Literature DB >> 16102309

Coxiella burnetii genotyping.

Olga Glazunova1, Véronique Roux, Olga Freylikman, Zuzana Sekeyova, Ghislain Fournous, Judith Tyczka, Nikolai Tokarevich, Elena Kovacava, Thomas J Marrie, Didier Raoult.   

Abstract

Coxiella burnetii is a strict intracellular bacterium with potential as a bioterrorism agent. To characterize different isolates of C. burnetii at the molecular level, we performed multispacer sequence typing (MST). MST is based on intergenic region sequencing. These regions are potentially variable since they are subject to lower selection pressure than the adjacent genes. We screened 68 spacers in 14 isolates and selected the 10 that exhibited the most variation. These spacers were then tested in 159 additional isolates obtained from different geographic areas or different hosts or were implicated in different manifestations of human disease caused by C. burnetii. The sequence analysis yielded 30 different allelic combinations. Phylogenic analysis showed 3 major clusters. MST allows easy comparison and exchange of results obtained in different laboratories and could be a useful tool for identifying bacterial strains.

Entities:  

Mesh:

Substances:

Year:  2005        PMID: 16102309      PMCID: PMC3320512          DOI: 10.3201/eid1108.041354

Source DB:  PubMed          Journal:  Emerg Infect Dis        ISSN: 1080-6040            Impact factor:   6.883


Coxiella burnetii is a strict intracellular microorganism, included in the γ subdivision of the Proteobacteria phylum (1). It is found in close association with arthropod and vertebrate hosts, and it causes Q fever in humans and animals. Cattle, goats, and sheep are the primary reservoirs of human infection. In humans, the disease may appear in 2 forms, acute and chronic (2). Acute Q fever may be asymptomatic or appear as atypical pneumonia, granulomatous hepatitis, or self-limited febrile illness. In some persons, the immune system is unable to control the infection and chronic Q fever occurs. The manifestations of chronic Q fever are endocarditis, hepatitis, osteomyelitis, or infected aortic aneurysms. C. burnetii is highly infectious by the aerosol route and can survive for long periods in the environment. Previous studies have shown that C. burnetii isolates differed respect to their plasmid type (QpH1, QpRS, QpDG, and QpDV) (3–6), lipopolysaccharide profiles (7), and analysis of endonuclease-digested DNA separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (8) or pulsed-field gel electrophoresis (PFGE) (9–11). Differentiation was also obtained by sequence determination of the isocitrate dehydrogenase gene (12), com1 gene, and mucZ gene, which was renamed djlA when the whole genome of C. burnetii was sequenced (13,14). Several other methods have been used to type different isolates of the same species, in particular, multilocus enzyme electrophoresis (15) and multilocus sequence typing (MLST) (16). Many bacterial species have been studied by using these approaches (17–19). Recently, the whole genome of the C. burnetii Nine Mile strain was sequenced (14). We decided to investigate parts of the genome located between 2 open reading frames (ORFs) because they are considered potentially variable since they are subject to lower selection pressure than the adjacent genes. The 16S/23S ribosomal spacer region has been widely used to genotype bacteria (20–23). We investigated the utility of multispacer sequence typing (MST) with 173 C. burnetii isolates. After screening, we selected 10 variable spacers and showed that the combination of the different sequences allowed us to characterize 30 different genotypes. Phylogenetic analysis inferred from compiled sequences characterized 3 monophyletic groups, which could be subdivided into different clusters.

Methods

Bacterial Strains

The C. burnetii strains included in this study are listed in Table A1. All the strains were propagated on Vero cell monolayers (ATCC CRL 1587). Minimal essential medium (MEM) (Invitrogen, Cergy-Pontoise, France) supplemented with 4% fetal bovine serum (Invitrogen) and 1% L-glutamine (Invitrogen) was used for cultivation. Infected cells were maintained in a 5% CO2 atmosphere at 35°C. C. burnetii cells were harvested, pelleted, resuspended in 200 μL MEM, and mixed with 500 μL Chelex 100 20% (Bio-Rad, Ivry sur Seine, France). The preparation was boiled for 30 min, centrifuged at 10,000 × g for 30 min (24), and the supernatant containing DNA was transferred to a clean Eppendorf tube and stored at 4°C or –20°C.
Table A1

Isolates of Coxiella burnetii studied

IsolateOriginDisease, symptoms, clinical statusGeographicsourceST (sequence type)Plasmid sequence type
CB108Human bloodAcuteMarseille, France, 20011QpDV
CB1Human heart valveChronicIstres, France, 19891QpDV
CB3Human heart valveChronicMarseille, France1QpDV
CB36Human placentaAbortionMartigues, France, 19921QpDV
CB38Human bloodAcuteMarseille, France, 19921QpDV
CB41Human heart valveChronicMarseille, France, 19931QpDV
CB60Human bloodAcuteMarseille, France, 19961QpDV
CB63Human heart valveChronicMarseille, France, 19941QpDV
CB75Human bloodChronicMarseille, France, 19981QpDV
CB82Human bloodAcuteMarseille, France, 19991QpDV
CB86Human bloodChronicMarseille, France, 19991QpDV
CB87Human placentaAbortionMartigues, France, 19991QpDV
CB89Human placentaAbortionMartigues, France, 20001QpDV
CB94Human bloodAcuteAix en Provence, France, 20001QpDV
CB97Human bloodAcuteMarseille, France, 20001QpDV
CB110Human bloodChronicMarseille, France, 20021QpDV
CB28Human bloodAcuteSalon de Provence, France, 19921QpDV
CB26Human bloodAcuteMarseille, France, 19921QpDV
CB64Human bloodAcuteMartigues, France, 19961QpDV
CB39Human bloodAcuteMarseille, France, 19922QpDV
RT-1140Human bloodPneumoniaKrimea, Ukrain 19542QpDV
RT-SchperlingHuman bloodFeverKyrgyzstan, 19552QpDV
CB118Human heart valveChronicMarseille, France, 20043QpDV
CB62Human bloodAcuteMartigues, France, 19964QpDV
CB20Human bloodAcuteSalon de Provence, France, 19914QpRS
CB51Human placentaAbortionMadrid, Spain, 19964QpDV
CB12Human bloodAcuteAix en Provence, France4QpDV
CB57Human bloodAcuteMartigues, France, 19964QpDV
CB54Human bloodAcuteAix en Provence, France, 19964QpDV
CB111Human heart valveChronicMarseille, France, 20035QpRS
CB35Human heart valveChronicParis, France, 19925QpRS
CB45Human heart valveChronicParis, France, 19936QpRS
CB43Human heart valveChronicParis, France, 19937QpRS
Leningrad-2Human blood-Leningrad, Russia, 19557QpRS
Leningrad-4Human blood-Leningrad, Russia, 19577QpRS
CB10Human heart valveChronic aneurysmGrenoble, France8QpRS
CB9Human bloodChronicLyon, France8QpRS
CB31Human heart valveChronicMarseille, France, 19928QpRS
CB34Human bloodChronicMarseille, France, 19928QpRS
CB44Human heart valveChronicCréteil, France, 19938QpRS
CB53AneurysmChronicMarseille, France, 19958QpRS
CB61Valvular prosthesisChronicMarseille, France, 19968QpRS
CB70Human heart valveChronicGrenoble, France, 19978QpRS
CB71Valvular prosthesisChronicSaint-Laurent du Var, France, 19978QpRS
CB73Valvular prosthesisChronicMarseille, France, 19988QpRS
CB81Human heart valveChronicMadrid, Spain, 19998QpRS
CB91Valvular prosthesisChronicMarseille, France, 20008QpRS
CB93Human placentaAbortionDreux, France, 20008QpRS
CB95Human bloodChronicMarseille, France, 20008QpRS
CB116AneurysmChronicMarseille, France, 20038QpRS
CB107Human heart valveChronicTours, France, 20018QpRS
CB96Human heart valveChronicMarseille, France, 20008QpRS
CB114Human heart valveChronicMarseille, France, 20038QpRS
CB15Human heart valveChronicLyon, France, 19918QpRS
CB47Human heart valveChronicBarcelone, Spain, 19948QpRS
CB99Human heart valveChronicMarseille, France, 20008QpRS
CB106Human heart valveChronicToulouse, France, 20018QpRS
CB79Human heart valveChronicParis, France, 19998QpRS
CB98Human heart valveChronicMarseille, France, 20008QpRS
CB83Goat placentaAbortionNewfoundland, USA, 19998QpRS
CB8Human heart valveChronicMarseille, France, 19908QpRS
PriscillaAborted goatAbortionMontana, USA, 19808QpRS
CB117Human heart valveChronicMarseille, France, 20048QpRS
CB32Human heart valveChronicLyon, France, 19929QpRS
CB92Human heart valveChronicMarseille, France, 20009QpRS
CB68Pigeon excrementMarseille, France, 19969QpRS
CB49Human heart valveChronicMarseille, France, 19949QpRS
CB65Human heart valveChronicMarseille, France, 199610QpRS
CB103Ewe placentaAbortionMarseille, France, 200110QpRS
CB13Human bloodChronicParis, France11QpH1/QpDV
CB40Human heart valveChronicParis, France, 199311QpH1
CB46Valvular prosthesisChronicParis, France, 199311QpH1
CB5Human bloodChronicParis, France, 199012QpH1
CB6Human bloodChronicParis, France12QpH1
CB42Valvular prosthesisChronicToulouse, France, 199312QpH1
CB52Valvular prosthesisChronicParis, France, 199512QpH1
CB56Human heart valveChronicParis, France, 199612QpH1
CB58Spleen abscessLyon, France, 199612QpH1
CB76Human heart valveChronicParis, France, 199812QpH1
CB105Human heart valveChronicMontpellier, France, 200112QpH1
CB112Human heart valveChronicZurich, Switzerland, 200312QpH1
CB109Human heart valveChronicBerlin, Germany, 200212QpH1
CB113Goat placentaAbortionAlbi, France, 200312QpH1
CB33Human heart valveChronicClermont-Ferrand, France, 199212QpH1
CB55VegetationChronicParis, France, 199612QpH1
CB2Human bloodImmunodepressionToulouse, France,13QpH1
CB69VegetationChronicToulouse, France, 199613QpH1
CB85Human bloodChronicTours, France, 199914QpH1
CB74Valvular prosthesisChronicToulouse, France, 199814QpH1
CB59AneurysmChronic aneurysmSaint-Etienne, France, 199614QpH1
CB80NodeChronicNiort, France, 199914QpH1
Z3055Ewe placentaAbortionGermany14QpH1
CB102Valvular prosthesisChronicPoitiers, France, 200115QpH1
CB11Human bloodAcuteMarseille, France16QpH1
CB23Human bloodChronicClermont-Ferrand, France, 198816QpH1
BrasovHumanAcuteRomania16QpH1
BanguiHuman bloodAcuteCentral Africa16QpH1
CaliforniaCow milkPersistentCalifornia, USA, 194716QpH1
CB25Human bloodAcuteParis, France, 199116QpH1
DyerHuman bloodAcuteUSA, 193816QpH1
OhioCow milkPersistentOhio, USA, 195616QpH1
Nine MileTickMontana, USA, 193516QpH1
CS-KL 9Ixodes ricinusSlovakia, 198916QpH1
Z-2775/90Cow placentaAbortionGermany, 199016QpH1
J-1Cow milkJapan16QpH1
J-3Cow milkJapan16QpH1
J-27Cow milkJapan16QpH1
J-60Cow milkJapan16QpH1
J-82Cow milkJapan16QpH1
HardthofCow milkGermany, 199016QpH1
CB77Human heart valveChronicParis, France, 199817QpH1
CB100Human bloodChronicStrasbourg, France18QpH1
HenzerlingHuman bloodAcuteItaly/Slovakia, 194518QpH1
BalaceanuHumanAcuteRomania18QpH1
GeierHumanAcuteRomania18QpH1
HeizbergHumanAcuteGreece18QpH1
Cs-FlorianHuman bloodSlovakia, 195618QpH1
Z-3464/92Goat placentaAbortionGermany, 199218QpH1
Z-4488/93Ewe placentaAbortionGermany, 199318QpH1
Z-349-36/94Ewe placentaGermany, 199418QpH1
MünchenSheepMünchen, Germany, 196918QpH1
CB119Human heart valveChronicSenegal, 200419QpH1
CB48Human placentaAbortionGrenoble, France, 199420QpH1
CB50Valvular prosthesisChronicParis, France, 199420QpH1
CB66AneurysmChronic aneurysmMarseille, France, 199620QpH1
CB72Valvular prosthesisChronicParis, France, 199620QpH1
CB78Valvular prosthesisChronicMarseille, France, 199820QpH1
CB88Human heart valveChronicLyon, France, 199920QpH1
CB90Human heart valveChronicLyon, France,200020QpH1
Z-3567/92Cow placentaAbortionGermany, 199220QpH1
Dugway 5J108-111RodentUtah, USA, 195820QpH1
CB4Human bloodChronicMontpellier, France,198821QpH1
CB7Human heart valveChronic AneurysmMarseille, France21QpH1
Q229Human heart valveChronicNova Scotia, Canada, 198221QpH1
Dog CBDog uterusNova Scotia, Canada, 199521
Poker CatCatNova Scotia, Canada, 198621
CBNSC1CatNova Scotia, Canada, 198621QpH1
Dog ut AdDog uterusNova Scotia, Canada, 198921
CB115Human heart valveChronicNova Scotia, Canada, 200321
Q212Human heart valveChronicNova Scotia, Canada, 198121
Scurry Q217Human liver biopsyHepatitisRocky Mountain, USA21
48 Haemaphysalis punctata Slovakia, 197022QpH1
IrkutskTickIrkutsk, Russia196923QpH1
UzbekistanCow placentaUzbekistan, 197123QpH1
1894Liver and spleen of wild birdCzechoslovakia, 195423QpH1
Kazakhstan-6 Dermacentor marginatus Kazakhstan, 196923QpH1
K-261-LougaCow milkLeningrad, Russia, 195923QpH1
Kazakhstan -5 Dermacentor hirundinis Kazakhstan, 196923QpH1
Russet mouseRusset mouse visceraPskov, Russia23QpH1
II/IA Dermacentor marginatus Slovakia, 197223QpH1
IXO Ixodes ricinus Czech Republic, 195723QpH1
Mongolia-2 Dermacentor nuttalli Mongolia, 198523QpH1
CS-27 Dermacentor marginatus Slovakia, 197223QpH1
Oufa-1Human bloodOufa, Russia23QpH1
Oufa-2Ewe placentaAbortionOufa, Russia23QpH1
Louga-3 Ixodes ricinus Leningrad, Russia, 196223QpH1
Louga-2 Ixodes ricinus Leningrag, Russia, 195923QpH1
Louga-1 Cimex lecturalius Leningrad, Russia, 195923QpH1
Louga rodentApodemus flavicollis visceraLeningrad, Russia, 195823QpH1
Mongolia-1 Dermacentor silvarum Mongolia, 198423QpH1
Vologda-2Human bloodVologda, Russia, 198723QpH1
8931 F10Cow placentaAbortionGermany24QpH1
Grita-Germany, 1940-194525QpH1
M-44VaccineRussia25QpH1
Kazakhstan-4FlyKazakhstan, 196525QpH1
TermezHuman bloodUzbekistan, 195226QpRS
Z2534Goat placentaAbortionAustria27QpH1
Kazakhstan-1Ewe placentaAbortionKazakhstan28QpRS
Kazakhstan-2Cow milkKazakhstan, 196228QpRS
Kazakhstan-3Hyalomma tickKazakhstan, 196228QpRS
TcheredovHuman bloodKazakhstan, 196528QpRS
Henzerling-r *Human bloodItaly, 1945 / Slovakia,29QpH1
NamibiaGoatNamibia, 199130QpRS

*Strain resistant to chlortetracycline obtained by passages in embryonated hen's eggs in presence of increasing doses of chlortetracycline.

Multispacer Sequence Typing

The whole genome of C. burnetii was accessible in the NCBI server (GenBank NC 002971). We kept spacers that were 300–700 bp in length. Primers were chosen in neighboring genes to allow polymerase chain reaction (PCR) amplification at 57°C and are listed in Table 1. Each PCR was carried out in a T3 Thermocycler Biometra (Biolabo, Archamps, France). Two microliters of the DNA preparation was amplified in a 50-μL reaction mixture containing 200 μmol/L of each primer, 200 μmol/L (each) dATP, dCTP, dGTP, and dTTP (Invitrogen), 1.5 U Taq DNA polymerase (Roche, Meylan, France) in 1× Taq buffer. Amplifications were carried under the following conditions: initial denaturation of 10 min at 95°C, followed by 37 cycles of denaturation for 30 s at 95°C, annealing for 30 s at 57°C, and extension for 1 min at 72°C. PCR products were purified and sequenced as previously described (25).
Table 1

Primers used for PCR amplification and sequencing of Coxiella burnetii gene spacers

Spacer nameORFNucleotide sequence (5´–3´)*Amplified fragment length (bp)
Cox2Hypothetical proteinCox20766 CAACCCTGAATACCCAAGGA397
Hypothetical proteinCox21004 GAAGCTTCTGATAGGCGGGA
Cox5Sulfatase domain proteinCox77554 CAGGAGCAAGCTTGAATGCG395
Entericidin, putativeCox77808 TGGTATGACAACCCGTCATG
Cox18Ribonuclease HCox283060 CGCAGACGAATTAGCCAATC557
DNA polymerase III, epsilon subunitCox283490 TTCGATGATCCGATGGCCTT
Cox20Hypothetical proteinCox365301 GATATTTATCAGCGTCAAAGCAA631
Hypothetical proteinCox365803 TCTATTATTGCAATGCAAGTGG
Cox22Hypothetical proteinCox378718 GGGAATAAGAGAGTTAGCTCA383
Amino acid permease family proteinCox378965 CGCAAATTTCGGCACAGACC
Cox37Hypothetical proteinCox657471 GGCTTGTCTGGTGTAACTGT463
Hypothetical proteinCox657794 ATTCCGGGACCTTCGTTAAC
Cox51Replicative DNA helicase, intein-containingCox824598 TAACGCCCGAGAGCTCAGAA674
Conserved hypothetical protein – Uridine kinaseCox825124 GCGAGAACCGAATTGCTATC
Cox56OmpA-like transmembrane domain proteinCox886418 CCAAGCTCTCTGTGCCCAAT479
Conserved hypothetical proteinCox886784 ATGCGCCAGAAACGCATAGG
Cox57Rhodanese-like domain proteinCox892828 TGGAAATGGAAGGCGGATTC617
Hypothetical proteinCox893316 GGTTGGAAGGCGTAAGCCTTT
Cox 61Dioxygenase, putativeCox956825 GAAGATAGAGCGGCAAGGAT611
Hypothetical proteinCox957249 GGGATTTCAACTTCCGATAGA

*The numbers are beginning or end locations of the genes where the primers were chosen.

*The numbers are beginning or end locations of the genes where the primers were chosen. PCR products were cloned in PGEM-T Easy Vector (Promega, Charbonnières, France) according to the manufacturer's instructions. Ten clones were cultivated in LB medium (USB, Cleveland, OH, USA) overnight, and PCR and sequencing were performed as described previously.

Plasmid Sequence Type, com1 Type, and djlA Type Determination

PCR for QpH1 and QpRS sequence plasmids were performed with the primers previously described QpH11/12 and QpRS01/02 (5). PCR was carried out as described for MST, except that annealing temperature was 55°C and cycle number was 35. PCR primers for QpDV and QpRS sequence plasmid amplification were chosen after comparison of the entire sequence of the 2 plasmids. The primers were QpDV1f and QpDV1r. PCR amplification was carried out at 63°C for 30 cycles. PCR was performed as previously described for com1 and djlA (13) (Table A2).
Table A2

Primer used in djlA, com1 and QpH1 and QpRS plasmid targeted sequences for PCR amplification and sequencing

PrimerNucleotide sequence 5´ → 3´Position in the gene
djlA-1*†CGGTGATGAACTGGATTGG–5 – 15
djlA-2†ATTGACCTGACGCGCTTGACG266 –247
djlA-3†GGCAACGCAAGACCCCCGTG579 – 598
djlA-4*†AACCATGCTTCGCACCTTAC810 –791
com-1*†CGTGAAGAACCGTTTGACTG3 – 22
com-2†TGAGGATTGCCTGCCACTGG284 – 265
com-3†GCGCTGCTCAGTGTCGACGG490 – 509
com-4*†CTTTTCTACCCGGTCGATTTC759 – 739
PrimerNucleotide sequence 5´ → 3´Position in the plasmidORF
QpH11TGACAAATAGAATTTCTTCATTTTGATGQpH1 (gb:AE016829) 15332 –15359Spacer between two hypothetical proteins
QpH12GCTTATTTTCTTCCTCGAATCTATGAATQpH1 (gb:AE016829) 168348 – 16375Spacer between two hypothetical proteins
QpRSO1CTCGTACCCAAAGACTATGAATATATCCQpRS gb:Y15898) 14761 –14734Hypothetical protein
QpRS02CACATTGGGTATCGTACTGTCCCTQpRS gb:Y15898) 14398 – 14321Hypothetical protein
QpDV1fATGAGAGAAGAGCAGCCGCTQpRS (gb:Y15898) 9889 – 9908Hypothetical protein
QpDV1rTCAATGATCCGATGTGCGTTTQpH1 (gb:Y15898) 10634 –10614Hypothetical protein

*Oligonucleotide primer used for PCR amplification.
†Oligonucleotide primer used for sequencing.

Data Analysis

Statistical analyses were performed by using the chi-square test in the program EpiInfo 6 (26). The spacer sequences were compiled and aligned by using the multisequence alignment program ClustalX (1.8). The phylogenetic relationships between the C. burnetii isolates were determined by using Mega version 2.0 (27). A matrix of pairwise differences in allele profiles was constructed, and the similarities between the allelic profiles of the isolates were assessed by cluster analysis using the unweighted pair-group method with arithmetic mean (UPGMA). Another analysis of the results was performed by using the BURST algorithm (http://www.mlst.net), which defines clonal complexes in which every isolate shares at least 5 identical alleles with at least 1 other isolate (Cox2, Cox5, Cox18, Cox20, Cox37, Cox56, and Cox57 were kept for the analysis) and characterizes ancestral genotypes. C. burnetii MST database was entered at the following website: http://ifr48.timone.univ-mrs.fr, and ST determination by sequence comparison is possible at this site.

Results

Choice of Spacers for Typing and Analysis by MST

Initially 14 isolates were chosen to test the genetic diversity of the spacers: Nine Mile, Priscilla, Q212, Heizberg, Brasov, Dog ut Ad, CB15, CB20, CB26, CB28, CB33, CB35, CB114, and CB115. We chose 68 spacers, but we retained only 51 spacers for which PCR amplification was obtained for all the isolates. We kept 10 spacers (Cox2, Cox5, Cox18, Cox20, Cox22, Cox37, Cox51, Cox56, Cox57, and Cox61) (Table 1) because they were representative of the results found when we analyzed the entire test set of 51 spacers. For each spacer, the number of variable sites in the sequences was determined, and the percentage of variability was calculated. They were, respectively, 1.1, 1.4, 1.9, 0.7, 2.3, 1.2, 1.4, 2.5, 1.7, and 2.1. We kept Cox18, Cox22, Cox51, Cox56, Cox57, and Cox61 because the percentage of variability in these spacers was high compared with the other spacers. We kept Cox2, Cox5, Cox20, and Cox37 because they allowed the characterization of CB35, CB15, CB26 and CB28, and Nine Mile respectively. To test the reliability of the spacers we kept, chi-square value was determined by using the value of 1% as the threshold value. The Fisher value was found to be statistically significant (9 × 10–4). We then added 159 other isolates. Sequences were obtained for all the isolates with spacers Cox2, Cox18, Cox20, Cox22, Cox37, Cox51, and Cox57. Mixed sequences were obtained with the isolate Poker Cat with spacers Cox5, Cox56, and Cox61. We cloned the PCR products and showed that several sequences were present after PCR amplification, including insertions or deletions. Allele distribution of the different gene spacers are described in Table 2. Each of the different sequences in a locus defined a distinct genotype, even if it differed from the others by only a single nucleotide. Thirty different sequence types (STs) were identified by using MST.
Table 2

Alleles of 10 spacers which allow the definition of the different Coxiella burnetii sequence types

COX
251820223751565761
ST
15634658156
25635658156
35634678156
45632658156
54635628256
64335658256
74635658256
85425153344
91425152346
105425152326
116516545432
123516545432
133516545532
147516569432
157516569632
163753416765
1737574110867
183716347963
1932785411965
2032615441065
2121462311111
223716387968
233716387963
2435165451239
253716347973
269485852346
2735165451232
288485752346
293719347963
3056956581386
The nucleotide sequence accession numbers are noted in Table A3. Accession numbers for Poker Cat isolate clones are, respectively, AY619726, AY619728, and AY619729, and AY619721 for Cox5, Cox56, and Cox61.
Table A3

Accession numbers of nucleotide sequences deposited in GenBank

Cox 2Cox 5Cox 18Cox 20Cox 22Cox 37Cox 51Cox 56Cox 57Cox 61
ST1 (CB26)AY492067AY495357AY502819AY502857AY502899AY502623AY502735AY502777AY502674AY512785
ST2 (CB39)AY574327AY574328AY574329AY574330AY574331AY574332AY574333AY574334AY574335AY574336
ST3 (CB118)AY574337AY574338AY574339AY574340AY574341AY574342AY574343AY574344AY574345AY574346
ST4 (CB20)AY492065AY495355AY502817AY502855AY502897AY502621AY502733AY502775AY502673AY512784
ST5 (CB35)AY494735AY495360AY502822AY502860AY502902AY502626AY502738AY502780AY502677AY512788
ST6 (CB45)AY494734AY502720AY502841AY502881AY502921AY502645AY502761AY502801AY502709AY512819
ST7 (CB43)AY574307AY574308AY574309AY574310AY574311AY574312AY574313AY574314AY574315AY574316
ST8 (Priscilla)AY596174AY502715AY502837AY502875AY502883AY502642AY502752AY502797AY502681AY596175
ST9 (CB68)AY494733AY502721AY502842AY502882AY502922AY502646AY502762AY502802AY502710AY512820
ST10 (CB103)AY492058AY495348AY502810AY502850AY502890AY502613AY502728AY502770AY502688AY512805
ST11 (CB13)AY575668AY575669AY575670AY575671AY575672AY575673AY575674AY575675AY575676AY575677
ST12 (CB33)AY492069AY495359AY502821AY502859AY502901AY502625AY502737AY502779AY502676AY512787
ST13 (CB2)AY575653AY575654AY575655AY575656AY575657AY575658AY575659AY575660AY575661AY575662
ST14 (CB85)AY575643AY575644AY575645AY575646AY575647AY575648AY575649AY575650AY575651AY575652
ST15 (CB102)AY492057AY495347AY502809AY502849AY502889AY502612AY502755AY502769AY502687AY512794
ST16 (Ohio)AY494725AY502712AY502834AY502872AY502916AY502640AY502748AY502794AY502707AY512816
ST17 (CB77)AY574325AY574326AY574317AY574318AY574319AY574320AY574321AY574322AY574323AY574324
ST18 (Henzerling)AY494723AY495369AY502832AY502870AY502914AY502638AY502746AY502792AY502701AY512814
ST19 (CB119)AY575633AY575634AY575635AY575636AY575637AY575638AY575639AY575640AY575641AY575642
ST20 (CB88)AY492072AY502719AY502825AY502863AY502905AY502629AY502759AY502783AY502696AY512798
ST21 (Q212)AY494729AY502716AY502838AY502876AY502918AY502643AY502753AY502798AY502682AY512793
ST22 (48)AY864229AY864230AY864231AY864232AY864233AY864234AY864235AY864236AY864237AY864238
ST23 (Irkutsk)AY864239AY864240AY864241AY864242AY864243AY864244AY864245AY864246AY864247AY864248
ST24 (8931 F10)AY864199AY864200AY864201AY864202AY864203AY864204AY864205AY864206AY864207AY864208
ST25 (Grita)AY864209AY864210AY864211AY864212AY864213AY864214AY864215AY864216AY864217AY864218
ST26 (Termez)AY864219AY864220AY864221AY864222AY864223AY864224AY864225AY864226AY864227AY864228
ST27 (Z2534)AY864249AY864250AY864251AY864252AY864253AY864254AY864255AY864256AY864257AY864258
ST28 (Kazakhstan-2)AY864259AY864260AY864261AY864262AY864263AY864264AY864265AY864266AY864267AY864268
ST29 (Henzerling-r)AY864269AY864270AY864271AY864272AY864273AY864274AY864275AY864276AY864277AY864278
ST30 (Namibia)AY864279AY864280AY864281AY864282AY864283AY864284AY864285AY864286AY864287AY864288

Computer Analysis of MST Data

The dendrogram in the Figure was constructed from a matrix of pairwise allelic differences between the compiled sequences of the 30 STs. We identified 3 monophyletic groups within the tree. The first group, representing 13 different STs, included isolates from France, Spain, Russia, Kyrgyzstan, Namibia, Kazakhstan, Ukraine, Uzbekistan, and the United States. It was divided in 2 subgroups. The first one included 36 isolates representing 8 different STs (ST1 to ST7 and ST30). Nineteen were represented by ST1. The second subgroup included 39 isolates which represented 5 different STs (ST8, ST9, ST10, ST26, and ST28). Twenty-eight were represented by ST8.
Figure

Dendrogram of the genetic relatedness among the 30 different sequence types defined by multispacer sequence type (MST) analysis. The dendrogram was constructed by unweighted pair-group method with arithmetic mean. Plasmid sequence type, com1 group, and djlA group corresponding to each ST are indicated on the right of the figure. The 3 monophyletic groups defined by MST analysis are indicated on the left.

Dendrogram of the genetic relatedness among the 30 different sequence types defined by multispacer sequence type (MST) analysis. The dendrogram was constructed by unweighted pair-group method with arithmetic mean. Plasmid sequence type, com1 group, and djlA group corresponding to each ST are indicated on the right of the figure. The 3 monophyletic groups defined by MST analysis are indicated on the left. The second group included isolates from Europe (France, Germany, Switzerland, Romania, Italy, Greece, Austria, Slovakia), the United States, Russia, Africa (Central Africa and Senegal), and Asia (Kazakhstan, Uzbekistan, Mongolia, and Japan). It was divided into 4 subgroups. The first one included 26 isolates, which represented 7 different STs (ST11, ST12, ST13, ST14, ST15, ST24, and ST27). The second subgroup included 34 isolates that were included in ST18, ST22, ST23, ST25, and ST29 groups. The third subgroup included 18 isolates (ST16 and ST17), and the fourth subgroup included 10 isolates (ST19 and ST20). The third group consisted of only 1 ST, ST21, and included the 7 Canadian isolates, 2 isolates from France (CB4 and CB7), and 1 isolate from the United States (Scurry). The clusters determined by the BURST algorithm were consistent with those determined by the phylogenetic analysis. Five groups were defined. The first one included ST1 to ST7; the putative ancestral genotype in this group was ST1. ST8 (putative ancestral genotype), ST9, ST10, ST26, and ST28 were included in the second group; ST11, ST12 (putative ancestral genotype), ST13, ST14, ST15, and ST24 in the third group, ST16 and ST17 in the fourth group; and ST18 (putative ancestral genotype), ST22, ST23, ST25, and ST29 in the fifth group. ST19, ST20, ST21, and ST30 were considered as singletons.

Sequence Type Determination and Correlation with Pathology

In the monophyletic group 1, the sequence of plasmid QpRS was found for isolates included in ST4, ST5, ST6, ST7, ST8, ST9, ST10, ST26, ST28, and ST30. The QpDV plasmid sequence was amplified for isolates included in ST1, ST2, ST3, and ST4. In the monophyletic group 2, the QpH1 plasmid sequence was found in all the isolates. In the monophyletic group 3, the QpH1 plasmid sequence or none of the searched plasmid sequences was detected. Sequence comparison of djlA generated 4 different groups. Group I included all STs included in the monophyletic group 2 defined by MST analysis. Group II included ST1, ST2, ST3, and ST4. Group III included ST5, ST6, ST7, ST30, ST26, ST28, ST8, ST9, and ST10. Group IV corresponded to ST21. Com1 sequence comparison generated 6 different groups. Group I included all the STs included in the monophyletic group 2 defined by MST analysis except ST14 (group V) and ST20 (groupVI). Group II included ST1, ST2, ST3, and ST4. Group III included ST5, ST6, ST7, ST30, ST26, ST28, ST8, ST9, and ST10. Group IV corresponded to ST21. When com1 typing was used, only 1 strain was not in accordance with MST typing results. This strain, CB95, was included in ST8 but exhibited a group II com1 sequence. QpDV plasmid presence in human isolates was correlated with the acute form of the disease (p = 2 × 10–7), and QpRS plasmid presence was correlated with the chronic form of the disease (p = 2 × 10–4). The acute form of the disease was correlated with ST1 (p = 10–3), ST4 (p = 7 × 10–4) ST16 (p = 3 × 10–3), ST18 (p = 10–2), and the chronic form of the disease was correlated with ST8 (p = 2 × 10–3).

Modifications in ORFs Surrounding Studied Spacers

As primers were chosen in ORFs surrounding the studied spacers, mutations, deletions, or insertions were noted in the protein sequences. Mutations were noted in the hypothetical protein (gi29653385) for ST11; in the hypothetical protein (gi29653385) for ST9 and ST26; in entericin (gi29653446) for ST20, in ribonuclease H (gi29653667) in ST1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 21, 26, 28, and 30; in amino acid permease family protein (gi29653908) in ST28; in hypothetical protein (gi29654047) in ST1, 2, 4, 5, 6, 7, 8, 9, 10, 26, 28, and 30. In CB118 (ST3), a stop codon appeared which shortened the length of the ORF. Mutations were noted in uridine kinase (gi29654198) in ST18, ST22, ST23, ST25, and ST29; in ompA-like transmembrane domain protein (gi29654257), in ST20; in rhodanese-like domain protein (gi29654263) in ST20 (the protein was longer by 2 amino acids); in dioxygenase (gi29654325) in ST21 and ST22; in hypothetical protein (gi29732244), in ST17. Insertions or deletions were noted in hypothetical protein (gi29653386) in ST5, 6, and 7; in hypothetical protein (gi29653755) in ST1 and ST3 (insertion of a base G in the DNA sequence made the protein sequence longer of 22 amino acids); in the amino acid permease family protein (gi29653772) in ST8, 9, and 10 (deletion of a base A in the DNA sequence made the protein sequence longer of 24 amino acids); in ompA-like transmembrane domain protein (gi29654257) in ST11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 22, 23, 24, 25, 27, and 29.

Discussion

Q fever in humans and animals, caused by C. burnetii, is found worldwide. In humans, it causes a variety of diseases such as acute flulike illness, pneumonia, hepatitis, and chronic endocarditis. In animals, C. burnetii is found in the reproductive system, both uterus and mammary glands and may cause abortion or infertility. Molecular methods are now almost universally used to characterize strains and to determine the relatedness between isolates causing diseases in different contexts. The most discriminative approach used for C. burnetii isolates until this study was PFGE. Twenty different restriction patterns were distinguished after NotI restriction of total C. burnetii DNA and PFGE (11). Comparison of PFGE profiles is sometimes difficult because good separation of the different fragments is required. For example, the isolate Heizberg was classified in group 1 by Thiele et al. (10) and in group 2 by Jäger et al. (11). This fact highlights the difficulty of comparing results obtained by this technique. Moreover, in some species, rapid genomic rearrangements occur because of repeats or insertion sequences, so even if isolates descended from a common ancestor that arose several decades ago, they may not readily be seen to be minor variants of the same clone. In these cases, PFGE does not contribute to tracing of isolates. The great advantage of MST over PFGE as a typing method is the lack of ambiguity and the portability of sequence data, which allow results from different laboratories to be compared without exchanging strains. This work is the first to include so many isolates in a rigorous examination of molecular epidemiology. The study of this bank of sequences will contribute to understanding the propagation mode of the bacteria as variations accumulate relatively slowly, thus making it an ideal tool for global epidemiology. For example, in ST16 we characterized isolates that were obtained from 1935 (Nine Mile) to 1991 (CB25). Most of the French isolates were included in monophyletic group 1. Nineteen were included in ST1, and 24 were included in ST8. Thus, an isolate has a geographic distribution even if genetic modifications appear (insertions, deletions or mutations) over time, giving rise to a new ST that is related to the ancestor isolate. This fact was highlighted when the analysis of the STs was performed by using the BURST algorithm. ST1 and ST8 were described as the ancestral genotypes and for example, ST9 and ST10 corresponded to SLVs of ST8 (isolates that differ at only 1 of the 7 loci) and ST26 and ST28 corresponded to DLVs of ST8 (double locus variants). But some types were not delineated on the basis of geographic origin because they were isolated from different parts of the world. This distribution in distant countries is likely related to movements of infected patients, animals, or ticks. This is particularly true for ST16 isolates that were encountered on 4 different continents, America, Europe, Asia, and Africa. The homology of the Canadian isolates from Nova Scotia should be noted. Q fever is just as endemic in Nova Scotia as in France. This may indicate rapid and recent spreading of a single strain. The association between ST21 and Canada is significant as tested with the chi-square test with a Fisher value <10–8. Notably, patient CB115, who had Q fever endocarditis, was living in Edmonton, Alberta (≈3,000 miles from Nova Scotia) when this illness was diagnosed. He grew up in Nova Scotia, and the molecular epidemiologic findings show that he acquired his disease there. Q fever is uncommon in Alberta. Most of the STs are found in Europe. A sample bias could exist as most of the isolates tested were from this continent, but the results obtained may also indicate that C. burnetii originated from the Old World and spread later in the New World, excluding New Zealand. Concordant results were found when MST was compared with com1 and djlA sequences comparison (Figure) However MST was more discriminant. Plasmid profile investigation of C. burnetii detected 4 different plasmids QpH1, QpRS, QpDV, and QpDG and 1 group of plasmidless isolates. QpH1 was first found in the Nine Mile tick isolate (28). QpRS was first found in the goat isolate Priscilla (29). QpDG was described from isolates obtained from feral rodents near Dugway, Utah (8). QpDV was found in French and Russian isolates (5,6). Another not-well-characterized plasmid type was described in China (30). The existence of a plasmidless C. burnetii isolate, Scurry Q217 was described (31), but a chromosomally integrated plasmid-homologous DNA fragment was found in this isolate by hybridization (32,33). Plasmid type sequence detection was also correlated with MST. Group 2 included isolates that PCR amplification found to be positive with primers specific for QpH1. Group 3 included 3 isolates, 2 from France (CB4 and CB7) and 1 from Nova Scotia (Poker Cat), in which plasmid sequence type of QpH1 was detected. No such sequence was detected in the other isolates of Nova Scotia origin included in group 3. Group 1 included isolates that were positive by PCR amplification with primers specific for QpRS (47/77). QpDV plasmid was described in isolates from France, Spain, Ukraine, and Kyrgyzstan. In fact, regions shared by QpH1, QpRS, and QpDV were termed "core plasmid sequences" and encompassed 25 kb. QpH1, QpRS, and QpDV are, respectively, 37 kb, 39 kb, and 33 kb in size. Integrated sequences in American isolate represent 18 kb. Differences in plasmid size and sequence can be explained by notable sequence rearrangements, such as deletions, insertions, or duplications, because several repeat sequences have been identified through which such rearrangements might have occurred. For CB13, we were able to characterize sequences for plasmids QpH1 and QpDV, which can be caused by several situations: this isolate may have 1) 2 different plasmids, 2) a QpH1 plasmid and sequences of QpDV integrated in the chromosome, or 3) a new plasmid that arose from combination of QpH1 and QpDV. All these hypotheses are in agreement with the presence of QpH1 plasmid in the ancestor of C. burnetii isolates. This plasmid was lost by some of them (monophyletic group 3) but genetic information of crucial importance for the organism was integrated in the chromosome. For other isolates, QpH1 plasmid evolved to QpRS plasmid, in some isolates QpRS plasmid evolved to QpDV plasmid. This study showed a correlation between QpDV and acute infections, between QpRS and chronic infections, and an association between some genotypes and disease type. A bias in sampling exists since acute disease is 20 times more frequent than chronic disease, but in this study, most of the human isolates were from chronic disease patients, and the isolates from acute infections were mainly obtained from France. These facts reflect the difficulty in isolating the bacteria. A genomic typing method such as MST could be applied directly to samples to obtain a more precise idea of how C. burnetii is spreading in the environment and the pathogenetic implications in acute and chronic forms of Q fever. Comparison of DNA sequences is the best approach to investigate bacterial evolution. MLST in association with BURST analysis has been used to type isolates of many species. But this method is useful only if housekeeping gene diversity exists in the studied species. For example, in the species Yersinia pestis no diversity was found in the housekeeping genes studied (34). With the MST approach, differentiation of the 3 biovars Antiqua, Medievalis, and Orientalis was possible (25), which shows that the discriminatory power of MST is higher than that of MLST and is comparable to that of tandem repeats analysis (35). Low variability was found in C. burnetii housekeeping genes such as 16S rRNA (36) and rpoB (37). MST is the first method that allows a rapid and reliable typing of C. burnetii isolates during investigations of outbreaks by sequencing the PCR product obtained from the 10 spacers described. We did not test isolates from Australia and only 8 from the United States. Two isolates from Africa (Namibia and CB119) were considered as singletons in the BURST analysis denoting lack of closely related isolates. In the future, isolates that were not available in our laboratory during this study must be tested so the missing links in our phylogenetic analysis can be determined. The constitution of a database in a website will allow isolates from all the countries in the world to be compared and increase understanding of the propagation of the isolates of C. burnetii.
  35 in total

Review 1.  Multilocus sequence typing.

Authors:  M C Enright; B G Spratt
Journal:  Trends Microbiol       Date:  1999-12       Impact factor: 17.079

2.  Sequencing and characterization of the cryptic plasmid QpRS from Coxiella burnetii.

Authors:  S Lautenschläger; H Willems; C Jäger; G Baljer
Journal:  Plasmid       Date:  2000-07       Impact factor: 3.466

Review 3.  Multi-locus sequence typing: a tool for global epidemiology.

Authors:  Rachel Urwin; Martin C J Maiden
Journal:  Trends Microbiol       Date:  2003-10       Impact factor: 17.079

4.  Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material.

Authors:  P S Walsh; D A Metzger; R Higuchi
Journal:  Biotechniques       Date:  1991-04       Impact factor: 1.993

Review 5.  Methods of multilocus enzyme electrophoresis for bacterial population genetics and systematics.

Authors:  R K Selander; D A Caugant; H Ochman; J M Musser; M N Gilmour; T S Whittam
Journal:  Appl Environ Microbiol       Date:  1986-05       Impact factor: 4.792

6.  Phylogenic homogeneity of Coxiella burnetii strains as determinated by 16S ribosomal RNA sequencing.

Authors:  A Stein; N A Saunders; A G Taylor; D Raoult
Journal:  FEMS Microbiol Lett       Date:  1993-11-01       Impact factor: 2.742

7.  Differentiation of Coxiella burnetii isolates by sequence determination and PCR-restriction fragment length polymorphism analysis of isocitrate dehydrogenase gene.

Authors:  S V Nguyen; K Hirai
Journal:  FEMS Microbiol Lett       Date:  1999-11-15       Impact factor: 2.742

8.  A new plasmid (QpDV) common to Coxiella burnetii isolates associated with acute and chronic Q fever.

Authors:  D Valková; J Kazár
Journal:  FEMS Microbiol Lett       Date:  1995-01-15       Impact factor: 2.742

9.  Lack of pathotype specific gene in human Coxiella burnetii isolates.

Authors:  A Stein; D Raoult
Journal:  Microb Pathog       Date:  1993-09       Impact factor: 3.738

10.  Is plasmid based differentiation of Coxiella burnetii in 'acute' and 'chronic' isolates still valid?

Authors:  D Thiele; H Willems
Journal:  Eur J Epidemiol       Date:  1994-08       Impact factor: 8.082

View more
  92 in total

1.  Interlaboratory evaluation of different extraction and real-time PCR methods for detection of Coxiella burnetii DNA in serum.

Authors:  Jeroen J H C Tilburg; Willem J G Melchers; Annika M Pettersson; John W A Rossen; Mirjam H A Hermans; Erik J van Hannen; Marrigje H Nabuurs-Franssen; Maaike C de Vries; Alphons M Horrevorts; Corné H W Klaassen
Journal:  J Clin Microbiol       Date:  2010-09-08       Impact factor: 5.948

2.  The Coxiella burnetii cryptic plasmid is enriched in genes encoding type IV secretion system substrates.

Authors:  Daniel E Voth; Paul A Beare; Dale Howe; Uma M Sharma; Georgios Samoilis; Diane C Cockrell; Anders Omsland; Robert A Heinzen
Journal:  J Bacteriol       Date:  2011-01-07       Impact factor: 3.490

3.  Molecular method for identification of Rickettsia species in clinical and environmental samples.

Authors:  Isabel Jado; Raquel Escudero; Horacio Gil; María Isabel Jiménez-Alonso; Rita Sousa; Ana L García-Pérez; Manuela Rodríguez-Vargas; Bruno Lobo; Pedro Anda
Journal:  J Clin Microbiol       Date:  2006-10-11       Impact factor: 5.948

4.  Comparative genomics reveal extensive transposon-mediated genomic plasticity and diversity among potential effector proteins within the genus Coxiella.

Authors:  Paul A Beare; Nathan Unsworth; Masako Andoh; Daniel E Voth; Anders Omsland; Stacey D Gilk; Kelly P Williams; Bruno W Sobral; John J Kupko; Stephen F Porcella; James E Samuel; Robert A Heinzen
Journal:  Infect Immun       Date:  2008-12-01       Impact factor: 3.441

5.  Rapid comparative genomic analysis for clinical microbiology: the Francisella tularensis paradigm.

Authors:  Bernard La Scola; Khalid Elkarkouri; Wenjun Li; Tara Wahab; Ghislain Fournous; Jean-Marc Rolain; Silpak Biswas; Michel Drancourt; Catherine Robert; Stéphane Audic; Sven Löfdahl; Didier Raoult
Journal:  Genome Res       Date:  2008-04-11       Impact factor: 9.043

6.  Cell extract-containing medium for culture of intracellular fastidious bacteria.

Authors:  Sudhir Singh; Malgorzata Kowalczewska; Sophie Edouard; Carole Eldin; Céline Perreal; Pascal Weber; Said Azza; Didier Raoult
Journal:  J Clin Microbiol       Date:  2013-06-05       Impact factor: 5.948

7.  Mouse Model of Coxiella burnetii Aerosolization.

Authors:  Cléa Melenotte; Hubert Lepidi; Claude Nappez; Yassina Bechah; Gilles Audoly; Jérôme Terras; Didier Raoult; Fabienne Brégeon
Journal:  Infect Immun       Date:  2016-06-23       Impact factor: 3.441

8.  Emergence of Q fever arthritis in France.

Authors:  Emmanouil Angelakis; Sophie Edouard; Marie-Alix Lafranchi; Thao Pham; Pierre Lafforgue; Didier Raoult
Journal:  J Clin Microbiol       Date:  2014-01-15       Impact factor: 5.948

9.  A Q Fever Outbreak with a High Rate of Abortions at a Dairy Goat Farm: Coxiella burnetii Shedding, Environmental Contamination, and Viability.

Authors:  Raquel Álvarez-Alonso; Mikel Basterretxea; Jesús F Barandika; Ana Hurtado; Jasone Idiazabal; Isabel Jado; Xabier Beraza; Milagros Montes; Paloma Liendo; Ana L García-Pérez
Journal:  Appl Environ Microbiol       Date:  2018-10-01       Impact factor: 4.792

10.  Coxiella burnetii isolates cause genogroup-specific virulence in mouse and guinea pig models of acute Q fever.

Authors:  K E Russell-Lodrigue; M Andoh; M W J Poels; H R Shive; B R Weeks; G Q Zhang; C Tersteeg; T Masegi; A Hotta; T Yamaguchi; H Fukushi; K Hirai; D N McMurray; J E Samuel
Journal:  Infect Immun       Date:  2009-09-28       Impact factor: 3.441

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.