Literature DB >> 12423551

Molecular characterisation of drug-resistant Plasmodium falciparum from Thailand.

Dinora Lopes1, Kanchana Rungsihirunrat, Fátima Nogueira, Aree Seugorn, José Pedro Gil, Virgilio E do Rosário, Pedro Cravo.   

Abstract

BACKGROUND: The increasing levels of Plasmodium falciparum resistance to chloroquine (CQ) in Thailand have led to the use of alternative antimalarials, which are at present also becoming ineffective. In this context, any strategies that help improve the surveillance of drug resistance, become crucial in overcoming the problem.
METHODS: In the present study, we have established the in vitro sensitivity to CQ, mefloquine (MF), quinine (QUIN) and amodiaquine (AMQ) of 52 P. falciparum isolates collected in Thailand, and assessed the prevalence of four putative genetic polymorphisms of drug resistance, pfcrt K76T, pfmdr1 N86Y, pfmdr1 D1042N and pfmdr1 Y1246D, by PCR-RFLP.
RESULTS: The percentage of isolates resistant to CQ, MF, and AMQ was 96% (50/52), 62% (32/52), and 58% (18/31), respectively, while all parasites were found to be sensitive to QUIN. In addition, 41 (79%) of the isolates assayed were resistant simultaneously to more than one drug; 25 to CQ and MF, 9 to CQ and AMQ, and 7 to all three drugs, CQ, MF and AMQ. There were two significant associations between drug sensitivity and presence of particular molecular markers, i) CQ resistance / pfcrt 76T (P = 0.001), and ii) MF resistance / pfmdr1 86N (P < 0.001)
CONCLUSIONS: i) In Thailand, the high levels of CQ pressure have led to strong selection of the pfcrt 76T polymorphism and ii) pfmdr1 86N appears to be a good predictor of in vitro MF resistance.

Entities:  

Mesh:

Substances:

Year:  2002        PMID: 12423551      PMCID: PMC149383          DOI: 10.1186/1475-2875-1-12

Source DB:  PubMed          Journal:  Malar J        ISSN: 1475-2875            Impact factor:   2.979


Background

Malaria due to Plasmodium falciparum affects 300 million people and claims an estimated 1.5 million lives every year. Our present inability to synthesise a fully protective vaccine means that chemotherapy stands as the only effective measure in the control of the disease. However, in many parts of the world the parasite P. falciparum has become resistant to most drugs presently used [1], seriously undermining efforts for controlling malaria. Chloroquine (CQ) has long been the drug of choice for the treatment of malaria; however, CQ-resistant parasites are now present in most areas where malaria is endemic [2]. Chloroquine resistance is especially well established in Thailand, after having been first described in that country in the late 1950's [3]. The decline in the efficacy of chloroquine has led to the use of alternative antimalarials, such as antifolates, mefloquine and artemisinin derivatives, but parasite resistance to these drugs is also becoming a real problem [2]. In this context, understanding the genetic basis of drug resistance is essential for implementing rational measures to overcome the problem. Although significant progress has been made in trying to understand how resistance to CQ may occur, many aspects of it remain unclear, and the genetic mechanisms responsible for mefloquine and quinine resistance are largely unknown. Nevertheless, two main genes have been implicated in quinoline resistance; the pfmdr1 (P. falciparum multi-drug resistance1) and the Pfcrt (P. falciparum chloroquine resistance transporter). There is evidence from the analysis of a genetic cross which indicates that point polymorphisms in the pfmdr1 gene may modulate sensitivity to both mefloquine (MF) and artemisinin in P. falciparum[4]. Furthermore, recent genetic transfection work has suggested that single nucleotide polymorphisms in the pfmdr1 gene encoding changes in aminoacids 1034, 1042 and 1246 can influence parasite responses to mefloquine, quinine and halofantrine as well as to the structurally unrelated drug artemisinin, and modulate sensitivity to chloroquine depending on the genetic background of the parasites strains [5]. However, chloroquine resistance was shown to segregate independently of the pfmdr1 gene, following a genetic cross between a CQ-sensitive parasite, P. falciparum HB3, and a CQ-resistant one, Dd2 [6], and the absence of a clear association between pfmdr1 and chloroquine responses in natural parasite populations [7-15], strongly suggests the involvement of other gene(s). Recently, detailed linkage analysis and fine chromosome mapping of progeny clones of the HB3 × Dd2 cross has allowed the identification of another gene, pfcrt, in which a mutation at aminoacid 76 (pfcrt K76T) is highly correlated with increased CQ tolerance among field parasite isolates of P. falciparum[16-24]. In addition, a causal relationship between pfcrt 76T and chloroquine resistance has been confirmed by genetic transfection experiments [16]. The study of the correlation between drug resistance in natural parasite populations and genetic polymorphisms may allow the development of molecular tools to help predict responses to drugs and, as mentioned above, the pfcrt and pfmdr1 genes have been identified as putative markers of quinoline resistance. In the present work we have investigated possible associations between four molecular markers in these genes and sensitivity to chloroquine, mefloquine, quinine (QUIN) and amodiaquine (AMQ) of P. falciparum parasites collected in Thailand.

Methods

Study site and method of parasite collection

After confirmation of P. falciparum infection by microscopical observation of thin and thick Giemsa-stained blood films, approximately 20 μl of blood were collected by finger-prick from consenting subjects living in 4 different areas of Thailand where malaria is highly endemic; the Tak province (North-western Thailand), Kanchanaburi (Western Thailand: Thai-Myanmar border), Chonburi (Eastern Thailand), Chantaburi and Trat (Eastern Thailand: Thai-Cambodia border). Samples were placed in sterile 1.5 ml micro-centrifuge tubes, together with 0.5 ml of transport medium (10 ml RPMI 1640 complete medium without serum, plus 20 μl of heparin 5000 i.u./ml), carried to Chulalongkorn University of Bangkok on the day of collection, at ambient temperature and placed in in vitro culture, following established procedures [25].

Parasite phenotyping (micro-tests)

Assessment of P. falciparum susceptibility to CQ, MF, QUIN and AMQ was performed according to the M.I.C. test [26,27], whereby samples were exposed to a range of concentrations of the four drugs, in microtitre culture plates, for 72 hours, with daily changes of medium (in the presence or absence of drugs). After this period, thin film Giemsa-stained preparations from each culture plate well were observed under light microscopy for the presence of parasites. The results were expressed in "minimum inhibiting concentration" (M.I.C.) units, i.e., the lowest drug concentration required to kill all or nearly all parasites (I.C.99) after 72 hours [26,27]. Parasite reference strains of known sensitivity to the drugs concerned were tested in parallel to all field-collected isolates. In this manner, the drug response of each isolate was determined by comparison of the M.I.C. between each sample and the relevant reference strains. Accordingly, samples tested for CQ, MF, QUIN and AMQ responses were clustered into two groups; sensitive (S) or resistant (R) based on sensitivity thresholds established in previous studies [26-29].

Genotyping by PCR-RFLP

Genomic DNA was extracted prior to drug testing, by a standard phenol:chloroform DNA extraction method, precipitated with absolute ethanol and stored in TE Buffer (Tris-EDTA), following established protocols [30]. The resulting DNA was used as template in 50 μl PCR reactions, containing 1 μM of each oligonucleotide primer, 1 × PCR buffer (Promega™), 2.5 mM MgCl2, 0.2 mM dNTP's and 0.025 U/μl of Promega™ Taq DNA polymerase. Accordingly, a fragment of the pfcrt gene containing codon 76 was amplified by PCR using a Nested-PCR approach. For amplification of DNA fragments containing pfmdr1 polymorphisms we used oligonucleotide primers published elsewhere [31], as well as newly designed ones. In this manner, the fragments of the pfmdr1 gene containing codons 86 and 1246 were amplified in a single-step PCR, whereas the sequence of codon pfmdr1 1042 was determined following amplification by semi-nested PCR. All primer sequences and respective PCR conditions are presented in Table 1.
Table 1

Polymerase Chain Reaction for amplification of fragments containing pfcrt and pfmdr1 gene polymorphisms

PrimerSequence (5' → 3')PCR
Pfcrt 76
1st round senseCAAGAAGGAAGTAAGTATCCAAAAATGG94°C, 30''; 56°C, 30''; 60°C, 60''; 45 cycles
AntisenseGTAGTTCTTGTAAGACCTATGAAGGC
Nested senseGCAAAAATGACGAGCGTTATAGAG94°C, 30''; 59°C, 30''; 60°C, 60''; 45 cycles
AntisenseCTGAACAGGCATCTAACATGGATATAGC
Pfmdr1 86
SenseATGGGTAAAGAGCAGAAAGAG94°C, 30''; 53°C, 30''; 68°C, 60''; 10 cycles, followed by 94°C, 30''; 50°C, 30''; 68°C, 60'', 35 cycles
AntisenseCGTACCAATTCCTGAACTCAC
Pfmdr1 1042
1st round senseTATGTCAAGCGGAGTTTTTGC94°C, 30''; 50°C, 30''; 68°C, 60''; 45 cycles
AntisenseTCTGAATCTCCTTTTAAGGAC
Semi-nested senseGTAAATGCAGCTTTATGGG94°C, 30''; 50°C, 30''; 68°C, 60''; 45 cycles
AntisenseTCTGAATCTCCTTTTAAGGAC
Pfmdr1 1246
SenseCTACAGCAATCGTTGGAGAAA94°C, 30''; 53°C, 30''; 68°C, 60''; 10 cycles, followed by 94°C, 30''; 50°C, 30''; 68°C, 60'', 35 cycles
AntisenseGCTCTAGCTATAGCTATTCTC
Polymerase Chain Reaction for amplification of fragments containing pfcrt and pfmdr1 gene polymorphisms

Restriction enzymes generating RFLPs

Following amplification of the fragments concerned, polymorphisms in the pfcrt and pfmdr1 genes were assessed as follows: pfcrt 76K and pfmdr1 86N were detected by incubation of the corresponding PCR fragments with ApoI (r/aatty), pfmdr1 1042N was detected using AsnI (at/taat), and pfmdr1 1246Y was determined by incubation with EcoRV (gat/atc). Endonucleases ApoI, AsnI and EcoRV had been obtained from New England BioLabs™, Roche Molecular Biochemicals™ and Stratagene™ respectively, and incubations were setup following the manufacturers instructions. Appropriate control DNA of samples with known pfcrt and pfmdr1 sequences was used in parallel with field-collected parasite isolates in every PCR-RFLP protocol; these were 3D7 (genotype pfcrt 76K, pfmdr1 86N, pfmdr1 1042N, pfmdr1 1246D), HB3 (genotype pfmdr1 1042D), Dd2 (genotype pfcrt 76T, pfmdr1 86Y) and 180/92 (genotype pfmdr1 1246Y). The products resulting from restrictions of pfmdr1 1042 were resolved in 8% acrylamide gels, whereas pfmdr1 86, pfmdr1 1246 and pfcrt 76 digests were run on 2% agarose gels, with both types of gels made in 1 × TBE buffer. All gels were stained with ethidium bromide and visualised under UV (ultraviolet) transillumination.

Statistical analysis of the association between pfcrt and pfmdr1 markers and drug responses

We searched for statistically significant associations between sensitivity to each of the drugs among all isolates and the presence of each of the particular markers included in our study by using Fisher's Exact Test (2-tailed) after having arranged the data in 2 × 2 contingency tables (mixed infections were excluded from this analysis). An association between a particular marker and resistance to a given drug was considered to be significant if the P value was found to be lower than 0.05 (P < 0.05).

Results

Responses to drugs

In total, 52 samples were analysed in vitro for their susceptibility to chloroquine, mefloquine and quinine, and 31 for amodiaquine. The results of these tests are presented in Table 2.
Table 2

Results of in vitro drug tests (CQ-chloroquine; MF-mefloquine; QUIN-quinine; AMQ-amodiaquine; S-sensitive; R-resistant)

CQMFQUINAMQCQ+MF onlyCQ+AMQ onlyMF+AMQ onlyCQ+MF+AMQ

S4% (2/52)38% (20/52)100% (52/52)42% (13/31)----
R96% (50/52)62% (32/52)-58% (18/31)48% (25/52)29% (9/31)-(0/31)23% (7/31)
Results of in vitro drug tests (CQ-chloroquine; MF-mefloquine; QUIN-quinine; AMQ-amodiaquine; S-sensitive; R-resistant)

Pfcrt and pfmdr1 genotypes

The pfcrt 76 PCR primers amplified a sub-fragment of the gene comprising 479 nucleotides, containing both a monomorphic and a polymorphic ApoI restriction site. In this manner, incubation of this fragment with endonuclease ApoI generated either 3 fragments of 122, 124 and 233 base-pairs (b.p.), or 2 fragments of 233 and 246 b.p., if K or T were present respectively (Figure 1). The PCR of pfmdr1 86 amplified a fragment of 504 b.p., within which the presence of asparagine (N) was determined by incubation with ApoI, originating segments of 255 and 249 b.p., which resolved as a single band in 2% agarose gels (Figure 1). For detection of 1042 polymorphisms (N or D) the 188 b.p. fragment obtained by PCR could be restricted with endonuclease AsnI, after which 3 segments were obtained of 116, 46 and 26 b.p. if 1042N were present in the sample, and two fragments of 162 and 26 b.p. in the presence of the alternative aminoacid (as with pfcrt 76, one of the restriction sites for AsnI within this segment is also monomorphic, therefore always resulting in at least one cut) (Figure 1). Codon 1246 polymorphisms (D or Y) were assayed following incubation of the corresponding 508 b.p. PCR product with EcoRV, which produced 2 fragments of 268 and 240 b.p. if the target DNA contained tyrosine (Y) (Figure 1). All data resulting from this analysis is compiled in Table 3, where allele frequencies for each of the markers are shown.
Figure 1

Agarose (pfmdr1 86, pfmdr1 1246, pfcrt 76), and acrylamide (pfmdr1 1042) gels showing PCR products and corresponding restriction digests, of control and field-collected samples of P. falciparum. (PCR-RFLP controls – 3D7 (genotype pfcrt 76K, pfmdr1 86N, pfmdr1 1042N, pfmdr1 1246D), HB3 (genotype pfmdr1 1042D), Dd2 (genotype pfcrt 76T, pfmdr1 86Y) and 180/92 (genotype pfmdr1 1246Y); IV, V and VIII – DNA Molecular Weight Markers IV, Bioline; V and VIII, Roche)

Table 3

Frequencies of allelic polymorphisms in the pfcrt and pfmdr1 genes

PfcrtPfmdr1
Allele76K76TMixed86N86YMixed1042N1042DMixed1246D1246YMixed
Frequency.04.83.13.60.23.17.92.080.92.02.06
Agarose (pfmdr1 86, pfmdr1 1246, pfcrt 76), and acrylamide (pfmdr1 1042) gels showing PCR products and corresponding restriction digests, of control and field-collected samples of P. falciparum. (PCR-RFLP controls – 3D7 (genotype pfcrt 76K, pfmdr1 86N, pfmdr1 1042N, pfmdr1 1246D), HB3 (genotype pfmdr1 1042D), Dd2 (genotype pfcrt 76T, pfmdr1 86Y) and 180/92 (genotype pfmdr1 1246Y); IV, V and VIII – DNA Molecular Weight Markers IV, Bioline; V and VIII, Roche) Frequencies of allelic polymorphisms in the pfcrt and pfmdr1 genes

Association between pfcrt and pfmdr1 markers and responses to drugs

Two significant correlations were detected between the presence of a particular marker and in vitro outcomes (Tables 4 and 5); one between CQ resistance and the presence of pfcrt 76T (P = 0.001) and the other, between MF resistance and the presence of pfmdr1 86N (P < 0.001). There was an evident lack of an association between AMQ responses and all of the markers studied (Table 6), a fact that was corroborated after statistical analysis (data not shown). In addition, since all isolates proved to be quinine sensitive, any correlations between response to this drug and corresponding genotypes could not be established. The data of the in vitro tests for the 4 drugs, and corresponding genotypes is compiled in Table 7.
Table 4

Plasmodium falciparum isolates listed according to sensitivity to chloroquine (CQ), with corresponding pfcrt and pfmdr1 markers

pfmdr1
IsolateCQpfcrt 768610421246
T9/94b3SKYND
TM408SKNND
T101RTNND
T108RTNND
T113RTNND
T115RTNND
T116RTNND
T120RTYND
T123RTNDD
T130RTNND
T131RTNND
T132RTNND
T133RTNND
S3RTYND
S64RTYND
S71RTYND
S90RTYDD
S118RTYND
S149RTNYNDY
S151RKTNYND
S152RTYND
S153RTYND
S157RKTNYND
S160RKTNYNDY
CH1RTYDD
CH3RTYDD
CH7RTNND
TD2RTNND
TD3RTNND
TD8RTNND
TD14RTNND
TD21RTNND
TD27RTNND
TD49RTNND
TD56RTNND
TD61RKTNND
TD62RTNND
TD64RTNNDY
TD79RKTNND
TD134RTNND
TD328RKTNND
TP4RTYND
TP7RTNYND
TP13RTNYndD
TP17RTNYND
TP18RTNND
TP20RTNYND
TP21RKTNndD
TP26RTNND
TP34RTNND
TP40RTNndY
RC17RTNYND

(S – sensitive; R – resistant; KT, NY and DY – mixed infections; nd – not determined; P = 0.001 for the association between CQR and presence of pfcrt 76T, mixed alleles excluded)

Table 5

Plasmodium falciparum isolates listed according to sensitivity to mefloquine (MF), with corresponding pfcrt and pfmdr1 markers

pfmdr1
IsolateMFpfcrt 768610421246
T9/94b3SKYND
S3STYND
S64STYND
S71STYND
S90STYDD
S118STYND
S149STNYNDY
S151SKTNYND
S152STYND
S153STYND
S157SKTNYND
S160SKTNYNDY
CH1STYDD
CH3STYDD
TP4STYND
TP7STNYND
TP13STNYndD
TP17STNYND
TP18STNND
TP40STNndY

TM408RKNND
TP20RTNYND
TP21RKTNndD
RC17RTNYND
T108RTNND
T113RTNND
T115RTNND
T130RTNND
T131RTNND
T132RTNND
TD61RKTNND
TD14RTNND
T101RTNND
T116RTNND
T120RTYND
T123RTNDD
T133RTNND
CH7RTNND
TD2RTNND
TD3RTNND
TD8RTNND
TD21RTNND
TD27RTNND
TD49RTNND
TD62RTNND
TD134RTNND
TD328RKTNND
TD56RTNND
TD64RTNNDY
TD79RKTNND
TP26RTNND
TP34RTNND

(S – sensitive; R – resistant; KT, NY and DY – mixed infections; nd – not determined; P < 0.001 for the association between MFR and presence of pfmdr1 86N, mixed alleles excluded)

Table 6

Plasmodium falciparum isolates listed according to sensitivity to amodiaquine (AQ), with corresponding pfcrt and pfmdr1 markers

Pfmdr1
IsolateAQpfcrt 768610421246
S153STYND
S157SKTNYND
S160SKTNYNDY
TD3STNND
TD49STNND
TD56STNND
TD62STNND
TD79SKTNND
TD134STNND
TD328SKTNND
TP4STYND
TP18STNND
TP26STNND

T9/94b3RKYND
TM408RKNND
S3RTYND
S118RTYND
S149RTNYNDY
S151RKTNYND
S152RTYND
TD14RTNND
TD61RKTNND
TD64RTNNDY
TP7RTNYND
TP13RTNYndD
TP17RTNYND
TP20RTNYND
TP21RKTNndD
TP34RTNND
TP40RTNndY
RC17RTNYND

(S – sensitive; R – resistant; KT, NY and DY – mixed infections; nd – not determined)

Table 7

Number of isolates clustered according to sensitivity to each drug and corresponding pfcrt and pfmdr1 genotypes

DrugPfcrtPfmdr1
76K76T76KT86N86Y86NY1042N1042D1042ND1246D1246Y1246DY
CQTotal
S2200110200200
R5004373011943404613
MF
S352276211729303212
R170161291216101601
QUIN
S5224373112945404813
R0000000000000
AMQ
S1309492213001201
R18213374715001512

(CQ – chloroquine; MF – mefloquine; QUIN – quinine; AMQ – amodiaquine; S – sensitive; R – resistant; 76KT, 86NY, 1042ND and 1246DY – mixed infections; shaded boxes indicate the two cases where there was a significant association between the presence of a particular marker and drug sensitivity: pfcrt 76T/CQR, P = 0.001 and pfmdr1 86N/MFR, P < 0.001)

Plasmodium falciparum isolates listed according to sensitivity to chloroquine (CQ), with corresponding pfcrt and pfmdr1 markers (S – sensitive; R – resistant; KT, NY and DY – mixed infections; nd – not determined; P = 0.001 for the association between CQR and presence of pfcrt 76T, mixed alleles excluded) Plasmodium falciparum isolates listed according to sensitivity to mefloquine (MF), with corresponding pfcrt and pfmdr1 markers (S – sensitive; R – resistant; KT, NY and DY – mixed infections; nd – not determined; P < 0.001 for the association between MFR and presence of pfmdr1 86N, mixed alleles excluded) Plasmodium falciparum isolates listed according to sensitivity to amodiaquine (AQ), with corresponding pfcrt and pfmdr1 markers (S – sensitive; R – resistant; KT, NY and DY – mixed infections; nd – not determined) Number of isolates clustered according to sensitivity to each drug and corresponding pfcrt and pfmdr1 genotypes (CQchloroquine; MFmefloquine; QUINquinine; AMQamodiaquine; S – sensitive; R – resistant; 76KT, 86NY, 1042ND and 1246DY – mixed infections; shaded boxes indicate the two cases where there was a significant association between the presence of a particular marker and drug sensitivity: pfcrt 76T/CQR, P = 0.001 and pfmdr1 86N/MFR, P < 0.001)

Discussion

The increasing failure rates of several antimalarial drugs in the majority of malaria-affected areas means that close monitoring of the epidemiology and dynamics of drug resistance are necessary if we are to implement measures to circumvent the problem. The identification and validation of easy, rapid molecular markers of drug resistance would greatly facilitate this process, and would allow us to overcome difficulties in the use of traditional methods for assaying drug sensitivity. In Thailand, CQ resistance was first reported more than forty years ago [3], and after ten years, resistance to chloroquine had become so widespread that use of the drug against P. falciparum was abandoned. At present, even though the drug is used only against P. vivax, it is perhaps not surprising to find that most P. falciparum are largely unaffected by CQ. Our in vitro observations show a near total prevalence of CQR (96%) in the present study area, confirming what has been widely reported [1]. Among all CQR isolates tested in our study, the presence of pfcrt 76T was universal (P = 0.001), indicating complete selection of this polymorphism by the drug, a result that is in agreement with recently published work not only from Thai-originated parasites [22], but also from parasites of different areas of the globe [32]. The correlation between pfmdr1 genotypes and quinoline resistance has often generated conflicting results; although it has been suggested that pfmdr1 86Y can be correlated with increased CQ resistance in parasites which originated from different areas of the world [33-36], other field studies have not corroborated these findings [7-15], and the results of a P. falciparum genetic cross indicated that CQR did not depend on the pfmdr1 gene [6]. Our present findings do not implicate pfmdr1 86 in CQ resistance in Thailand, since the presence of both N and Y in our samples was largely independent of their CQ response, indicating that chloroquine does not appear to exert selective pressure on this area of the gene. Interestingly though, pfmdr1 1042D and pfmdr1 1246N, previously associated with increased CQ sensitivity following genetic transfection experiments [5], were largely absent in our samples, possibly suggesting a mechanism of chloroquine resistance that may in part depend on the presence of the alternative polymorphic alleles, pfmdr1 1042N and pfmdr1 1246D, respectively. Mefloquine was introduced in Thailand in the form of Fansimef (mefloquine-sulfadoxine-pyrimethamine) during 1984 with an initial cure rate of 95%, but MF-resistant P. falciparum parasites have arisen and present a real threat to the control of malaria, especially in the Thai/Cambodia and Thai/Myanmar border areas [37]. In the present work the prevalence of MF resistance was 62%, indicating a worrying trend. A correlation between pfcrt 76T and mefloquine sensitivity would always be difficult to establish, since the near complete presence of this polymorphism is likely to have been selected by chloroquine pressure, whose mechanisms of action and resistance are probably distinct from those of MF. Earlier work from Thailand and other areas of the world has indicated that an increase in the level of mefloquine sensitivity among field isolates of P. falciparum may be correlated with a mutation in codon 86 of the pfmdr1 gene (N86Y) [38-40]. In the present work, the occurrence of pfmdr1 86N was significantly associated with MF resistance as 31/32 resistant isolates carried this polymorphism (P < 0.001), strongly suggesting that 86N is an important event in the generation of MF resistance and may be a useful marker to monitor MF resistance in this country. Interestingly, although the prevalence of AMQ resistance was high (58%), we did not detect a significant correlation between AMQ responses and any of the markers studied, contrary to what could be expected considering that AMQ is chemically very similar to CQ. These observations indicate that the mechanism of action and/or resistance differ between the two drugs, which may raise interesting questions about the design of new CQ-derivative compounds. Quinine is one of the most effective drugs for the treatment of malaria in Thailand. Although the efficacy of this drug has been reduced, it has not yet become a serious problem, since the combination with tetracycline increases its cure rate. In fact, P. falciparum quinine sensitivity was total in all regions covered by our study, showing that despite its adverse side effects, quinine can still be used as a reliable resource of malaria therapy in Thailand. The reasons for the long-lasting efficacy of quinine may be manyfold, but its explanations lie outside the scope of this article. Most importantly, quinine may prove especially valuable in the treatment of multi-drug resistant Falciparum malaria, which we found to be largely present in our study as 41 out of 52 isolates were found to be resistant to more than one compound and 7 were unaffected by all drugs (CQ, MF and AMQ) except quinine.

Conclusions

Taken together, our results seem to be suggesting that CQ and MF are the major selective forces on the pfcrt and pfmdr1 genes, whereby the presence of pfcrt 76T, and possibly pfmdr1 1042N and pfmdr1 1246D in Thai-originated parasites has been selected by chloroquine pressure. The pfmdr1 86N mutation seems to be important only for mefloquine resistance, and may represent a useful marker for monitoring resistance in this country, although its validation may require in vivo correlates and the analysis of a larger number of samples.

Authors' contributions

DL carried out a proportion of the parasite phenotyping, performed the molecular analysis of the majority of the samples and contributed for the elaboration of the manuscript. KR performed the molecular typing of a number of the isolates. FN participated in the parasite's phenotyping and genotyping. AS performed parasite collection and did a proportion of the micro-tests. JPG, VR and PC, conceived the study, participated in its design and co-ordination and were involved in phases of the experimental work.

Competing interests

None declared.
  37 in total

1.  Polymorphisms in the Plasmodium falciparum pfcrt and pfmdr-1 genes and clinical response to chloroquine in Kampala, Uganda.

Authors:  G Dorsey; M R Kamya; A Singh; P J Rosenthal
Journal:  J Infect Dis       Date:  2001-03-27       Impact factor: 5.226

2.  Pgh1 modulates sensitivity and resistance to multiple antimalarials in Plasmodium falciparum.

Authors:  M B Reed; K J Saliba; S R Caruana; K Kirk; A F Cowman
Journal:  Nature       Date:  2000-02-24       Impact factor: 49.962

3.  Analysis of pfcrt point mutations and chloroquine susceptibility in isolates of Plasmodium falciparum.

Authors:  R Durand; S Jafari; J Vauzelle; J F Delabre; Z Jesic; J Le Bras
Journal:  Mol Biochem Parasitol       Date:  2001-04-25       Impact factor: 1.759

4.  Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance.

Authors:  D A Fidock; T Nomura; A K Talley; R A Cooper; S M Dzekunov; M T Ferdig; L M Ursos; A B Sidhu; B Naudé; K W Deitsch; X Z Su; J C Wootton; P D Roepe; T E Wellems
Journal:  Mol Cell       Date:  2000-10       Impact factor: 17.970

5.  High-level chloroquine resistance in Sudanese isolates of Plasmodium falciparum is associated with mutations in the chloroquine resistance transporter gene pfcrt and the multidrug resistance Gene pfmdr1.

Authors:  H A Babiker; S J Pringle; A Abdel-Muhsin; M Mackinnon; P Hunt; D Walliker
Journal:  J Infect Dis       Date:  2001-04-13       Impact factor: 5.226

6.  Strong association, but incomplete correlation, between chloroquine resistance and allelic variation in the pfmdr-1 gene of Plasmodium falciparum isolates from India.

Authors:  P R Bhattacharya; C R Pillai
Journal:  Ann Trop Med Parasitol       Date:  1999-10

7.  Increased sensitivity to the antimalarials mefloquine and artemisinin is conferred by mutations in the pfmdr1 gene of Plasmodium falciparum.

Authors:  M T Duraisingh; C Roper; D Walliker; D C Warhurst
Journal:  Mol Microbiol       Date:  2000-05       Impact factor: 3.501

Review 8.  Chloroquine-resistant malaria.

Authors:  T E Wellems; C V Plowe
Journal:  J Infect Dis       Date:  2001-08-07       Impact factor: 5.226

9.  Plasmodium falciparum malaria in Laos: chloroquine treatment outcome and predictive value of molecular markers.

Authors:  D R Pillai; A C Labbé; V Vanisaveth; B Hongvangthong; S Pomphida; S Inkathone; K Zhong; K C Kain
Journal:  J Infect Dis       Date:  2001-02-01       Impact factor: 5.226

10.  A molecular marker for chloroquine-resistant falciparum malaria.

Authors:  A Djimdé; O K Doumbo; J F Cortese; K Kayentao; S Doumbo; Y Diourté; D Coulibaly; A Dicko; X Z Su; T Nomura; D A Fidock; T E Wellems; C V Plowe
Journal:  N Engl J Med       Date:  2001-01-25       Impact factor: 91.245

View more
  22 in total

1.  Association between prevalence of chloroquine resistance and unusual mutation in pfmdr-I and pfcrt genes in India.

Authors:  Sabyasachi Das; Subhankari Prasad Chakraborty; Amiya Kumar Hati; Somenath Roy
Journal:  Am J Trop Med Hyg       Date:  2013-03-18       Impact factor: 2.345

2.  In vivo assessment of the antimalarial and spleen-protective activities of the Saudi propolis methanolic extract.

Authors:  Qwait AlGabbani; Lamjed Mansour; Yasser A Elnakady; Saleh Al-Quraishy; Suliman Alomar; Esam M Al-Shaebi; Abdel-Azeem S Abdel-Baki
Journal:  Parasitol Res       Date:  2016-11-07       Impact factor: 2.289

3.  Ex vivo activity of endoperoxide antimalarials, including artemisone and arterolane, against multidrug-resistant Plasmodium falciparum isolates from Cambodia.

Authors:  Charlotte A Lanteri; Suwanna Chaorattanakawee; Chanthap Lon; David L Saunders; Wiriya Rutvisuttinunt; Kritsanai Yingyuen; Ian Bathurst; Xavier C Ding; Stuart D Tyner
Journal:  Antimicrob Agents Chemother       Date:  2014-07-21       Impact factor: 5.191

4.  Ex Vivo Drug Susceptibility Testing and Molecular Profiling of Clinical Plasmodium falciparum Isolates from Cambodia from 2008 to 2013 Suggest Emerging Piperaquine Resistance.

Authors:  Suwanna Chaorattanakawee; David L Saunders; Darapiseth Sea; Nitima Chanarat; Kritsanai Yingyuen; Siratchana Sundrakes; Piyaporn Saingam; Nillawan Buathong; Sabaithip Sriwichai; Soklyda Chann; Youry Se; You Yom; Thay Kheng Heng; Nareth Kong; Worachet Kuntawunginn; Kuntida Tangthongchaiwiriya; Christopher Jacob; Shannon Takala-Harrison; Christopher Plowe; Jessica T Lin; Char Meng Chuor; Satharath Prom; Stuart D Tyner; Panita Gosi; Paktiya Teja-Isavadharm; Chanthap Lon; Charlotte A Lanteri
Journal:  Antimicrob Agents Chemother       Date:  2015-05-26       Impact factor: 5.191

5.  Antimalarial exposure delays Plasmodium falciparum intra-erythrocytic cycle and drives drug transporter genes expression.

Authors:  Maria Isabel Veiga; Pedro Eduardo Ferreira; Berit Aydin Schmidt; Ulf Ribacke; Anders Björkman; Ales Tichopad; José Pedro Gil
Journal:  PLoS One       Date:  2010-08-25       Impact factor: 3.240

6.  Genetic structure of Plasmodium falciparum populations between lowland and highland sites and antimalarial drug resistance in Western Kenya.

Authors:  Mariangela Bonizzoni; Yaw Afrane; Frederick N Baliraine; Dolphine A Amenya; Andrew K Githeko; Guiyun Yan
Journal:  Infect Genet Evol       Date:  2009-05-04       Impact factor: 3.342

7.  Double mutation in the pfmdr1 gene is associated with emergence of chloroquine-resistant Plasmodium falciparum malaria in Eastern India.

Authors:  Sabyasachi Das; Santanu Kar Mahapatra; Satyajit Tripathy; Sourav Chattopadhyay; Sandeep Kumar Dash; Debasis Mandal; Balaram Das; Amiya Kumar Hati; Somenath Roy
Journal:  Antimicrob Agents Chemother       Date:  2014-07-28       Impact factor: 5.191

8.  Atorvastatin is a promising partner for antimalarial drugs in treatment of Plasmodium falciparum malaria.

Authors:  Véronique Parquet; Sébastien Briolant; Marylin Torrentino-Madamet; Maud Henry; Lionel Almeras; Rémy Amalvict; Eric Baret; Thierry Fusaï; Christophe Rogier; Bruno Pradines
Journal:  Antimicrob Agents Chemother       Date:  2009-03-23       Impact factor: 5.191

9.  Analysis of genetic mutations associated with anti-malarial drug resistance in Plasmodium falciparum from the Democratic Republic of East Timor.

Authors:  Afonso de Almeida; Ana Paula Arez; Pedro Vl Cravo; Virgílio E do Rosário
Journal:  Malar J       Date:  2009-04-09       Impact factor: 2.979

10.  Plasmodium falciparum phenotypic and genotypic resistance profile during the emergence of Piperaquine resistance in Northeastern Thailand.

Authors:  Nonlawat Boonyalai; Chatchadaporn Thamnurak; Piyaporn Sai-Ngam; Winita Ta-Aksorn; Montri Arsanok; Nichapat Uthaimongkol; Siratchana Sundrakes; Sorayut Chattrakarn; Chaiyaporn Chaisatit; Chantida Praditpol; Watcharintorn Fagnark; Kirakarn Kirativanich; Suwanna Chaorattanakawee; Pattaraporn Vanachayangkul; Paphavee Lertsethtakarn; Panita Gosi; Darunee Utainnam; Wuttikon Rodkvamtook; Worachet Kuntawunginn; Brian A Vesely; Michele D Spring; Mark M Fukuda; Charlotte Lanteri; Douglas Walsh; David L Saunders; Philip L Smith; Mariusz Wojnarski; Narongrid Sirisopana; Norman C Waters; Krisada Jongsakul; Jariyanart Gaywee
Journal:  Sci Rep       Date:  2021-06-28       Impact factor: 4.996

View more

北京卡尤迪生物科技股份有限公司 © 2022-2023.