Molecular modulation of expression of prion protein by heat shock.

Prion diseases (also known as transmissible spongiform encephalopathies) are associated with the conversion of the normal cellular form of the prion protein (PrPC) to an abnormal scrapie-isoform (PrP(Sc). The conversion of PrP(C) to PrP(Sc) is post-translational and is owing to protein conformational change. This has led to the hypothesis that molecular chaperones may be involved in the folding of prion proteins, and hence the disease process. By treating human NT-2 cells with heat-shock stress, we found that both the mRNA levels for prion protein (PrP) and heat shock protein 70 (HSP70) increased simultaneously after heat treatment. Western-blot analysis of PrP also showed a two-fold increase in PrP protein level 3 after heat treatment. Furthermore, two heat-shock elements (HSEs) were located at the positions of -680 bp (HSE1; GGAACTATTCTTGACATTGCT), and -1653 bp (HSE2; TGAGAACTCAGGAAG) of the rat PrP (RaPrP) gene promoter. Luciferase reporter constructs of the RaPrP promoter with HSE expressed higher luciferase activity (10- to 15-fold) than those constructs without HSE. Electrophoretic gel mobility shift assay (EMSA) and super-shift assay confirmed the interaction of HSE1 and HSE2 with the heat-shock transcription factor-1 (HSTF-1). These results suggest that cellular stress up-regulates both the transcription and translation of PrP through interaction with the HSEs on the PrP gene promoter, resulting in an increase in protein synthesis.