Literature DB >> 16318732

Vibrio cholerae pathogenic clones.

Anna Salim1, Ruiting Lan, Peter R Reeves.   

Abstract

We resolved the relationships between 2 pandemic clones of Vibrio cholerae. Using 26 housekeeping genes, we showed that the US Gulf clone, the Australian clone, and 3 El Tor strains isolated before the seventh pandemic were related to the seventh pandemic clone. The sixth pandemic clone was well separated from them.

Entities:  

Mesh:

Substances:

Year:  2005        PMID: 16318732      PMCID: PMC3367346          DOI: 10.3201/eid1111.041170

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Cholera caused by Vibrio cholerae is a major disease that has caused great fear since the first recorded pandemic in 1817 because of the frequency of death and the rapidity with which it occurs (,). Approximately 200 O antigens have been distinguished serologically (,), but only O1 and O139 have been found in epidemic and pandemic cholera isolates (,). The seventh pandemic (1961–present) is still widespread and has a severe impact on 3 continents. The sixth pandemic ended in 1923, but the clone persisted at least until the 1990s (). Furthermore, several cholera outbreaks were reported after the sixth pandemic retreated but before the start of the seventh pandemic. Isolates from these outbreaks were recognized as different from those of the sixth pandemic and were allocated to the El Tor biotype, while the sixth and fifth pandemics, both of which had been studied microbiologically, were referred to as the classical biotype. These El Tor outbreaks occurred in Indonesia and the Middle East (1926–1960) () and are often referred to as prepandemic isolates because they were later seen as forerunners of the seventh pandemic, which was also of the El Tor biotype. However, now that environmental V. cholerae has been studied in some detail, major components of the El Tor phenotype are known to be present in most environmental isolates, and the classical biotype is believed to have arisen by loss of characters otherwise widely present in the species (). Also, cases of sporadic indigenous cholera have been detected in Australia () and the United States (), both of the O1 El Tor biotype. These are generally referred to as the US Gulf and Australian clones. All of the pathogenic forms discussed above had the O1 serotype, but in 1992 a variant of the seventh pandemic appeared with a new O antigen, O139; this variant is known as V. cholerae O139 Bengal (). The relationships of V. cholerae have been studied in several ways, but the most useful insights have come from multilocus enzyme electrophoresis () and more recently by multilocus sequence analyses (,,). In this study, we sequenced 26 housekeeping genes from V. cholerae isolates representative of the sixth and seventh pandemic clones and other closely related toxigenic strains to determine relationships to better understand the origins of pandemic clones.

The Study

Twenty-six housekeeping genes distributed evenly on both chromosomes (Table A1) were studied by using 5 nontoxigenic environmental isolates and 12 toxigenic V. cholerae isolates, which comprise 5 sixth and seventh pandemic isolates and 7 pathogenic isolates related to them (Table). One of the 3 seventh pandemic isolates is N16961; the sequence of its genome () was used in this study. All 26 housekeeping genes were successfully sequenced from the remaining 11 toxigenic isolates. However, 4 genes could not be amplified by polymerase chain reaction from 1 of the environmental isolates (sdaA for 370-94, hmpA for 905-93, glgX for 928-93, and pepN for 370-94) and were not sequenced. The GenBank accession numbers for the nucleotide sequences determined in this study are DQ020969–DQ021380.
Table A1

Chromosomal location of 26 genes of Vibrio cholerae and primers used*

GeneChromosomal location† (kb)Forward primerSequence (5´→3´)Position‡Reverse primerSequence (5´→3´)Position§Amplicon size, bp
gyrB 114876TGGTTTTTGAGGTGGTGGAT1164877CGCTTGATTCTTACGGTTAC13301,214
udhA 1414968GAAAAAGAGAGCAGTGTAGG1064969CGTCCCACTTCATAAGGCAC11311,025
purH 2804970TCAGCGTATCAGATAAAACC354971CTTGCCATTCACCACACTCC11181,083
gppA 3144972GCCGTTTCTTCACCCTTGTA104973GGATTTTTTGCCAGCCATTC14161,406
lytB 7324974ATGAGCAAACCAATGAAAAT14975TTAGGCACTTCAAAGAACAT936935
adk 10504873CATCATTCTTCTCGGTGCTC64967CACTCACTTCGCTCACTTGC620614
metG 11024878CTGAACCCCGAAAAAGATAG314879CTGTGGAAATAAACGATGTC10501,019
icd 12094965TTCATTACTGCCGATTATTC664966TTTGGTGTCTTTCTGCTTAC11291,063
pepN 16025054CACACCTCAAGCCAAATACC95055GTACAGCTTCATGCCACGTT12191,210
fumC 16844874TTATCAAGCACAAACTCAAC664875TCACAGGCAGCATCACATTA10791,013
metE 18354987TTGCTCTTGAAAAATACTGG594988GAGAAGACTTACGCGCAACA11691,110
ndh 20384989TTGAGGATTGTTGTTGTGAC14990GTTTTAATCATGCCGTGCAG12421,241
plsX 21775009ATTTAACCGTTGCACTTGAT85010GGCTGGGTACTTGTCGTTTC980972
purM 23804991GTGAGCGGTAATAATCCATC14992GCTTCGTTGCTATTGGCGGC10231,022
carA 25574993CAGATGGTATTTCCGTCGGT654994AAAGTGGTCAAACAGCGGTG11111,046
pyrG 26274995GCGGGGTTGTATCCTCTCTA294996TATTTGGTGTTTTTATTGAA12301,201
malP125056GAAACCTACTCAACAGAAAC35057CAGAGTGTGGTTGGTGTAAG10901,087
pncB1054999GTTTTCTCCCCACATCATTC155000TTCACACATGGCTTTTTCCG11891,174
hmpA2025001TGCTCACCCAAGAACACATC25002CGGACCACACAAATAGAA AT10811,079
glyA2965003ACACCCGCCAAAATGAACAG1105004CATAGGCTTCTCTTCGTCAA11111,001
fruK4465005TAACGGGCAGTGTAAACCAG475006GCGGATACTTGAATTTGTTG930883
pntA5005049AGAACAACTCGCTGGTGAAA215050ATGCCCCTACTACAATGATG14091,388
sdaA6024976AAGGGGAAAGTTATGCTCTC494977CATTTGCTGGTGCGCTTGAG13081,259
speA7615058TAATCCTCTCTGTTTTTGTG475059TGTTTTTCAGTAGCATTGGC12141,167
pyrC8785013TGACAACACTGACGATTACA265014TTGCGAGGTAGGCCGTAGAA936910
glgX9775060GTCAACGCCTTTCCCATTAG155061TTCGGCAATCAGCTTTACTT10511,036

*The annealing temperatures were 55–62°C for primers for gyrB and pepN and 55°C for the remaining primers.
†Location of each gene on the 2 chromosomes (large and small chromosomes) of V. cholerae isolate N16961.
‡Position of the first base of the forward primer relative to the first base of the start codon.
§Position of the first base of the reverse primer relative to the first base of the start codon.
¶Genes on the small chromosome of V. cholerae isolate N16961.

Table

Isolates of Vibrio cholerae tested

Original nameLaboratory nameClone/isolateYear isolatedLocationSource*SerogroupBiotype
#75M9676th pandemic1921JapanCDCO1Classical
395M16166th pandemic1965IndiaCVDO1Classical
E506M794US Gulf Coast1974Texas, USACVDO1El Tor
4808M796US Gulf Coast1978Louisiana, USACVDO1El Tor
NCTC 9420M640Pre-7th pandemic1954Cairo, EgyptNCTCO1El Tor
NCTC 5395M543Pre-7th pandemic1938Baghdad, IraqNICEDO1El Tor
66-2 (Makassar 759)M802Pre-7th pandemic1937Sulawesi, IndonesiaIPO1El Tor
SIMP/77M2140Australian1977AustraliaQHO1El Tor
M4287/77M2141Australian1977AustraliaQHO1El Tor
2100M6637th pandemic1992Bali, IndonesiaIMVSO1El Tor
E9120M7937th pandemic1961IndonesiaCVDO1El Tor
N16961†7th pandemic1971BangladeshGenBankO1El Tor
1085-93M549Environmental1993GermanyNIHJO37
141-94M553Environmental1994GermanyNIHJO70
905-93M555Environmental1993ArgentinaNIHJO97
928-93M557Environmental1993ArgentinaNIHJO6
370-94M563Environmental1994South KoreaNIHJO81

*CDC, Centers for Disease Control and Prevention; CVD, Centre for Vaccine Development (Dr James Kaper); NCTC, National Collection of Type Cultures; NICED, National Institute for Cholera and Enteric Diseases; IP, Institute Pasteur (Dr A. Dodin); QH, Queensland Health (Dr Denise Murphy); IMVS, Institute of Medical and Veterinary Science; NIHJ, National Institute of Health, Japan (Dr Tohio Shimada).
†Sequence of the genome of isolate N16961 was used. GenBank accession numbers for chromosomes 1 and 2 are AE003852 and AE003853, respectively.

The 5 nontoxigenic environmental isolates had different sequences for each gene. These sequences were not found in any of the 12 toxigenic isolates. The average pairwise difference among the 5 environmental isolates in the 22 genes sequenced ranged from 0.67% to 5.29%, an indication that V. cholerae as a species has a high level of sequence variation. However 11 of the 26 housekeeping genes (glyA, gppA, pntA, icd, purM, plsX, ndh, glgX, adk, carA, and speA) were identical in all toxigenic V. cholerae isolates, confirming that they are closely related. There were 18 mutation/recombination events among the 15 genes with sequence variation in the 12 toxigenic isolates. Three (malP, pyrC, and gyrB) of these genes had undergone 2 changes. Seven cases of single base differences, which are attributed to mutation, were clearly distinct from 11 cases of multiple base differences, which are attributed to recombination. Ten of the events attributed to recombination involve changes in 10 to 51 bases (Figure 1). The metG gene, in which the 2 sequences differ by only 4 bases, might have undergone 4 mutational events rather than a single recombination event, but we considered this to be most unlikely.
Figure 1

Distribution of base differences in strains of Vibrio cholerae. The base positions relative to the start of the ATG codon are shown. Isolates 395 and E9120 were compared for the fruK, lytB, metE, pepN, pyrG, fumC, malP, metG, pyrC, and sdaA genes, and isolates 395 and E506 were compared for the gyrB gene.

Distribution of base differences in strains of Vibrio cholerae. The base positions relative to the start of the ATG codon are shown. Isolates 395 and E9120 were compared for the fruK, lytB, metE, pepN, pyrG, fumC, malP, metG, pyrC, and sdaA genes, and isolates 395 and E506 were compared for the gyrB gene. Some of the 11 genes believed to have undergone recombination may have undergone >1 recombination event. This possibility is likely because 11 of 26 genes have undergone recombination. For example, in metE the base changes are at the 2 ends and may represent 2 recombination events; the same applies, to a lesser extent, to malP. With regard to the length of DNA involved in recombination events, segments longer than a gene are most common because only in the genes discussed above and in sdaA and gyrB are the bases that differed clustered within the gene. This is suggestive of recombination within that gene. The sequences for the 26 genes were used to produce a tree with mutational and recombinational events and given equal weight, which is shown in Figure 2. By sequencing 26 genes, we have observed sufficient variation to determine the relationships of the isolates studied. The tree is unrooted because the environmental isolates share no alleles with each other or toxigenic isolates. The relatively high rate of recombination in V. cholerae means that the level of sequence similarity does not indicate relatedness of the isolates unless the sequences are very similar and differences can be attributed to mutation, as in the toxigenic strains. However, other reasons exist for believing that the root is on the long 10-event branch that includes 2 mutational changes. The 10 El Tor isolates on 1 end are, at most, 3 steps from it and the 2 classical sixth pandemic isolates are separated by 1 event. The isolates date from 1937 to 1992 for the former group and from 1921 to 1965 for the latter group. Since 1 group giving rise to the other while undergoing little divergence itself is highly improbable, we believe that the root lies somewhere on that branch. The properties that characterize the El Tor biotype are those of environmental strains, which makes it unlikely that they are derived from the sixth pandemic, and the reverse seems even less likely because the fifth pandemic was also the classical biotype. We therefore treat the tree as being rooted on the long branch, which enables us to follow the sequence of events.
Figure 2

Relationships of toxigenic Vibrio cholerae isolates. The mutational (m) and recombinational (r) changes are given equal weight. Shown is a unique (unrooted) tree, with the events indicated on the branches.

Relationships of toxigenic Vibrio cholerae isolates. The mutational (m) and recombinational (r) changes are given equal weight. Shown is a unique (unrooted) tree, with the events indicated on the branches. Among the El Tor isolates, the Australian clone is the most closely related of the current clones to the seventh pandemic clone, with 1 and 2 events along the 2 branches separating them. The Australian clone, although not discovered until 1977, must have arisen before the seventh pandemic and spread to Australia. The prepandemic outbreak isolates are located separately among the surviving El Tor pathogenic clones, with the 1937 Indonesian 66-2 (Makassar 759) isolate located closest to the seventh pandemic clone. The US Gulf clone diverged before the Australian clone and the seventh pandemic clones diverged, with a single recombination event on the branch to the common ancestor of the Australian and the seventh pandemic clones. The 2 sixth pandemic isolates are well separated from the other strains, differing from them at 10 loci, an average of 5 events per branch. These include recombination events affecting 8 genes. If representative, ≈30% of the genes have undergone recombination during divergence of the sixth pandemic clone and the El Tor group of pathogenic clones that includes the seventh pandemic clone. The extensive divergence between the sixth pandemic and other toxigenic isolates studied indicates a long period since divergence from the common ancestor, which presumably occurred well before the sixth pandemic (1899–1923). In the absence of any intermediates, we cannot allocate individual events to either branch but presume that each is equally likely to have occurred on either branch.

Conclusions

This study using sequences of 26 genes has resolved the evolutionary relationship of the 2 major pandemic clones of V. cholerae and the relationships of the seventh pandemic clone to other pathogenic El Tor clones and isolates. With the relationships established it is clear that study of the prepandemic isolates and Australian clone in particular could illuminate the events involved in the emergence of the current seventh pandemic clone from this lineage.
  11 in total

Review 1.  Cholera in the 1990s.

Authors:  P R Reeves; R Lan
Journal:  Br Med Bull       Date:  1998       Impact factor: 4.291

2.  Genomic relatedness of the new Matlab variants of Vibrio cholerae O1 to the classical and El Tor biotypes as determined by pulsed-field gel electrophoresis.

Authors:  Ashrafus Safa; Nurul Amin Bhuiyan; Munirul Alam; David A Sack; G Balakrish Nair
Journal:  J Clin Microbiol       Date:  2005-03       Impact factor: 5.948

3.  Allelic diversity and population structure in Vibrio cholerae O139 Bengal based on nucleotide sequence analysis.

Authors:  M Farfán; D Miñana-Galbis; M C Fusté; J G Lorén
Journal:  J Bacteriol       Date:  2002-03       Impact factor: 3.490

4.  Cholera: calamitous past, ominous future.

Authors:  S W Lacey
Journal:  Clin Infect Dis       Date:  1995-05       Impact factor: 9.079

5.  An epidemiological study of Vibrio cholerae O1 in the Australian environment based on rRNA gene polymorphisms.

Authors:  P M Desmarchelier; F Y Wong; K Mallard
Journal:  Epidemiol Infect       Date:  1995-12       Impact factor: 2.451

6.  Outbreak of Vibrio cholerae non-O1 in India and Bangladesh.

Authors:  M K Bhattacharya; S K Bhattacharya; S Garg; P K Saha; D Dutta; G B Nair; B C Deb; K P Das
Journal:  Lancet       Date:  1993-05-22       Impact factor: 79.321

7.  Cholera on a Gulf Coast oil rig.

Authors:  J M Johnston; D L Martin; J Perdue; L M McFarland; C T Caraway; E C Lippy; P A Blake
Journal:  N Engl J Med       Date:  1983-09-01       Impact factor: 91.245

8.  Evolutionary relationships of pathogenic clones of Vibrio cholerae by sequence analysis of four housekeeping genes.

Authors:  R Byun; L D Elbourne; R Lan; P R Reeves
Journal:  Infect Immun       Date:  1999-03       Impact factor: 3.441

9.  Multilocus sequence typing has better discriminatory ability for typing Vibrio cholerae than does pulsed-field gel electrophoresis and provides a measure of phylogenetic relatedness.

Authors:  Mamuka Kotetishvili; O Colin Stine; Yuansha Chen; Arnold Kreger; Alexander Sulakvelidze; Shanmuga Sozhamannan; J Glenn Morris
Journal:  J Clin Microbiol       Date:  2003-05       Impact factor: 5.948

10.  DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae.

Authors:  J F Heidelberg; J A Eisen; W C Nelson; R A Clayton; M L Gwinn; R J Dodson; D H Haft; E K Hickey; J D Peterson; L Umayam; S R Gill; K E Nelson; T D Read; H Tettelin; D Richardson; M D Ermolaeva; J Vamathevan; S Bass; H Qin; I Dragoi; P Sellers; L McDonald; T Utterback; R D Fleishmann; W C Nierman; O White; S L Salzberg; H O Smith; R R Colwell; J J Mekalanos; J C Venter; C M Fraser
Journal:  Nature       Date:  2000-08-03       Impact factor: 49.962

View more
  25 in total

1.  Recombination shapes the structure of an environmental Vibrio cholerae population.

Authors:  Daniel P Keymer; Alexandria B Boehm
Journal:  Appl Environ Microbiol       Date:  2010-11-12       Impact factor: 4.792

2.  Clonal relationship among Vibrio cholerae O1 El Tor strains causing the largest cholera epidemic in Kenya in the late 1990s.

Authors:  M Scrascia; F Maimone; K A Mohamud; S F Materu; F Grimont; P A D Grimont; C Pazzani
Journal:  J Clin Microbiol       Date:  2006-09       Impact factor: 5.948

Review 3.  Circulation and transmission of clones of Vibrio cholerae during cholera outbreaks.

Authors:  O Colin Stine; J Glenn Morris
Journal:  Curr Top Microbiol Immunol       Date:  2014       Impact factor: 4.291

4.  Origins of the current seventh cholera pandemic.

Authors:  Dalong Hu; Bin Liu; Lu Feng; Peng Ding; Xi Guo; Min Wang; Boyang Cao; Peter R Reeves; Lei Wang
Journal:  Proc Natl Acad Sci U S A       Date:  2016-11-14       Impact factor: 11.205

5.  Disarming bacterial virulence through chemical inhibition of the DNA binding domain of an AraC-like transcriptional activator protein.

Authors:  Ji Yang; Dianna M Hocking; Catherine Cheng; Con Dogovski; Matthew A Perugini; Jessica K Holien; Michael W Parker; Elizabeth L Hartland; Marija Tauschek; Roy M Robins-Browne
Journal:  J Biol Chem       Date:  2013-09-09       Impact factor: 5.157

6.  Population Structure and Multidrug Resistance of Non-O1/Non-O139 Vibrio cholerae in Freshwater Rivers in Zhejiang, China.

Authors:  Yun Luo; Henghui Wang; Jie Liang; Huiqin Qian; Julian Ye; Lixia Chen; Xianqing Yang; Zhongwen Chen; Fei Wang; Sophie Octavia; Michael Payne; Xiaojun Song; Jianmin Jiang; Dazhi Jin; Ruiting Lan
Journal:  Microb Ecol       Date:  2021-01-07       Impact factor: 4.552

7.  Intestinal ameliorative effects of traditional Ogi-tutu, Vernonia amygdalina and Psidium guajava in mice infected with Vibrio cholera.

Authors:  Olufunke B Shittu; Olusola L Ajayi; Samuel O Bankole; Temitope Os Popoola
Journal:  Afr Health Sci       Date:  2016-06       Impact factor: 0.927

8.  Assessing clonal correlation of epidemic Vibrio cholerae isolates during 2011 in 16 provinces of Iran.

Authors:  Massoud Hajia; Mohamad Rahbar; Marjan Rahnamye Farzami; Hossein Masoumi Asl; Alireza Dolatyar; Mohsen Imani; Roghieh Saburian; Moharam Mafi; Bita Bakhshi
Journal:  Curr Microbiol       Date:  2014-11-26       Impact factor: 2.188

9.  Genetic relatedness of selected clinical and environmental non-O1/O139 Vibrio cholerae.

Authors:  Antonina Aydanian; Li Tang; Yuansha Chen; J Glenn Morris; Peter Olsen; Judith A Johnson; G Balakrish Nair; O Colin Stine
Journal:  Int J Infect Dis       Date:  2015-07-08       Impact factor: 3.623

10.  A Vibrio cholerae Core Genome Multilocus Sequence Typing Scheme To Facilitate the Epidemiological Study of Cholera.

Authors:  Kevin Y H Liang; Fabini D Orata; Mohammad Tarequl Islam; Tania Nasreen; Munirul Alam; Cheryl L Tarr; Yann F Boucher
Journal:  J Bacteriol       Date:  2020-11-19       Impact factor: 3.490

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.