Literature DB >> 15927526

Real-time RT-PCR detection of 12 respiratory viral infections in four triplex reactions.

R N Gunson1, T C Collins, W F Carman.   

Abstract

Entities:  

Mesh:

Substances:

Year:  2005        PMID: 15927526      PMCID: PMC7108440          DOI: 10.1016/j.jcv.2004.11.025

Source DB:  PubMed          Journal:  J Clin Virol        ISSN: 1386-6532            Impact factor:   3.168


× No keyword cloud information.

Introduction

Traditional viral culture, usually in combination with direct immunofluoresence (DIF), is the gold standard for the laboratory diagnosis of viral respiratory infection. However, these methods are insensitive, laborious, have prolonged turn-around times, and cannot detect all recognised viral respiratory pathogens. PCR is more sensitive and specific than traditional methods and can be used to detect fastidious viruses. Real-time PCR is at least as sensitive as nested gel-based PCR protocols and offers increased rapidity (results available within the working day). The use of specific labelled probes ensures easy interpretation when used in a multiplex format. We describe four triplex TaqMan™-based RT-PCR methods adapted from published methods and further developed in-house for the diagnosis of 12 viral respiratory pathogens.

Selection of primers and probes

Primers and probes for each triplex are described in full (Table 1 ). Real-time RT-PCR assays for human metapneumovirus (hMPV) (Mackay et al., 2003), RSV A and B (van Elden et al., 2003), and coronavirus 229E and OC43 (van Elden et al., 2004) were published previously. Although the primers for the detection of influenza A and influenza B, rhinovirus, and parainfluenza 1 and 2 were from previously published methods (Bredius et al., 2004, Templeton et al., 2004), TaqMan™ probes for these pathogens were adapted from the original molecular beacons. In-house real-time RT-PCR methods were developed for coronavirus NL63 and parainfluenza 3 using Beacon designer 2.0 (Premier Biosoft International) and Primer Express (Applied Biosystems). Conserved target regions were identified using BLAST (www.ncbi.nlm.nih.gov/blast). Regions within the 1a and haemagluttinin genes were chosen for coronavirus NL63 and parainfluenza 3, respectively. The primers and probes were shown to detect all submitted NL63 and parainfluenza 3 sequences. No interfering secondary structures were observed using the mfold algorithm (www.bioinfo.rpi.edu).
Table 1

Primers and probes used in triplex real-time RT-PCR assays

TriplexPathogenPrimer sequences (concentration in nM)Probe sequence (concentration in nM)Target
1Influenza AAAAGCGAATTTCAGTGTGAT (1000)6FAM-CCC TCT TCG GTG AAA GCC CT-BHQ (300)NS1 gene
GAAGGCAAT GTGAGATTT (500)



Influenza BGTCCATCAAGCTCCAGTTTT (1000)CY5-CCTCCGTCTCCACCTACT TCGTT-BHQ (300)Nucleoprotein gene
TCTTCTTACAGCTTGCTTGC (500)



Human metapneumovirusAACCGTGTACTAAGTGATGCACTC (500)VIC-CTTTGCCATACTCAATGAACAAAC-TAMRA (300)Nucleocapsid protein gene
CATTGTTTGACCGGCCCCATAA (500)



2RSV AAGATCAACTTCTGTCATCCAGCAA (1000)6FAM-CACCATCCAACGGAGCACAGGAGAT-BHQ (300)Nucleocapsid protein gene
TTCTGCACATCATAATTAGGAG (250)



RSV BAAGATGCAAATCATAAATTCACAGGA (1000)CY5-TTTCCCTTCCTAACCTGGACATA-BHQ (300)
TGATATCCAGCATCTTTAAGTA (1000)



RhinovirusTGGACAGGGTGTGAAGAGC (1000)VIC-TCCTCCGGCCCCTGAATG-TAMRA (300)Five untranslated region
CAAAGTAGTCGGTCCCATCC (1000)



3Parainfluenza 1ACCTACAAGGCAACAACATC (1000)CY5-CAAACGATGGCTGAAAAAGGGA-BHQ (300)HN gene
CTTCCTGCTGGTGTGTTAAT (500)



Parainfluenza 2CCATTTACCTAAGTGATGGAA (1000)VIC-AATCGCAAAAGCTGTTCAGTCAC-TAMRA (300)HN gene
CGTGGCATAATCTTCTTTTT (1000)



Parainlfuenza 3CCAGGGATATAYTAYAAAGGCAAAA (1000)6FAM-TGGRTGTTCAAGACCTCCATAYCCGAGAAA-BHQ (300)HN gene
CCGGGRCACCCAGTTGTG (1000)



4Coronvirus 229ECAGTCAAATGGGCTGATGCA (1000)6FAM-CCCTGACGACCACGTTGTGGTTCA-BHQ (300)
AAAGGGCTATAAAGAGAATAAGGTATTCT (1000)



Coronavirus OC43CGATGAGGCTATTCCGACTAGGT (125)CY5-TCCGCCTGGCACGGTACTCCCT-BHQ (300)
CCTTCCTGAGCCTTCAATATAGTAACC (1000)



Coronavirus NL63ACGTACTTCTATTATGAAGCATGATATTAA (1000)VIC-ATTGCCAAGGCTCCTAAACGTACAGGTGTT-TAMRA (300)
AGCAGATCTAATGTTATACTTAAAACTACG (1000)
Primers and probes used in triplex real-time RT-PCR assays

Selection of flourophores

All real-time RT-PCR assays were developed for use on the ABI 7500 real-time PCR system. For multiplex real-time PCR, ABI recommend that probes are labelled with the dyes FAM and VIC, as they are distinguishable from each other because they have different emission wavelength maxima (518 nm and 554 nm). We chose CY5 as the third dye as its emission wavelength maxima is far removed from both FAM and VIC (670 nm). No cross-talk was observed.

Protocol

Respiratory controls and samples were extracted using the Qiagen blood minikit on the Biorobot 9604 using standard protocols. Amplification was carried out in a 25 μl reaction volume using the Invitrogen superscript III One step q-RT-PCR system containing 10 μl of extracted sample. Primers and probes were added to each PCR reaction at the concentration shown (Table 1). Reverse transcription was performed for 15 min at 50 °C. Platinum taq polymerase was activated 95 °C for 2 min and 40 cycles of PCR performed at 95 °C for 8 s and 60 °C for 34 s using an ABI 7500 SDS. Total reaction time per triplex reaction was approximately 75 min.

Analytical sensitivity

All real-time PCR assays were previously assessed in their original single target or duplex formats using panels of known culture and DIF or nested PCR positive and negative samples. All of the real-time RT-PCR assays were more sensitive than traditional or nested RT-PCR methods (data not shown). All real-time RT-PCR assays (except coronavirus NL63 and parainfluenza 2) were also assessed using quality control molecular diagnostics (QCMD) respiratory panel (Forde et al., in press). Each real-time RT-PCR test detected the appropriate target at the appropriate end point dilution.

Sensitivity compared to current diagnostic methods

Four multiplex real-time RT-PCR assays were developed for the simultaneous detection of influenza A, influenza B, and hMPV; RSV A, RSV B, and rhinovirus; parainfluenza 1, 2, and 3; coronavirus 229E, OC43, and NL63. Each triplex real-time RT-PCR assay was initially assessed using positive controls and compared to the previous duplicate or single target format. Triplex assays were then compared to panels of tissue culture and DIF and/or nested RT-PCR positive samples (where available). To determine whether mixed infections would reduce triplex sensitivity end point dilutions of each viral target were tested in both a single target and a pooled target (containing 10 different viral targets at the same endpoint dilution) format.

Multiplex real-time RT-PCR for influenza A, influenza B, and human metapneumovirus

Positive control samples for influenza A, influenza B, and hMPV were tested in triplicate wells using the triplex assay in parallel with the previous duplex or single target format (Table 2 ). There was no significant loss of sensitivity (as observed by cycle threshold (Ct)) between methods. The triplex assay was then tested on 11 influenza A positive samples. The triplex assay detected all the previous positive samples. The endpoint dilution of both the single target controls and pooled format controls were detected by the triplex assay showing that “mixed infections” would not reduce the sensitivity of this assay.
Table 2

Comparison of Ct of positive controls in triplicate for influenza A, influenza B, and HmPv in single, duplex, and triplex RT-PCR reactions

Mean Ct (±S.E.M.)
Flu A in duplex29.91 (0.1)
Flu A in triplex30.46 (0.32)
Flu B in duplex25.90 (0.21)
Flu B in triplex26.22 (0.53)
hMPV in single29.83 (0.38)
hMPV in triplex28.93 (0.18)
Comparison of Ct of positive controls in triplicate for influenza A, influenza B, and HmPv in single, duplex, and triplex RT-PCR reactions

Multiplex real-time RT-PCR for RSV A, RSV B, and rhinovirus

Positive samples for RSV A, RSV B, and rhinovirus were tested in a triplex format in triplicate and compared to duplex or single target format (Table 3 ). No loss in sensitivity was observed for RSV A and RSV B. The sensitivity of the rhinovirus real-time RT-PCR improved when incorporated in the triplex assay (as shown by a reduction in the Ct). This increase in sensitivity was sample specific (only occurred with the positive control) as no reduction in Ct was observed when the testing the rhinovirus positive samples. The triplex assay was then assessed on 42 RSV positive samples (NPA samples positive by DIF and nested gel-based PCR) and 11 rhinovirus positive samples. The triplex assay detected all previously positive samples. The endpoint dilution of both the single target controls for RSV A, RSV B, and rhinovirus and pooled format controls (containing 10 viral targets) were detected by the triplex assay showing that “mixed infections” would not reduce the sensitivity of this assay.
Table 3

Comparison of Ct for RSV A, RSV B, and rhinovirus in single, duplex, and triplex RT-PCR reactions

Mean Ct (±S.M.E.)
RSV A duplex17.43 (0.28)
RSV A triplex17.19 (0.15)
RSV B duplex22.06 (0.22)
RSV B triplex21.17 (0.28)
Rhino single26.05 (0.13)
Rhino triplex23.85 (0.02)
Comparison of Ct for RSV A, RSV B, and rhinovirus in single, duplex, and triplex RT-PCR reactions

Multiplex real-time RT-PCR for parainfluenza 1, 2, and 3

Positive control samples for parainflueza 1, 2, and 3 were tested in a triplex format, either with the new PF3 assay or the original test. The introduction of the new PF3 assay had no effect on the sensitivity of the PF1 and PF2 RT-PCR assays (Table 4 ). However, the new PF3 RT-PCR was more sensitive than the previous method. The new triplex assay was then compared to the published method on 19 DIF PF3 positive samples. The new method detected one additional sample (19 versus 18). The endpoint dilution of both the single target controls and pooled format controls were detected by the triplex assay showing that “mixed infections” would not reduce the sensitivity of this assay.
Table 4

Comparison of published parainfluenza triplex assay with triplex parainfluenza assay incorporating new PF3 RT-PCR assay

Ct of PF1 controlCt of PF2 controlCt of PF3 control
Published parainfluenza triplex assay28.3424.1728.37
Published parainfluenza triplex assay with new PF3 PCR27.7525.0224.24
Comparison of published parainfluenza triplex assay with triplex parainfluenza assay incorporating new PF3 RT-PCR assay

Multiplex real-time RT-PCR for coronavirus 229E, OC43, and NL63

Positive samples for coronavirus 229E, OC43, and NL63 were tested in a triplex format and in the duplex or single target format (Table 5 ). No significant changes in Ct were observed. The endpoint dilution of both the single target controls and pooled format controls were detected by the triplex assay showing that “mixed infections” would not reduce the sensitivity of this assay.
Table 5

Comparison of Ct for single, duplex, and triplex RT-PCR assays for conrovirus 229E, OC43, and NL63

Ct of OC43 controlCt of 229E controlCt of NL63 control
OC34/229E/NL63 assay23.7631.926.67
OC43/229E assay23.6331.3
NL63 assay26.23
Comparison of Ct for single, duplex, and triplex RT-PCR assays for conrovirus 229E, OC43, and NL63 We have shown these triplex real-time RT-PCR assays to be at least as sensitive our previous RT-PCR assays. The rapidity, stability, and ease of use of these triplex real-time RT-PCR assays results in improved turn-around-times (12 pathogens within the working day), easier interpretation, and increased cost effectiveness. The implementation of these assays will no doubt improve patient management, infection control procedures, and the effectiveness of surveillance systems.
  5 in total

1.  Rapid and sensitive method using multiplex real-time PCR for diagnosis of infections by influenza a and influenza B viruses, respiratory syncytial virus, and parainfluenza viruses 1, 2, 3, and 4.

Authors:  Kate E Templeton; Sitha A Scheltinga; Matthias F C Beersma; Aloys C M Kroes; Eric C J Claas
Journal:  J Clin Microbiol       Date:  2004-04       Impact factor: 5.948

2.  Prospective study of respiratory viral infections in pediatric hemopoietic stem cell transplantation patients.

Authors:  Robbert G M Bredius; Kate E Templeton; Sitha A Scheltinga; Eric C J Claas; Aloys C M Kroes; Jaak M Vossen
Journal:  Pediatr Infect Dis J       Date:  2004-06       Impact factor: 2.129

3.  Molecular assays for detection of human metapneumovirus.

Authors:  Ian M Mackay; Kevin C Jacob; Daniel Woolhouse; Katharine Waller; Melanie W Syrmis; David M Whiley; David J Siebert; Michael Nissen; Theo P Sloots
Journal:  J Clin Microbiol       Date:  2003-01       Impact factor: 5.948

4.  Applicability of a real-time quantitative PCR assay for diagnosis of respiratory syncytial virus infection in immunocompromised adults.

Authors:  L J R van Elden; A M van Loon; A van der Beek; K A W Hendriksen; A I M Hoepelman; M G J van Kraaij; P Schipper; M Nijhuis
Journal:  J Clin Microbiol       Date:  2003-09       Impact factor: 5.948

5.  Frequent detection of human coronaviruses in clinical specimens from patients with respiratory tract infection by use of a novel real-time reverse-transcriptase polymerase chain reaction.

Authors:  Leontine J R van Elden; Anton M van Loon; Floris van Alphen; Karin A W Hendriksen; Andy I M Hoepelman; Marian G J van Kraaij; Jan-Jelrik Oosterheert; Pauline Schipper; Rob Schuurman; Monique Nijhuis
Journal:  J Infect Dis       Date:  2004-01-28       Impact factor: 5.226

  5 in total
  84 in total

1.  Comparison of the Luminex Respiratory Virus Panel fast assay with in-house real-time PCR for respiratory viral infection diagnosis.

Authors:  Naomi J Gadsby; Alison Hardie; Eric C J Claas; Kate E Templeton
Journal:  J Clin Microbiol       Date:  2010-03-31       Impact factor: 5.948

2.  Added value of an oropharyngeal swab in detection of viruses in children hospitalized with lower respiratory tract infection.

Authors:  Laura L Hammitt; Sidi Kazungu; Steve Welch; Anne Bett; Clayton O Onyango; Rory N Gunson; J Anthony G Scott; D James Nokes
Journal:  J Clin Microbiol       Date:  2011-04-13       Impact factor: 5.948

3.  Improved detection of respiratory viruses in pediatric outpatients with acute respiratory illness by real-time PCR using nasopharyngeal flocked swabs.

Authors:  Patrick Kiio Munywoki; Fauzat Hamid; Martin Mutunga; Steve Welch; Patricia Cane; D James Nokes
Journal:  J Clin Microbiol       Date:  2011-07-20       Impact factor: 5.948

4.  Comparison of four multiplex PCR assays for the detection of viral pathogens in respiratory specimens.

Authors:  Trevor P Anderson; Anja M Werno; Kevin Barratt; Patalee Mahagamasekera; David R Murdoch; Lance C Jennings
Journal:  J Virol Methods       Date:  2013-04-11       Impact factor: 2.014

5.  Clinical validation of a new triplex real-time polymerase chain reaction assay for the detection and discrimination of Herpes simplex virus types 1 and 2.

Authors:  Heide Reil; Ariane Bartlime; Jana Drerup; Thomas Grewing; Klaus Korn
Journal:  J Mol Diagn       Date:  2008-06-13       Impact factor: 5.568

6.  Identification of respiratory viruses in adults: nasopharyngeal versus oropharyngeal sampling.

Authors:  David Lieberman; Devora Lieberman; Avi Shimoni; Ayelet Keren-Naus; Rachel Steinberg; Yonat Shemer-Avni
Journal:  J Clin Microbiol       Date:  2009-09-02       Impact factor: 5.948

7.  RespiFinder: a new multiparameter test to differentially identify fifteen respiratory viruses.

Authors:  Martin Reijans; Gijs Dingemans; Corné H Klaassen; Jacques F Meis; Judith Keijdener; Brit Mulders; Kimberly Eadie; Willem van Leeuwen; Alex van Belkum; Alphons M Horrevorts; Guus Simons
Journal:  J Clin Microbiol       Date:  2008-02-06       Impact factor: 5.948

8.  Evaluation of a multiplex real-time PCR assay for the detection of respiratory viruses in clinical specimens.

Authors:  Insoo Rheem; Joowon Park; Tae-Hyun Kim; Jong Wan Kim
Journal:  Ann Lab Med       Date:  2012-10-17       Impact factor: 3.464

9.  Genetic relatedness of infecting and reinfecting respiratory syncytial virus strains identified in a birth cohort from rural Kenya.

Authors:  Charles N Agoti; Alexander G Mwihuri; Charles J Sande; Clayton O Onyango; Graham F Medley; Patricia A Cane; D James Nokes
Journal:  J Infect Dis       Date:  2012-09-10       Impact factor: 5.226

10.  Laboratory detection of respiratory viruses by automated techniques.

Authors:  Mercedes Pérez-Ruiz; Irene Pedrosa-Corral; Sara Sanbonmatsu-Gámez; María Navarro-Marí
Journal:  Open Virol J       Date:  2012-11-30
View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.