Literature DB >> 14988013

Silencing SARS-CoV Spike protein expression in cultured cells by RNA interference.

Yuanjiang Zhang1, Tieshi Li, Ling Fu, Changming Yu, Yinghua Li, Xialian Xu, Yinyin Wang, Hongxiu Ning, Shuping Zhang, Wei Chen, Lorne A Babiuk, Zhijie Chang.   

Abstract

The severe acute respiratory syndrome (SARS) has been one of the most epidemic diseases threatening human health all over the world. Based on clinical studies, SARS-CoV (the SARS-associated coronavirus), a novel coronavirus, is reported as the pathogen responsible for the disease. To date, no effective and specific therapeutic method can be used to treat patients suffering from SARS-CoV infection. RNA interference (RNAi) is a process by which the introduced small interfering RNA (siRNA) could cause the degradation of mRNA with identical sequence specificity. The RNAi methodology has been used as a tool to silence genes in cultured cells and in animals. Recently, this technique was employed in anti-virus infections in human immunodeficiency virus and hepatitis C/B virus. In this study, RNAi technology has been applied to explore the possibility for prevention of SARS-CoV infection. We constructed specific siRNAs targeting the S gene in SARS-CoV. We demonstrated that the siRNAs could effectively and specifically inhibit gene expression of Spike protein in SARS-CoV-infected cells. Our study provided evidence that RNAi could be a tool for inhibition of SARS-CoV.

Entities:  

Mesh:

Substances:

Year:  2004        PMID: 14988013      PMCID: PMC7127813          DOI: 10.1016/S0014-5793(04)00087-0

Source DB:  PubMed          Journal:  FEBS Lett        ISSN: 0014-5793            Impact factor:   4.124


Introduction

SARS‐CoV (the SARS‐associated coronavirus), which causes the severe acute respiratory syndrome, threatens the health of populations throughout the world [1, 2]. Although SARS is reported [3, 4, 5, 6, 7] as a novel coronavirus, it retains similar protein structures as other members of the coronavirus family [8]. The Spike protein of the coronavirus, with a molecular weight of 150 kDa, contains a large amino‐terminal ectodomain and short carboxy‐terminal endodomain bridged with a transmembrane domain. The ectodomain of the Spike protein is extensively glycosylated with N‐linked glycosylation and seems important for the interaction with the receptors on the surface of the host cells. The conformation change through dimerization of the Spike protein is reported to be critical for the fusion event between the viral envelope and cellular membrane for the coronavirus family [9]. Therefore, binding of antibody to the Spike protein could block the viron entrance into host cells for some of the coronaviruses. RNA interference (RNAi) (for reviews see [10, 11, 12, 13, 14]) is an innate cellular process, which is activated by a double‐stranded RNA molecule with 19–23‐nucleotide duplexes in cells from Caenorhabditis elegans to mammals [15]. The RNAi is triggered by degradation of single‐stranded RNAs of identical sequences. Therefore, RNAi technology can be used to silence gene expression by directly targeting its specific sequence of mRNA. Beside the widely used strategies for knocking down gene expression in academic research, RNAi technology, generated by small interfering RNAi (siRNA), has been used in therapeutic studies of human diseases including cancer, neurogenerative diseases and viral infectious diseases (reviewed in [14]). To date, RNAi technology is reported as an ideal tool to inhibit infectious virus replication in host cells because siRNA can target and silence the important genes of the virus [16]. Using poliovirus as a model, Gitlin et al. [17] demonstrated that siRNA could effectively protect human cells against infection by a rapidly replicating and highly cytolytic RNA virus. Hu et al. [18] reported that siRNA could block retroviral infection in chick embryos and inhibit the growth of the Rous sarcoma virus and human immunodeficiency virus (HIV) in cell culture. They found that the siRNA primarily prevented accumulation of the viral RNAs synthesized in the late stage of the infection, but did not degrade the RNA genome in the virus in the early stage of the infection. Other groups reported that siRNA could specifically inhibit HIV‐1 replication and virus propagation [19] through targeting major genes in the HIV life cycle, including p24 (the HIV long terminal repeat) [20, 21], vif, nef [19], tat and rev [22, 23]. RNAi has been also used in anti‐hepatitis C or B virus (HCV, HBV), which causes chronic liver disease including cirrhosis and hepatocellular carcinoma [24, 25, 26, 27, 28]. Papadia et al. [28], using a cell culture system, showed that the siRNAs generated from the HCV replicon could inhibit the HCV mRNA transcripts and protein expression. Those siRNAs could even inhibit HCV cDNA copies and OAS gene expression, which was induced by interferon‐α in virus‐infected host cells. Recently, McCaffrey et al. [26] reported that RNAi could be used in a mouse model to inhibit HBV replication. To search for a potential therapeutic method to prevent SARS‐CoV infection, we adopted RNAi technology based on reported studies in other infectious diseases. In this report, we targeted the Spike protein of SARS‐CoV using siRNAs generated from the DNA vector. We demonstrated that the siRNA could effectively and specifically silence gene expression of the Spike protein in SARSinfected cells.

Materials and methods

Vector construction

The vector with a U6 promoter (pBS/U6, a gift from Dr. Yang Shi at Harvard Medical School, Boson, MA, USA) was used to construct a 22 bp siRNAs. The hairpin cDNAs were generated through annealing of the complementary oligos synthesized, where ApaI and EcoRI sites were constructed. The hairpin cDNA insert was subcloned into the pBS/U6 vector through ApaI and EcoRI sites. The clones were verified by XhoI digestion. Finally the clones were sequence‐confirmed. The full length cDNA of the Spike protein was subcloned into a pCMV‐Myc expression vector (Invitrogen) with BamHI and EcoRI through polymerase chain reaction (PCR) generating restrictive enzymes in the 5′ and 3′ ends of the insert. The subcloned vector, pCMV‐Myc/HA‐Spike, was sequence‐confirmed for the correct frame in the expression vector. pEGFP‐N1 was from Clontech Laboratories.

Cell culture and transfection

Human embryonic kidney cell line 293T and African green monkey kidney cell line Vero E6 were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% heat‐inactivated fetal bovine serum (FBS), 100 U/ml penicillin and 100 μg/ml streptomycin. 293T cells were plated onto 6 well plates at a density of 4×105 cells per well and cultured at 37°C with 5% CO2 overnight for transfection. A total amount of 5 μg DNA per well was used for transient transfection with CalPhos (Clontech) according to the manufacturer's protocol. Vero E6 cells were plated onto 12 well plates at a density of 2×105 cells per well and cultured at 37°C with 5% CO2 overnight. The transfection was performed at 90% cell confluence with a total amount of 4 μg DNA per well using Lipofectamine 2000 (Invitrogen) following the manufacturer's protocol.

SARS‐CoV culture and infection

SARS‐CoV (strain BJ01, GenBank accession number genbank:AY278488), provided by the Institute of Microbiology and Epidemiology, AMMS, China, was propagated on Vero E6 cells. The virus was released from the infected cells by three freeze–thaw cycles. The titration of the virus was determined by plaque assay on Vero E6 cell monolayer. For the test of inhibition of the virus by siRNA, 2×105 transfected Vero E6 cells (with siRNA vectors) were infected with 5×105 multiplicity of infection (MOI) of SARS‐CoV (BJ01), in a final volume of 1 ml of DMEM with 2% FBS for 2 h at 37°C. Cells were then washed once with phosphate‐buffered saline (PBS, pH 7.4), before adding 2 ml complete medium to allow growth for 48 h at 37°C with 5% CO2. All those operations were performed in a bio‐safety P3 level lab.

Western blot

Cells overexpressing hemagglutinin (HA)‐tagged Spike protein were harvested 48 h post transfection and lysed with 0.3 ml of cold lysis buffer (20 mM Tris–HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X‐100, 1 mM NaVO3, 2.5 mM sodium pyrophosphate, 1 mM β‐glycerol phosphate, 1 mM phenylmethylsulfonyl fluoride, 5 μg/ml aprotinin, and 5 μg/ml leupeptin, pH 7.5). 30 μg of total protein from cell lysate was separated on 6% sodium dodecyl sulfatepolyacrylamide gel electrophoresis, electro‐transferred to nitrocellulose membrane (Hyclone ECI, Amersham Pharmacia Biotech). Antibodies directly to HA, enhanced green fluorescent protein (EGFP) and β‐actin, obtained from Santa Cruz, were used to blot the membranes according to the conditions the manufacturer provided. The signals were detected by enhanced chemiluminescence (ECL, Amersham).

Immunostaining

Transfected cells were incubated for about 24 h. Cells were fixed in 4% paraformaldehyde for 20 min at room temperature, and permeabilized with PBS containing 0.2% Triton X‐100 for 10 min. The cells were blocked with FDB (PBS with 1 mM CaCl2, 1 mM MgCl2, 5% normal goat serum, 10% fetal bovine serum and 2% bovine serum albumin) for 1 h, and were incubated with primary antibodies in FDB for 3 h. After washing with PBS containing 0.1% Triton X‐100, the cells were incubated with suitable secondary antibodies conjugated with fluorescent isothiocyanate (TRITC) for 1 h. Cells were washed with PBS three times before observation. The results were analyzed using a Nikon TE300 fluorescence microscope. Pictures were taken with a CCD camera (SPOT, Diagnostic Instrument, USA) equipped with a computer‐based image acquisition system.

RNA isolation and reverse transcription (RT) PCR

Total RNA from the transfected cells or infected cells was extracted using Trizol (Invitrogen). The PCR reaction was performed using the One Step RNA PCR kit (Takara, Japan) with 1 μg of total RNA for each sample. 1 μM of forward primer (5′‐TATAGGATCCCACCATGTTTATTTTCTTATTATTTCTTAC‐3′) and reverse primer (5′‐TATAGAATTCTGTGTAATGTAATTTGACACC‐3′) was used for the PCR reaction with 25 cycles of denaturation (94°C, 30 s), annealing (55°C, 1 min) and extension (68°C, 4 min). β‐Actin (forward primer, 5′‐CAAGAGATGGCCACGGCTGCT‐3′; reverse primer, 5′‐TCCTTCTGCATCCTGTCGGCA‐3′) was used as an internal control and the reaction conditions were 25 cycles of denaturation (94°C, 30 s), annealing (55°C, 50 s) and extension (68°C, 1 min).

Northern blot

Total RNA (10 μg) from SARS‐CoV‐infected cells was fractionated on a 1.3% formaldehydeagarose gel and transferred to a nitrocellulose membrane. Probe S‐gene (1350–1950 bp from ATG from the CDS of the S gene) was labeled with 32P using the Prime‐a‐Gene kit (Promega) according to the manufacturer's protocol. Hybridization was performed at 68°C for 2 h in hybridization buffer (Promega). Membranes were washed three times in 2×SSC with 0.1% sodium dodecyl sulfate at 50°C and autoradiographed by PhosphorImager (DNA Storm, Amersham Pharmacia Biotech).

Virus titration

Vero E6 cells were infected with 4×103 MOI SARS‐CoV (BJ01) per well 48 h post transfection with plasmids including pBS/U6, pBS/U6/GFPi and pBS/U6/S‐RNAi1/2. The virus was allowed to infect the cells for 2 h and then was completely withdrawn by washing with PBS. After incubation for 72 h, the cells were lysed and assayed for the level of virus (MOI) in 96 well plates.

Results

Selection of siRNA target sequences in mRNA of Spike protein

The coronavirus Spike protein plays a critical role in virus infection. Therefore, we chose the S gene as a target for inhibition of SARS‐CoV infection. To locate the target site of siRNA in the SARS‐CoV genome, we selected those sequences of 22 bp with the structure of AGN18TT. As an empirical design, we preferably chose the sites with GC/AT ratios between 30% and 60%. Also we used the selected sequences to search GenBank to confirm their specificity. In matching for those criteria, two specific target sequences were determined and noted, S‐RNAi1 and S‐RNAi2. A schematic presentation of the sequences is shown in Fig. 1A . Those two targeted sequences in the Spike protein were at 1358–1376 and 3081–3099 bp from the first ATG of the cDNA of the gene, which were located in the S1 and S2 region of the protein, respectively.
Figure 1

Target sites and vector information. A: Locations of siRNA target sites. S1 and S2 represent the S1 and S2 regions of Spike protein respectively. The targeted sequences for siRNA design are listed. B: Schematic of vector for generating siRNA. pBS/U6 promoter, sequence generating siRNA hairpin and transcriptional terminal signal are shown as indicated. C: Diagram of predicted structure of siRNAs from pBS/U6/S‐RNA1 and pBS/U6/S‐RNA2. UUCAAGAGA was used to generate the hairpin loop, indicated as a cycle.

Target sites and vector information. A: Locations of siRNA target sites. S1 and S2 represent the S1 and S2 regions of Spike protein respectively. The targeted sequences for siRNA design are listed. B: Schematic of vector for generating siRNA. pBS/U6 promoter, sequence generating siRNA hairpin and transcriptional terminal signal are shown as indicated. C: Diagram of predicted structure of siRNAs from pBS/U6/S‐RNA1 and pBS/U6/S‐RNA2. UUCAAGAGA was used to generate the hairpin loop, indicated as a cycle.

Construction of the vectors generating siRNA

Although siRNA could be chemically synthesized directly, the cDNA vector driven by a promoter is used in most cases [14] for convenience and economy reasons. In this study, we adopted the U6 promoter vector [29] and constructed a 22 bp siRNA through the hairpin, which could be produced by the DNA vector. The hairpin cDNAs were generated through annealing of the complementary oligos synthesized, where ApaI and EcoRI sites were constructed. The hairpin cDNA as an insert was subcloned into pBS/U6 vector through ApaI and EcoRI sites. The correct clones were verified by XhoI digestion, which was replaced by the insert. Finally, the clones were sequence‐confirmed. The single‐strand hairpin RNAs generated from the vectors were predicted as in Fig. 1C.

Expression of Spike protein in cultured cells

To generate an in vitro expression system of the Spike protein from SARS‐CoV, we adopted the mammalian cell culture method. The cDNA encoding the Spike protein from SARS‐CoV was constructed into pCMV‐Myc, a mammalian expression vector with a CMV promoter, which could drive the expression of the Spike protein in cultured cells. To detect the protein expression, the cDNA of Spike protein was tagged with HA at the C‐terminus (Fig. 2A , top panel). This construct was transfected into 293T cells and the expression of Spike protein was measured by Western blot. The data showed that the vector could drive the expression of Spike protein of SARS‐CoV in the cells at a high level (Fig. 2, top panel, lane 1) although the molecular weight of the expressed protein (>90 kDa) was smaller than the predicted one (105 kDa). To avoid different transfection efficiencies, we balanced the total amount of DNA with an EGFP expression vector. The data showed that the EGFP expressions were very even (Fig. 2, bottom panel, lanes 1, 3, and 4) and β‐actin level showed equal loading of samples (Fig. 2, middle panel), suggesting that the transfection experiments were controlled under identical conditions. Taken together, we overexpressed the Spike protein from SARS‐CoV in 293T cells, which could be used for the study of the gene silencing in the cultured cells.
Figure 2

Inhibition of expression of the Spike protein. Transfected siRNAs as indicated inhibited Spike protein expression. The Spike protein tagged with HA at the C‐terminus (HA‐Spike) overexpressed in the cells, which were co‐transfected with the indicated plasmids, was detected by Western blot using anti‐HA antibody from the lysates of the cells. β‐Actin and EGFP were used as internal and positive controls.

Inhibition of expression of the Spike protein. Transfected siRNAs as indicated inhibited Spike protein expression. The Spike protein tagged with HA at the C‐terminus (HA‐Spike) overexpressed in the cells, which were co‐transfected with the indicated plasmids, was detected by Western blot using anti‐HA antibody from the lysates of the cells. β‐Actin and EGFP were used as internal and positive controls.

Silencing of S gene expression in cells by siRNA

To determine whether the siRNA we generated could effectively reduce the expression of Spike protein in cultured cells, we first transfected the siRNA vectors pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 into 293T cells where Spike protein was overexpressed. To show the specificity of the siRNA targeting, we used EGFP as a control. From the data, it was clearly demonstrated that pBS/U6/EGFP‐RNAi could specifically silence the expression of EGFP protein in cells (Fig. 2, bottom panel, lane 2). However, pBS/U6/S‐RNAi1, pBS/U6/S‐RNAi2 or the vector alone (pBS/U6) had no effect on EGFP expression (Fig. 2, bottom panel, lanes 1, 3 and 4). Interestingly, both pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 could specifically impair the expression of Spike protein in cultured cells (Fig. 2, top panel, lanes 3 and 4), while pBS/U6/EGFP‐RNAi or the vector did not (Fig. 2, top panel, lanes 1 and 2). Meanwhile, all of the constructs had no effect on β‐actin expression (Fig. 2, middle panel). All these data suggest that siRNA targeting of the Spike protein in SARS‐CoV could block or silence the expression of Spike protein in mammalian cells. To show the silencing of the Spike protein in transfected cells, we also performed an immunostaining experiment using anti‐HA antibody. Similarly, we assessed EGFP expression by using fluorescence microscopy. The results showed that EGFP proteins were highly expressed in cells transfected with the expression vector in the presence of the co‐transfected pBS/U6 vector (Fig. 3a ), pBS/U6/S‐RNAi1 (Fig. 3e) and pBS/U6/S‐RNAi2 (Fig. 3g), but rarely expressed in cells in the presence of the co‐transfected pBS/U6/EGFP‐RNAi (Fig. 3c). In contrast, Spike protein could be detected at levels similar to the EGFP protein in the control panel (Fig. 3a,b). However, when pBS/U6/S‐RNAi1 (Fig. 3f) and pBS/U6/S‐RNAi2 (Fig. 3h) respectively were transfected into cells, Spike proteins were shown to be gradually reduced. These data suggest that pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 significantly blocked the expression of Spike protein in the cells, indicating that the siRNAs we designed functioned in our mammalian system.
Figure 3

Immunostaining for Spike protein in transfected cells. 293T cells were co‐transfected with pCMV‐Myc/HA‐Spike and pEGFP‐N1 vectors for 48 h in the presence of different siRNA plasmids as indicated. The cells were immunostained with anti‐HA antibody plus TRITC‐conjugated secondary antibody (red). The pictures were viewed with a Nikon TE300 microscope and captured with SPOT CCD software. The EGFP pictures were observed before immunostaining. The co‐transfected vectors are (a,b) empty vector pBS/U6, (c,d) pBS/U6/EGFP‐RNAi, (e,f) pBS/U6/S‐RNAi1, and (g,h) pBS/U6/S‐RNAi2.

Immunostaining for Spike protein in transfected cells. 293T cells were co‐transfected with pCMV‐Myc/HA‐Spike and pEGFP‐N1 vectors for 48 h in the presence of different siRNA plasmids as indicated. The cells were immunostained with anti‐HA antibody plus TRITC‐conjugated secondary antibody (red). The pictures were viewed with a Nikon TE300 microscope and captured with SPOT CCD software. The EGFP pictures were observed before immunostaining. The co‐transfected vectors are (a,b) empty vector pBS/U6, (c,d) pBS/U6/EGFP‐RNAi, (e,f) pBS/U6/S‐RNAi1, and (g,h) pBS/U6/S‐RNAi2. To verify the inhibition of Spike protein expression by siRNAs through the inhibition of the S gene, semi‐quantitative RT‐PCR was performed. The data show that pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 reduced the accumulation of mRNA S gene (Fig. 4 , lanes 3 and 4 compared to lane 2) while it had no effect on β‐actin mRNA. These data indicate that siRNAs inhibited Spike protein expression through blocking mRNA accumulation.
Figure 4

Reduced mRNA accumulation of the S gene in cells overexpressing Spike protein. 293T cells were co‐transfected with the S gene expression vector (pCMV‐Myc/HA‐Spike) and the indicated plasmids for siRNA or control vectors. Cells were harvested after transfection for 2 days. RT‐PCR products for the S gene and the internal control, β‐actin, are shown as indicated molecular weights.

Reduced mRNA accumulation of the S gene in cells overexpressing Spike protein. 293T cells were co‐transfected with the S gene expression vector (pCMV‐Myc/HA‐Spike) and the indicated plasmids for siRNA or control vectors. Cells were harvested after transfection for 2 days. RT‐PCR products for the S gene and the internal control, β‐actin, are shown as indicated molecular weights.

Inhibition of SARS‐CoV infection by siRNA in cultured cells

To determine whether the vector‐based siRNA could efficiently prevent SARS‐CoV infection of cells, we transfected 2, 3 and 4 μg of pBS/U6/S‐RNAi1 (Fig. 5 , lanes 3–5), and pBS/U6/S‐RNAi2 (Fig. 5, lanes 6–8) into Vero E6 cells in a 12 well plate. As controls, the pBS/U6 vector alone (Fig. 5, lane 1) and pBS/U6/EGFP‐RNAi (as a non‐related gene RNAi, Fig. 5, lane 2) were also transfected into parallel cells. After incubation for 1 day, the transfected cells were infected with SARS‐CoV (BJ01) at 5×105 MOI per well with 2×105 cells. The cells were harvested and the total RNA was isolated for RT‐PCR to measure S gene expression. The data indicate that both pBS/U6/S‐RNAi1 and pBS/U6/S‐RNAi2 could effectively inhibit gene expression of the Spike protein in the SARS‐CoV‐infected cells (compare lanes 3 and 6 to lanes 1 and 2 in Fig. 5). As expected, with the increasing amounts of siRNA transfected, there was increasing inhibition of S gene expression (compare lanes 3–5 and lanes 6–8 in Fig. 5). Those data were reconfirmed by Northern blots (Fig. 6 , same design as Fig. 5), suggesting that the siRNA we generated could block S gene expression of SARS‐CoV in the infected cells.
Figure 5

Dose‐dependent inhibition of S gene mRNA accumulation. The Vero E6 cells were transfected with the indicated plasmids for one day. Thereafter, the cells were infected with SARS‐CoV (BJ01) at 5×105 MOI/ml. After 2 days of infection, the cells were harvested with Trizol (Promega) for RNA isolation in a P3 lab. RT‐PCR was performed to show the accumulation of S gene mRNA from the infected SARS‐CoV. Increasing amounts of siRNA vectors transfected are indicated. RT‐PCR products for the S gene and the internal control, β‐actin, are shown as indicated molecular weights.

Figure 6

Northern blot of S gene mRNA in the transfected cells. The Vero E6 cells were transfected with the indicated plasmids and treated with SARS‐CoV as in Fig. 5. The total RNA was subjected to Northern blot analysis with 32P‐labeled probes amplified from SARS‐CoV cDNA (BJ01) and GAPDH. The abundance of S gene mRNA and GAPDH is indicated.

Dose‐dependent inhibition of S gene mRNA accumulation. The Vero E6 cells were transfected with the indicated plasmids for one day. Thereafter, the cells were infected with SARS‐CoV (BJ01) at 5×105 MOI/ml. After 2 days of infection, the cells were harvested with Trizol (Promega) for RNA isolation in a P3 lab. RT‐PCR was performed to show the accumulation of S gene mRNA from the infected SARS‐CoV. Increasing amounts of siRNA vectors transfected are indicated. RT‐PCR products for the S gene and the internal control, β‐actin, are shown as indicated molecular weights. Northern blot of S gene mRNA in the transfected cells. The Vero E6 cells were transfected with the indicated plasmids and treated with SARS‐CoV as in Fig. 5. The total RNA was subjected to Northern blot analysis with 32P‐labeled probes amplified from SARS‐CoV cDNA (BJ01) and GAPDH. The abundance of S gene mRNA and GAPDH is indicated.

siRNA inhibited the replication of SARS‐CoV from the infected cells

Since SARS‐CoV can replicate rapidly in cells we tested the ability of siRNA to inhibit virus production. After 72 h of culture, the virus in the medium of the cells should represent the newly replicated virus in the cells. To validate the siRNA effects on replication of SARS‐CoV, we performed virus titration assays by assaying for extracellular virus in infected cells 72 h post infection. The data showed that the control plate had high titers of virus (Fig. 7 , lane 1), suggesting the virus replicated in the cells during the 72 h culture period. In contrast, the virus titer was dramatically decreased in the plate where the cells were transfected with siRNA (Fig. 7, lanes 2 and 3), demonstrating that the siRNA inhibited virus replication. Both pBS/U6 and pBS/U6/EGFP‐RNAi treatments had similar levels of virus to that of the control, suggesting the RNAi effect was specific.
Figure 7

SARS‐CoV titration in the medium of the infected cells. The indicated Vero E6 cells were infected with SARS‐CoV for 2 h and then the virus was washed off with medium. The virus titrations were determined for the supernatant (medium) of the infected cells cultured for 72 h after infection. (+) indicates cells infected with SARS‐CoV, (−) indicates normal cultured cells.

SARS‐CoV titration in the medium of the infected cells. The indicated Vero E6 cells were infected with SARS‐CoV for 2 h and then the virus was washed off with medium. The virus titrations were determined for the supernatant (medium) of the infected cells cultured for 72 h after infection. (+) indicates cells infected with SARS‐CoV, (−) indicates normal cultured cells.

Discussion

SARS‐CoV has been classified as a novel member of the coronavirus family with significantly different genome sequences [4, 7, 30]. However, the structure of the virus is similar to the other coronaviruses, which contain a spike protein thought to play an important role in viral entry and pathogenesis [9]. In an attempt to prevent and inhibit SARS‐CoV replication, we employed RNAi technology, which has been used to silence virus gene expression in HIV and HCV/HBV. In this paper, we provide evidence that a DNA vector‐based siRNA could effectively and specifically inhibit gene expression of the Spike protein from SARS‐CoV. Initially, we showed that siRNAs silenced the expression of Spike protein in cells transfected with S gene expression vector. Both Western blot and immunostaining experiments consistently suggested that the DNA vectors carrying the siRNA hairpin targeted the overexpressed S gene in cells. We also showed that the mRNA level was decreased when siRNAs were transfected into the cells. This model system demonstrated the inhibition of gene expression of the virus as in the case of inhibition of HIV and HCV/HBV [18, 19, 21, 22, 23, 27, 28, 31, 32, 33]. The genome sequence revealed SARS‐CoV as a novel coronavirus, in which the typical Spike protein and other proteins were predicted. However, there is no report on the isolation and purification of Spike protein from SARS‐CoV‐infected cells or tissues. In this report we used the recombinant Spike protein cDNA from the SARS‐CoV genome and expressed the protein in 293T cells. The molecular weight of the expressed HA‐tagged protein was smaller than the predicted one, suggesting the modification of Spike protein in mammalian cells. Our data showed that this expression vector could be targeted by the siRNAs. Because there is no anti‐Spike protein antibody generated, this is a direct way to detect the inhibition of the protein expression by siRNA in cultured cells. Importantly, after demonstration that siRNAs inhibited Spike protein expression in cells transfected with the expression vector, we used Vero E6 cells, which were reported to be susceptible to SARS‐CoV infection and replication. We infected the cells with SARS‐CoV (strain BJ01) and found, through both RT‐PCR and Northern blot, that siRNAs could significantly inhibit S gene mRNA accumulation, suggesting that siRNAs might inhibit SARS‐CoV replication in cells. This could be further demonstrated by the evaluation of the virus yields from the cells. We consider that the virus in the medium after 72 h of culture represents newly replicated virus. Therefore, the decreased yields of virus in the medium confirmed that virus replication was inhibited by the siRNAs we designed. Taken together, we report that the designed siRNA vectors targeting the mRNA of Spike protein from SARS‐CoV could specifically and effectively silence gene expression in mammalian cells. This study provides evidence that siRNA could be employed as a potential tool to inhibit gene expression of the Spike protein of SARS‐CoV. To our knowledge, this is the first report that siRNA could be used for inhibition of SARS‐CoV in cells. Whether those siRNAs could be used in animal models for SARS‐CoV infection is under investigation.
  34 in total

Review 1.  RNA-triggered gene silencing.

Authors:  A Fire
Journal:  Trends Genet       Date:  1999-09       Impact factor: 11.639

2.  Interfering with gene expression.

Authors:  J Marx
Journal:  Science       Date:  2000-05-26       Impact factor: 47.728

3.  RNA interference of HIV replication.

Authors:  Miguel Angel Martínez; Bonaventura Clotet; José A Esté
Journal:  Trends Immunol       Date:  2002-12       Impact factor: 16.687

4.  RNAi puts a lid on virus replication.

Authors:  Raul Andino
Journal:  Nat Biotechnol       Date:  2003-06       Impact factor: 54.908

5.  Inhibition of viral gene expression and replication in mosquito cells by dsRNA-triggered RNA interference.

Authors:  Natasha J Caplen; Zhili Zheng; Barry Falgout; Richard A Morgan
Journal:  Mol Ther       Date:  2002-08       Impact factor: 11.454

Review 6.  Coronavirus spike proteins in viral entry and pathogenesis.

Authors:  T M Gallagher; M J Buchmeier
Journal:  Virology       Date:  2001-01-20       Impact factor: 3.616

7.  Inhibition of intracellular hepatitis C virus replication by synthetic and vector-derived small interfering RNAs.

Authors:  Takanori Yokota; Naoya Sakamoto; Nobuyuki Enomoto; Yoko Tanabe; Makoto Miyagishi; Shinya Maekawa; Li Yi; Masayuki Kurosaki; Kazunari Taira; Mamoru Watanabe; Hidehiro Mizusawa
Journal:  EMBO Rep       Date:  2003-06       Impact factor: 8.807

8.  Coronavirus main proteinase (3CLpro) structure: basis for design of anti-SARS drugs.

Authors:  Kanchan Anand; John Ziebuhr; Parvesh Wadhwani; Jeroen R Mesters; Rolf Hilgenfeld
Journal:  Science       Date:  2003-05-13       Impact factor: 47.728

9.  Potent and specific inhibition of human immunodeficiency virus type 1 replication by RNA interference.

Authors:  Glen A Coburn; Bryan R Cullen
Journal:  J Virol       Date:  2002-09       Impact factor: 5.103

10.  Inhibition of HIV-1 infection by small interfering RNA-mediated RNA interference.

Authors:  John Capodici; Katalin Karikó; Drew Weissman
Journal:  J Immunol       Date:  2002-11-01       Impact factor: 5.422

View more
  71 in total

Review 1.  RNA interference and antiviral therapy.

Authors:  Yan Ma; Chu-Yan Chan; Ming-Liang He
Journal:  World J Gastroenterol       Date:  2007-10-21       Impact factor: 5.742

2.  Cloning and identification of microRNAs in bovine alveolar macrophages.

Authors:  Guangxian Xu; Yan Zhang; Hao Jia; Juan Li; Xiaoming Liu; John F Engelhardt; Yujiong Wang
Journal:  Mol Cell Biochem       Date:  2009-06-09       Impact factor: 3.396

3.  Application of siRNA against SARS in the rhesus macaque model.

Authors:  Qingquan Tang; Baojian Li; Martin Woodle; Patrick Y Lu
Journal:  Methods Mol Biol       Date:  2008

4.  Inhibition, escape, and attenuated growth of severe acute respiratory syndrome coronavirus treated with antisense morpholino oligomers.

Authors:  Benjamin W Neuman; David A Stein; Andrew D Kroeker; Michael J Churchill; Alice M Kim; Peter Kuhn; Philip Dawson; Hong M Moulton; Richard K Bestwick; Patrick L Iversen; Michael J Buchmeier
Journal:  J Virol       Date:  2005-08       Impact factor: 5.103

5.  Efficient Inhibition of Avian and Seasonal Influenza A Viruses by a Virus-Specific Dicer-Substrate Small Interfering RNA Swarm in Human Monocyte-Derived Macrophages and Dendritic Cells.

Authors:  Miao Jiang; Pamela Österlund; Veera Westenius; Deyin Guo; Minna M Poranen; Dennis H Bamford; Ilkka Julkunen
Journal:  J Virol       Date:  2019-02-05       Impact factor: 5.103

6.  Emerging Technologies for the Treatment of COVID-19.

Authors:  Hossein Aghamollaei; Rahim Sarvestani; Hamid Bakherad; Hamed Zare; Paul C Guest; Reza Ranjbar; Amirhossein Sahebkar
Journal:  Adv Exp Med Biol       Date:  2021       Impact factor: 2.622

7.  ZNF536, a novel zinc finger protein specifically expressed in the brain, negatively regulates neuron differentiation by repressing retinoic acid-induced gene transcription.

Authors:  Zhen Qin; Fangli Ren; Xialian Xu; Yongming Ren; Hongge Li; Yinyin Wang; Yonggong Zhai; Zhijie Chang
Journal:  Mol Cell Biol       Date:  2009-04-27       Impact factor: 4.272

8.  Inhibition of West Nile Virus replication by retrovirus-delivered small interfering RNA in human neuroblastoma cells.

Authors:  Yongbo Yang; Chengxiang Wu; Jianguo Wu; Vivek R Nerurkar; Richard Yanagihara; Yuanan Lu
Journal:  J Med Virol       Date:  2008-05       Impact factor: 2.327

Review 9.  Respiratory viruses other than influenza virus: impact and therapeutic advances.

Authors:  W Garrett Nichols; Angela J Peck Campbell; Michael Boeckh
Journal:  Clin Microbiol Rev       Date:  2008-04       Impact factor: 26.132

Review 10.  The spike protein of SARS-CoV--a target for vaccine and therapeutic development.

Authors:  Lanying Du; Yuxian He; Yusen Zhou; Shuwen Liu; Bo-Jian Zheng; Shibo Jiang
Journal:  Nat Rev Microbiol       Date:  2009-02-09       Impact factor: 60.633

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.