Widespread presence in mammals and high binding specificity of a nuclear protein that recognises the single-stranded telomeric motif (CCCTAA)n.

We have recently identified a protein in HeLa nuclear extracts which recognises the single-stranded telomeric sequence (CCCTAA)n in vertebrates [Marsich, E., Piccini, A., Xodo, L. E. & Manzini, G. (1996) Nucleic Acids Res. 24, 4029-4033]. In this paper we provide further experimental evidence, using electrophoretic mobility shift assays, SDS/PAGE after ultraviolet cross-linking, and gel permeation chromatography techniques, that: (a) this protein displays remarkably stringent requirements for the telomeric motif sequence, as (CCCTAAA)n, (CCCCAA)n and (TCCCAA)n are tightly bound, but (CCTAA)n is not; (b) it requires at least four CCC-block repeats properly spaced to bind strongly to DNA, e.g. the polypurine stretch of the murine Ki-ras promoter d(CTCCCTCCCTCCCTCCTTCCCTCCCTCCC), the CarG-motif-containing sequence d(CCATTTCCTAATTAGGTAAAAG), and d(C)22 are not recognised by this protein; (c) it is present in nuclear extracts from several vertebrate sources including human, rat, pig, hamster and chicken; (d) its molecular mass is about 40 kDa, as determined by SDS/ PAGE and non-denaturing gel permeation chromatography, suggesting that this protein is monomeric under native conditions.