
| 105 | 4999 | GTTTTCTCCCCACATCATTC | 15 | 5000 | TTCACACATGGCTTTTTCCG | 1189 | 1,174 | |
| 202 | 5001 | TGCTCACCCAAGAACACATC | 2 | 5002 | CGGACCACACAAATAGAA AT | 1081 | 1,079 | |
| 296 | 5003 | ACACCCGCCAAAATGAACAG | 110 | 5004 | CATAGGCTTCTCTTCGTCAA | 1111 | 1,001 | |
| 446 | 5005 | TAACGGGCAGTGTAAACCAG | 47 | 5006 | GCGGATACTTGAATTTGTTG | 930 | 883 | |
| 500 | 5049 | AGAACAACTCGCTGGTGAAA | 21 | 5050 | ATGCCCCTACTACAATGATG | 1409 | 1,388 | |
| 602 | 4976 | AAGGGGAAAGTTATGCTCTC | 49 | 4977 | CATTTGCTGGTGCGCTTGAG | 1308 | 1,259 | |
| 761 | 5058 | TAATCCTCTCTGTTTTTGTG | 47 | 5059 | TGTTTTTCAGTAGCATTGGC | 1214 | 1,167 | |
| 878 | 5013 | TGACAACACTGACGATTACA | 26 | 5014 | TTGCGAGGTAGGCCGTAGAA | 936 | 910 | |
| 977 | 5060 | GTCAACGCCTTTCCCATTAG | 15 | 5061 | TTCGGCAATCAGCTTTACTT | 1051 | 1,036 |
*The annealing temperatures were 55–62°C for primers for gyrB and pepN and 55°C for the remaining primers. †Location of each gene on the 2 chromosomes (large and small chromosomes) of V. cholerae isolate N16961. ‡Position of the first base of the forward primer relative to the first base of the start codon. §Position of the first base of the reverse primer relative to the first base of the start codon. ¶Genes on the small chromosome of V. cholerae isolate N16961.
Isolates of Vibrio cholerae tested
| Original name | Laboratory name | Clone/isolate | Year isolated | Location | Source* | Serogroup | Biotype |
|---|---|---|---|---|---|---|---|
| #75 | M967 | 6th pandemic | 1921 | Japan | CDC | O1 | Classical |
| 395 | M1616 | 6th pandemic | 1965 | India | CVD | O1 | Classical |
| E506 | M794 | US Gulf Coast | 1974 | Texas, USA | CVD | O1 | El Tor |
| 4808 | M796 | US Gulf Coast | 1978 | Louisiana, USA | CVD | O1 | El Tor |
| NCTC 9420 | M640 | Pre-7th pandemic | 1954 | Cairo, Egypt | NCTC | O1 | El Tor |
| NCTC 5395 | M543 | Pre-7th pandemic | 1938 | Baghdad, Iraq | NICED | O1 | El Tor |
| 66-2 (Makassar 759) | M802 | Pre-7th pandemic | 1937 | Sulawesi, Indonesia | IP | O1 | El Tor |
| SIMP/77 | M2140 | Australian | 1977 | Australia | QH | O1 | El Tor |
| M4287/77 | M2141 | Australian | 1977 | Australia | QH | O1 | El Tor |
| 2100 | M663 | 7th pandemic | 1992 | Bali, Indonesia | IMVS | O1 | El Tor |
| E9120 | M793 | 7th pandemic | 1961 | Indonesia | CVD | O1 | El Tor |
| N16961† | 7th pandemic | 1971 | Bangladesh | GenBank | O1 | El Tor | |
| 1085-93 | M549 | Environmental | 1993 | Germany | NIHJ | O37 | |
| 141-94 | M553 | Environmental | 1994 | Germany | NIHJ | O70 | |
| 905-93 | M555 | Environmental | 1993 | Argentina | NIHJ | O97 | |
| 928-93 | M557 | Environmental | 1993 | Argentina | NIHJ | O6 | |
| 370-94 | M563 | Environmental | 1994 | South Korea | NIHJ | O81 |
*CDC, Centers for Disease Control and Prevention; CVD, Centre for Vaccine Development (Dr James Kaper); NCTC, National Collection of Type Cultures; NICED, National Institute for Cholera and Enteric Diseases; IP, Institute Pasteur (Dr A. Dodin); QH, Queensland Health (Dr Denise Murphy); IMVS, Institute of Medical and Veterinary Science; NIHJ, National Institute of Health, Japan (Dr Tohio Shimada). †Sequence of the genome of isolate N16961 was used. GenBank accession numbers for chromosomes 1 and 2 are AE003852 and AE003853, respectively.
Figure 1Distribution of base differences in strains of Vibrio cholerae. The base positions relative to the start of the ATG codon are shown. Isolates 395 and E9120 were compared for the fruK, lytB, metE, pepN, pyrG, fumC, malP, metG, pyrC, and sdaA genes, and isolates 395 and E506 were compared for the gyrB gene.
Figure 2Relationships of toxigenic Vibrio cholerae isolates. The mutational (m) and recombinational (r) changes are given equal weight. Shown is a unique (unrooted) tree, with the events indicated on the branches.