NKp46 has been shown to represent a novel, natural killer (NK) cell-specific surface molecule, involved in human NK cell activation. In this study, we further analyzed the role of NKp46 in natural cytotoxicity against different tumor target cells. We provide direct evidence that NKp46 represents a major activating receptor involved in the recognition and lysis of both human and murine tumor cells. Although NKp46 may cooperate with other activating receptors (including the recently identified NKp44 molecule) in the induction of NK-mediated lysis of human tumor cells, it may represent the only human NK receptor involved in recognition of murine target cells. Molecular cloning of the cDNA encoding the NKp46 molecule revealed a novel member of the immunoglobulin (Ig) superfamily, characterized by two C2-type Ig-like domains in the extracellular portion. The transmembrane region contains the positively charged amino acid Arg, which is possibly involved in stabilizing the association with CD3zeta chain. The cytoplasmic portion, spanning 30 amino acids, does not contain immunoreceptor tyrosine-based activating motifs. Analysis of a panel of human/hamster somatic cell hybrids revealed segregation of the NKp46 gene on human chromosome 19. Assessment of the NKp46 mRNA expression in different tissues and cell types unambiguously confirmed the strict NK cell specificity of the NKp46 molecule. Remarkably, in line with the ability of NKp46 to recognize ligand(s) on murine target cells, the cDNA encoding NKp46 was found to be homologous to a cDNA expressed in murine spleen. In conclusion, this study reports the first characterization of the molecular structure of a NK-specific receptor involved in the mechanism of NK cell activation during natural cytotoxicity.
NKp46 has been shown to represent a novel, natural killer (NK) cell-specific surface molecule, involved in humanNK cell activation. In this study, we further analyzed the role of NKp46 in natural cytotoxicity against different tumor target cells. We provide direct evidence that NKp46 represents a major activating receptor involved in the recognition and lysis of both human and murine tumor cells. Although NKp46 may cooperate with other activating receptors (including the recently identified NKp44 molecule) in the induction of NK-mediated lysis of humantumor cells, it may represent the only humanNK receptor involved in recognition of murine target cells. Molecular cloning of the cDNA encoding the NKp46 molecule revealed a novel member of the immunoglobulin (Ig) superfamily, characterized by two C2-type Ig-like domains in the extracellular portion. The transmembrane region contains the positively charged amino acid Arg, which is possibly involved in stabilizing the association with CD3zeta chain. The cytoplasmic portion, spanning 30 amino acids, does not contain immunoreceptor tyrosine-based activating motifs. Analysis of a panel of human/hamster somatic cell hybrids revealed segregation of the NKp46 gene on human chromosome 19. Assessment of the NKp46 mRNA expression in different tissues and cell types unambiguously confirmed the strict NK cell specificity of the NKp46 molecule. Remarkably, in line with the ability of NKp46 to recognize ligand(s) on murine target cells, the cDNA encoding NKp46 was found to be homologous to a cDNA expressed in murine spleen. In conclusion, this study reports the first characterization of the molecular structure of a NK-specific receptor involved in the mechanism of NK cell activation during natural cytotoxicity.
The molecular mechanism by which NK cells can discriminate and kill autologous cells that do not express
sufficient amounts of MHC class I molecules has been
identified recently (1, 2). NK cells express a number of
MHC class I–specific receptors that, upon interaction with
their ligands, inhibit NK cell cytotoxicity (3–5). In humans, two distinct families of inhibitory receptors for
HLA–class I molecules have been identified. The first one
is represented by members of the Ig superfamily that display
specificity for different groups of HLA–class I alleles encoded by the HLA-C, -B, or -A loci (5–7). The second
group is represented by heterodimers formed by members
of the C-type lectin superfamily. They are composed by
the covalent association of CD94 with members of the
NKG2 family (8–10). The CD94–NKG2A heterodimer
has recently been shown to represent the receptor for
HLA-E molecules (11–13). On the other hand, thus far
only limited information has been available on the surface
molecules involved in triggering of NK cells during natural
cytotoxicity. In this context, we showed that the activating
forms of the HLA-C–specific receptors (p50) may play a
role in cytotoxicity against HLA–class I-positive target cells
(14–16). However, it is evident that this activating pathway
is not involved in cytotoxicity against HLA–class I-negative
target cells. In the search for receptors responsible for NK
cell triggering in the process of non-MHC-restricted cytotoxicity, we recently identified two novel NK-specific triggering surface molecules. The first one is a 46-kD molecule
(termed NKp46 in this study) that is selectively expressed
by all resting and activated humanNK cells (17), and associates with the CD3ζ chain (18). The second one is a 44-kD molecule (NKp44) that is only expressed by activated
humanNK cells, and associates with the recently described
killer cell activating protein (KAR)1-associated polypeptide
(KARAP)/DNAX activation protein (DAP)12 signal transducing molecule (18–20). Clues that these molecules may
represent triggering receptors involved in natural cytotoxicity have been provided by their ability to activate NK cell
function after cross-linking mediated by anti-NKp46 or
anti-NKp44 mAb (17, 18). In addition, anti-NKp46 or
anti-NKp44 mAb could partially inhibit the NKcytotoxicity against FcγR-negative tumor target cells (18). Remarkably, this inhibitory effect varied depending upon the target
cells analyzed. Moreover, a synergistic effect could be demonstrated when the two mAbs were used in combination
(18). A likely interpretation of these data is that the inhibitory effect on NKcytotoxicity is consequent to mAb-mediated masking of relevant receptors involved in recognition
of target cell ligands. In this study we show that the NKp46
molecule initiates a pathway of NK cell activation involved
not only in the recognition of human but also of murine
target cells. Molecular cloning of NKp46 revealed a novel
member of the Ig superfamily characterized by two Ig-like
extracellular domains, a transmembrane region containing
the charged amino acid Arg, and a short cytoplasmic tail
that does not contain immunoreceptor tyrosine-based activating motifs (ITAMs).
Materials and Methods
Cells Lines, Antibodies, Generation of NK Cell Clones, and Cytolytic Assays.
HumanNK cells were isolated from peripheral
blood lymphocytes of healthy donors as previously described (21).
The purity of the cell population was evaluated by flow cytometric
analysis after staining with anti-CD3, anti-CD56 and anti-NKp46
mAbs. NK cell clones were generated as previously described
(21). Polyclonal NK cell cultures and clones were maintained in
RPMI 1640 medium supplemented with 10% FCS and 100 U/ml
recombinant IL-2. PHA-activated human T lymphocytes and T
cell clones were obtained and maintained as previously described
(22). The Raji, Daudi, 721.221 B, Jurkat T, HL60 and U937
myelomonocytic, M14 melanoma, and IGROV ovarian carcinoma cell lines (all of human origin), and mousethymoma
BW1502 were cultured in RPMI 1640 medium supplemented
with 10% FCS. Monkey kidney COS-7 cells were maintained in
DMEM supplemented with 10% FCS.mAbs BAB281 (IgG1, anti-NKp46), Z231 (IgG1, anti-NKp44),
C218 (IgG1, anti-CD56), C227 (IgG1, anti-CD69), and EB6
(IgG1, anti-p58.1) were obtained in our lab (17, 18, 23). NK cell
clones were assessed for cytolytic activity in a 4-h 51Cr-release assay as previously described (23).
cDNA Library Construction.
Total RNA was extracted from
IL-2–activated polyclonal NK cells obtained from two healthy
donors by guanidinium thiocyanate lysis followed by centrifugation on a cesium chloride cushion (24). Poly A+ RNA was purified by magnetic separation with Dynabeads Oligo(dT)25 (Dynal
A.S., Oslo, Norway). 5 μg of polyA+ RNA was used to construct a directional cDNA library by using the SuperScript Plasmid System for cDNA Synthesis and Plasmid Cloning (GIBCO
BRL, Gaithersburg, MD). In brief, first strand cDNA synthesis
was catalyzed by SuperScript II reverse transcriptase by using an
oligo-dT-NotI primer-adapter. After second strand synthesis,
cDNA was ligated to SalI adapters and subsequently digested with
NotI. Digested cDNA was size-fractionated by column chromatography and the larger inserts were ligated into SalI-NotI–digested
VR1012 plasmid (Vical Inc., San Diego, CA), a mammalian expression vector containing CMV IE promoter/enhancer regions.
The ligation products were transformed into XL1-Blue MRF′
bacterial cells (Stratagene, La Jolla, CA) by electroporation. The
library (∼106 independent recombinant clones) was divided into
10 fractions (105 clones each) and grown for several hours, and
then frozen glycerol cultures were prepared and DNA was isolated by the alkaline lysis method (24).
Library Screening by cDNA Expression in COS-7 Cells and Sib-Selection.
The library screening procedure was adapted from the
method reported by Brakenhoff et al. (25). In brief, 10 μg of plasmid DNA from each library fraction was transfected into COS-7
cells by electroporation (3 × 106 cells each electroporation) and
cells were seeded into 100-mm petri dishes. A control transfection with p58.1 cDNA in VR1012 plasmid was performed in
each experiment. On day 3 after transfection, cell monolayers
were immunocytochemically stained as described below. The library fraction containing the highest number of positive cells and
the lowest number of bacterial colonies was chosen for further
analysis. The corresponding glycerol stock was titered and divided into 10 smaller pools (∼2 × 105 colonies each), and then
plasmid DNA was isolated from bacterial overnight cultures of
each library subpool and transfected into COS-7 cells. Subsequent rounds of screening of progressively smaller pools of bacterial colonies were performed until a single positive colony (clone
2F) was identified.
Immunocytochemical Staining of Transfected COS-7 Cells.
Immunocytochemistry was essentially performed according to Brakenhoff et al. (25). In brief, cells in 100-mm petri dishes were air
dried, fixed with methanol, washed once with Tris buffer saline
(TBS: 25 mM Tris-HCl, pH 7.4, 2 mM KCl, 150 mM NaCl),
and incubated with 2% normal rabbit serum/1% BSA in TBS for
15 min at room temperature. Incubation with either BAB 281
(library transfected cells) or EB6 (control cells) mAb, each diluted
1:2 in TBS/1% BSA, was conducted for 1 h at room temperature.
After extensive washes in TBS, cells were incubated with rabbit
anti–mouse immunoglobulins (DAKO, Glostrup, Denmark) diluted 1:25 in TBS/1% BSA for 30 min at room temperature. The
dishes were washed again in TBS and subsequently incubated with
alkaline phosphatase (AP) anti-AP mAb (DAKO) diluted 1:200 in
TBS/1% BSA for 30 min at room temperature. Cells were
washed again in TBS, rapidly equilibrated in AP buffer (100 mM
Tris-HCl, pH 9.5, 100 mM NaCl, 10 mM MgCl2), and then incubated for 10 min at room temperature with nitro blue tetrazolium (100 μg/ml) and 5-bromo-4-chloro-3-indolyl phosphate
(50 μg/ml) in AP buffer. Cell monolayers were then rinsed with
deionized water and visually analyzed under an inverted phase
microscope. Positive cells stained purple and the membrane localization of the immunoreactive protein was detectable as a well
delineated dark cell profile.
DNA Sequencing.
DNA sequencing was performed using
d-Rhodamine Terminator Cycle Sequencing Kit and an automatic sequencer (Automatic Sequencer 377; PE Applied Biosystems, Foster City, CA).
Transient Transfections.
COS-7 cells (5 × 105/plate) were
transfected with clone 2F cDNA by the DEAE-dextran method,
as previously described (5). After 48 h, transfected cells were detached with 2% EDTA in PBS, stained with mAb BAB281 followed by a PE-conjugated goat antibody to mouse IgG1, and analyzed by flow cytometry using a FACSort® (Becton Dickinson,
San Jose, CA).
Analysis of NKp46 Transcript Expression by Northern Blotting.
Northern blot analysis of RNA extracted from multiple human
tissues was performed using Northern Territory™ Human Normal Tissue Blots I, II, and III from Invitrogen (Carlsbad, CA).
The Northern blots contained total RNA from heart, brain, kidney, liver, lung, pancreas, spleen, and skeletal muscle (Blot I);
esophagus, stomach, intestine, colon, uterus, placenta, bladder,
and adipose tissue (Blot II); and tonsil, thymus, appendix, lymph
node, gall bladder, prostate, testis and ovary (Blot III). To analyze
NKp46 gene expression in leukocytes, total RNA was purified
from the indicated cells, size-separated by electrophoresis in agarose gels containing formaldehyde, and transferred onto a nylon
membrane (DuPont-NEN, Boston, MA). Northern blots were
hybridized under high stringency conditions as previously described (26). The NKp46 cDNA probe (a 1.3-kb SalI–NotI fragment excised from the VR1012 recombinant vector) was 32P-labeled by random priming (27).
Reverse Transcriptase PCR Analysis.
cDNA was obtained by
reverse transcription of mRNA from various leukocytic cells using oligo dT priming. Primers used for cDNA amplification of
complete NKp46 open reading frame (ORF; 984 bp) were as follows: 5′CTGAGCGATGTCTTCCACAC (46FOR) and 5′CCGCCCAGGCTCAACACC (46REV). Amplification was performed with 25 pmol of each primer for 30 cycles (30 s at 94°C,
30 s at 60°C, and 30 s at 72°C), followed by a 7-min incubation
at 72°C. The amplification products were subcloned in pCR2.1
vector by TOPO-TA Cloning kit (Invitrogen), and subsequently
were sequenced.
Biochemical Characterization of the NKp46 Molecule.
Cyanogen
bromide Sepharose-coupled (Amersham
Pharmacia Biotech, Uppsala, Sweden) BAB281 mAb was used to immunoprecipitate
NKp46 molecules from 1% NP-40 lysates of 125I surface-labeled
cells (DuPont-NEN), as previously described (17). Immunoprecipitates were analyzed by discontinuous SDS-PAGE under reducing conditions (5% 2-ME).NKp46 molecules, purified from dried gel, were treated with
neuraminidase (2 mU), α-l-fucosidase (2 μg), N-acetyl-β-d-glucosaminidase (1 mU), O-glycosidase (2.5 mU), and N-glycosidase
F (0.4 U) (all from Boehringer Mannheim, Mannheim GmbH,
Germany), for 18 h at 37°C in 30 μl of 20-mM phosphate buffer,
pH 7, 0.1% SDS, 1% NP-40, and 10 mM 2-ME. Digestion was
stopped by adding 10 μl of 4× SDS sample buffer. Samples were
then analyzed by discontinuous SDS-PAGE.
Chromosomal Localization of NKp46 Gene and Southern Blotting.
A panel of genomic DNA samples from human/hamster
cell hybrids (BIOS Laboratories, New Haven, CT) was used to
assign NKp46 gene to a specific chromosome by Southern blotting. The somatic cell hybrid blot contained 20 multichromosomal somatic cell hybrids plus 3 control genomic DNAs from
human, hamster, and mouse tissues. High stringency hybridization and washes were performed according to the manufacturer's
instructions. The NKp46 labeled probe was the same as that used
for Northern blotting.Analysis of cross-species conservation of the NKp46 gene was
performed using Zoo-Blot from Clontech (Palo Alto, CA). The
Southern blot contained genomic DNA from human, Rhesus
monkey, Sprague-Dawley rat, BALB/c mouse, dog, cow, rabbit,
chicken, and Saccharomyces cerevisiaeyeast. The probe used was a
cDNA segment corresponding to nucleotides 310–715 of the
NKp46 ORF obtained by PCR. Washes were carried out at low
stringency conditions as previously described (26).
Results and Discussion
NKp46 Represents an NK cell Triggering Receptor Involved
in the Recognition of both Human and Murine Tumor Cells.
A series of humanNK cell clones derived from different
donors were selected for their ability to lyse a panel of human or murine FcγR-negative tumor target cells. In agreement with previous data, all NK clones expressed NKp46
surface molecules (17). To assess the possible role of
NKp46 in the recognition of different target cells, we evaluated the cytolytic activity in either the absence or presence of anti-NKp46 mAb. Based on the results of these experiments, three different groups of target cells could be
identified. In the first group, addition of anti-NKp46 mAb
led to an almost complete (>70%) inhibition of target cell
lysis. Remarkably, target cells belonging to this group (including Bw1502 and YAC cells) were of murine origin. In
the second group, addition of anti-NKp46 mAb resulted in
a partial (30–60%) inhibition of cytolysis. This group included various humantumor cell lines including lung, liver
or mammary gland carcinomas, melanomas, and EBV-transformed cell lines. Lysis of the third group (which included only a few humantumor cell lines) was not affected
by anti-NKp46 mAb. Fig. 1 shows the cytolytic activity of
NK clones against target cells representative of each group.
It can be seen that the murinethymoma BW1502 (representative of the first group of target cells) is lysed in the absence of added mAb, whereas lysis was sharply inhibited in
the presence of anti-NKp46 mAb. A similar inhibitory effect was consistently detectable in all analyzed NK clones.
Addition of isotype-matched anti-NKp44 (Fig. 1) or anti-CD69 or anti-CD56 mAb (data not shown) had no effect.
In the case of the M14 melanoma cell line (representative
of the second group), anti-NKp46 mAb partially (∼50%)
inhibited target cell lysis, whereas anti-NKp44 mAb (Fig.
1), as well as anti-CD69 and anti-CD56 mAbs (data not
shown), had no effect. Finally, killing of IGROV ovarian
carcinoma cell line (representative of the third group) was
affected by neither anti-NKp46 nor anti-NKp44 mAb.
Taken together, these data provide further evidence that
NKp46 functions as a triggering receptor involved in natural cytotoxicity. It is conceivable that the inhibitory effect
of anti-NKp46 mAb may reflect masking of the NKp46
receptor. This would prevent NKp46 interaction with
ligand(s) expressed on target cells. Remarkably, the mAb-mediated abrogation of cytolytic activity against murine
target cells suggests that NKp46 may represent the only
triggering receptor expressed by humanNK cells capable of
recognizing a ligand on the surface of murine cells. If this
interpretation is correct, one may speculate that the ligand(s)
for NKp46 may be conserved in human and mouse. The
finding that lysis of M14 melanoma could be inhibited only
partially by anti-NKp46 mAb suggests that, in this case,
NKp46 may cooperate with other, still undefined, NK receptors for optimal induction of NK cell triggering. In this
context, it is of note that NK-mediated cytotoxicity against
M14 is not affected by masking of NKp44 molecules. It
should be also noted that NKp44 has been shown to cooperate with NKp46 in the NK-mediated cytolytic activity
against other tumor targets such as the lung carcinoma
A549 and the EBV-transformed B cell lines LCL721.221
and RPMI 8866 (18). Taken together, these data would
suggest that different triggering receptors expressed by a
given NK cell may differentially contribute to activation of
cytotoxicity, depending on the ligands expressed by the analyzed target cells.
Figure 1
Inhibition of natural cytotoxicity by mAb-mediated masking
of NKp46 molecules. Seven representative NK cell clones, derived from
two donors, were analyzed for cytotoxic activity in a 51Cr-release assay
against the following FcγR-negative target cell lines: BW1502 (murine
thymoma), M14 (human melanoma), and IGROV (human ovarian carcinoma), in either the absence (□) or presence of BAB281 (anti-NKp46,
▪), or in Z231 (anti-NKp44, ◪) mAb. Both mAbs are IgG1. The E/T
ratio was 5:1 for human target cells and 8:1 for murine target cells. Each
bar represents the mean of triplicate experiments.
The inability of anti-NKp46 mAb to inhibit cytolytic
activity against IGROV cells may reflect the absence (or
inadequate expression) of the NKp46 ligand(s). Alternatively, several additional still unknown receptor–ligand interactions may be responsible for NK cell activation against
IGROV cells, and blocking of the NKp46 receptor may
not significantly impair the overall triggering of cytolysis. It
is of note that although lysis of most melanoma cell lines
was inhibited by anti-NKp46 mAb (indeed, most melanomas belong to the above-defined “group 2” of cell targets),
lysis of a melanoma cell line (from melanomapatient no.
15392) was not affected by masking of NKp46 (data not
shown). This suggests that the ligand(s) for the NKp46 receptor may be differentially expressed even by humantumor cells of the same histotype.
Cloning of cDNA that Encodes NKp46.
To isolate the
cDNA that encodes the NKp46 molecule, we applied an
expression cloning strategy. An expression library was prepared from humanNK cell cDNA derived from two healthy
donors, and was divided into 10 fractions of ∼105 independent recombinant clones. Individual fractions were transiently
transfected into COS-7 and analyzed by immunocytochemical staining with anti-NKp46 mAb. The first screening revealed two positive library fractions. Screening of progressively smaller pools of recombinants allowed us to isolate a
single clone (2F) that directed cell surface expression of the
NKp46 protein, as demonstrated by staining with anti-NKp46 mAb and by flow cytometric analysis (Fig. 2
A).
Figure 2
(A) Cell surface expression of NKp46 protein in COS-7
transfected cells. COS-7 cells, transfected with clone 2F cDNA (left) or
vector alone (right), were stained with anti-NKp46 mAb, followed by PE-conjugated goat anti–mouse IgG1 and were analyzed by flow cytometry.
White profiles represent cells incubated with second reagent alone (i.e.,
negative controls). (B) Nucleotide and predicted amino acid sequences of
NKp46. The beginning of translation is marked by an arrow. The putative signal peptide is indicated in lowercase letters, the minimal predicted
transmembrane region is underlined, and the charged amino acid Arg is
circled and shaded in gray. Cysteines involved in the Ig-like fold are circled and putative N- and O-glycosylation sites are boxed. DNA and protein sequence analysis were performed using GeneWorks, MacVector
suites (Oxford Molecular Group Inc., Oxford, UK), NetOGlyc 2.0 (http:
//www.cbs.dtu.dk/services/NetOGlyc/), and PSORT (http://psort.
nibb.ac.jp/) Prediction Servers. These sequence data are available from
EMBL/GenBank/DDBJ under accession number AJ001383.
The cDNA comprises a 915-bp ORF encoding a novel
protein of 304 amino acids (Fig. 2
B). The predicted amino
acid sequence is consistent with a type I transmembrane
protein belonging to the Ig superfamily. The extracellular
region is preceded by a 21-residue signal peptide, and consists of two cysteine-bridged C2-type Ig-like domains followed by a stretch of amino acids that probably form a stem
connecting the ectodomain with the transmembrane region. The putative transmembrane segment may be unusually short, comprising 19 amino acids that include a positively charged residue (Arg). Alternatively, inclusion of the
two acidic amino acids Glu and Asp would result in a longer
transmembrane region characterized by the atypical presence of several charged residues. The intracellular portion is
30 amino acids in length, is rich in basic residues, and does
not contain consensus sequences for any known ITAM. Remarkably, recent biochemical analysis revealed an association
of the NKp46 receptor with the ITAM-containing CD3ζ
subunit (18). However, unlike CD16 cDNA, the NKp46
cDNA does not require cotransfection with CD3ζ cDNA to
induce surface expression of the NKp46 protein. In addition, cotransfection of NKp46 and CD3ζ cDNAs did not result in any significant increase of NKp46 surface expression
in COS-7 cells (data not shown). It is of note that the NKp46
molecule, unlike other activating NK receptors (including
KAR and NKp44), does not appear to be associated with the
KAR-associated polypeptide (KARAP)/DNAX-associated
protein (DAP)12 signal transducing subunit (18–20).Next, COS-7 cells untransfected or transfected with the
NKp46 cDNA were surface labeled with 125I, lysed in 1%
NP-40, and then immunoprecipitated with the anti-NKp46 mAb. As shown in Fig. 3
a, the anti-NKp46 mAb
immunoprecipitated a surface molecule of ∼46 kD from
NKp46-transfected COS-7 cells, corresponding to the surface molecule immunoprecipitated from a polyclonal NK
cell population used as a control. A second faint band displaying a molecular mass of ∼33 kD could be visualized in
immunoprecipitates derived from NKp46-transfected COS-7
cells. The NKp46 molecule was originally described as a
poorly glycosylated protein characterized by a slight decrease
in molecular mass after treatment with O-glycosidase (17).
On the other hand, the difference between the molecular
size of the protein predicted from the cDNA sequence
(∼33 kD) and the molecular mass of the NKp46 molecule
derived from normal NK cells or transfected COS-7 cells
(46 kD), suggested the presence of previously undetected
glycosylations. Moreover, computer search for putative
glycosylation sites indicated one potential N-linked glycosylation site at Asn216 and two potential O-linked glycosylation sites at Thr125 and Thr225, respectively (28). This
was confirmed by experiments in which NKp46 molecules
were treated with O- and/or N-glycosidase in the presence
of fucosidase and N-acetyl-glucosaminidase. As shown in
Fig. 3
b, under these conditions we could demonstrate a decrease in molecular mass after treatment with either N-or
O-glycosidase (lanes C and D, respectively). Moreover,
when the NKp46 molecules were digested with both N-and
O-glycosidase (lane E), a band of ∼33 kD, corresponding to
the predicted NKp46 protein backbone, could be visualized.
Thus, the NKp46 molecule presumably displays both N- and
O-glycosylations, and the faint band of 33 kD visualized
in immunoprecipitates derived from COS-7 transfected
cells may represent a nonglycosylated form of the NKp46
molecule.
Figure 3
Biochemical analysis of NKp46 glycoprotein. (a) A polyclonal NK cell population (A) and COS-7 cells, untransfected (B) or
transfected with NKp46 cDNA (C), were surface-labeled with 125I and
immunoprecipitated with BAB281 (anti-NKp46) mAb. Samples were analyzed in an 11% SDS-PAGE under reducing conditions. (b) NKp46
molecules, purified from a 125I surface-labeled NK cell population, were
treated with various enzymes as indicated. Samples were run in a 9%
SDS-PAGE under reducing conditions.
Tissue Distribution and Sequence Analysis of the NKp46
Transcript.
NKp46 cDNA and amino acid sequences were
compared with the EMBL/GenBank/DDBJ databases. This
analysis revealed a partial homology with members of the
immunoglobulin-like transcript (ILT)/leukocyte immunoglobulin-like receptor (LIR) receptor family that are
mainly expressed on human lymphoid and myelomonocytic cells (29–31). In particular, the greatest amino acid
identity (39%) was observed between the extracellular domain of NKp46 and that of the inhibitory ILT3 receptor
(29), also known as HM18 (30) or LIR-5 (31) (Fig. 4).
Figure 4
Alignment of amino acid sequences corresponding to the extracellular regions of NKp46 and ILT3 proteins. The putative signal peptides were deleted from both sequences. Consensus sequence is indicated
on top, dashes were introduced to maximize homologies, and amino acids
identical to the consensus are indicated by dots.
Northern blot experiments performed using RNA from
multiple human tissues showed that the NKp46 gene is
weakly expressed only in spleen (data not shown). More
detailed Northern blot analysis, using RNA isolated from
purified NK cell populations or clones, polyclonal T cells,
and cell lines including the T, B, and myelomonocytic
lines, revealed that NKp46 expression is confined to NK
cells, whereas other lymphoid or myelomonocytic cells do
not express NKp46 mRNA (Fig. 5). The NK-specific expression pattern of NKp46 transcript was subsequently
confirmed by reverse transcriptase (RT)-PCR analysis (data
not shown). These findings are in agreement with previous
data demonstrating NK-specific cell surface expression of
NKp46 protein, as determined by flow cytometric analysis
using anti-NKp46 specific mAb (17). Remarkably, the NK
cell–restricted expression of NKp46 differentiates this molecule from ILT/LIR molecules that generally display a
broader cellular distribution.
Figure 5
Northern blot analysis of NKp46 transcript expression. Total
RNA was isolated from cells of different origins as follows: polyclonal NK
cell populations (NK-LM and NK-FG); NK cell clones (KK41 and
TB34); a polyclonal CD3+ T cell population (PHA blasts); a T lymphoma
cell line (Jurkat); Burkitt's lymphoma B cell lines (Raji and Daudi); an
EBV-transformed B cell line (LCL721.221); a histiocytic lymphoma cell
line (U937); and an acute promyelocytic leukemia cell line (HL60). 10 μg
of each RNA preparation (2 μg of RNA from NK cell clones KK41 and
TB34) were hybridized with the 1.3-kb NKp46 probe. The positions of
28S and 18S ribosomal RNA subunits are indicated on the left.
As shown in Fig. 5, the NKp46 main transcript is ∼3.4 kb
long, and an additional faint band of ∼0.9 kb is also detectable. Subsequent RT-PCR experiments, using specific
primers and RNA isolated from NK cell clones derived
from different donors, revealed the existence of shorter
cDNA sequences, probably representing alternative splice
variants of NKp46 (data not shown). It is possible that the
0.9-kb RNA transcript that weakly hybridizes with the
NKp46 full length cDNA probe might correspond to a
transcript encoding a lower molecular weight isoform of
NKp46 molecule. At present, it is not known whether these
alternative splice variants of NKp46 (nucleotide sequence
data are available from EMBL/GenBank/DDBJ under accession numbers AJ006121, AJ006122, and AJ006123) represent functional molecules.The NKp46 cDNA sequences obtained by RT-PCR
from clonal and polyclonal NK cells isolated from several
unrelated donors were identical (data not shown). This
finding indicates that the NKp46 gene does not display significant allelic variations among different individuals.
Chromosomal Localization and Southern Blot Analysis of the
NKp46 Gene.
We performed analysis of chromosomal
localization of the NKp46 gene by Southern blotting. To
this aim, we used genomic DNA, extracted from a panel of
human/hamster somatic cell hybrids, hybridized with the
NKp46 cDNA probe at high stringency conditions. This
analysis revealed segregation of the NKp46 gene on chromosome 19 (Fig. 6). Since the genes encoding killer cell
inhibitory protein (KIR)/KAR, FcαR (1), ILT/LIR (29–
31), and LAIR-1/p40 (32) molecules are also located on
chromosome 19 (in particular, they are linked within a
short segment of 19q13.14; reference 33), this suggests the
existence of a common ancestral gene for all these molecules. Southern blot analysis of human genomic DNA (Fig.
6) also revealed a relatively simple hybridization pattern for
the NKp46 gene, suggesting that the NKp46 probe may
hybridize with a single gene or a few genes.
Figure 6
Chromosomal localization of NKp46 gene. Genomic DNA
derived from a panel of hamster/human somatic cell hybrids, or from human, hamster, or mouse tissues, and digested with EcoRI, was hybridized
with the 1.3-kb NKp46 probe. The hybrid cell lines containing chromosome 19 are indicated on top. The positions of the 23.1-, 9.4-, and 6.6-kb
fragments of the λ HindIII-digested molecular weight marker are indicated on the right side of each autoradiograph.
We next investigated the species-specificity of the
NKp46 gene by Southern blot analysis under lower stringency conditions, using genomic DNA from different species. Interestingly, the NKp46 probe displays cross-hybridization with genomic DNA from monkey, dog, rabbit,
cow, mouse, and rat DNA (data not shown). These data
suggest a significant cross-species conservation of the NKp46-encoding gene. In addition, by searching the National Center for Biotechnology Information (NCBI) database of expressed sequence tags (EST), we found an EST clone from
a C57BL/6J mouse spleen cell library (accession number
AA170207) that shared high degree of sequence identity
with the humanNKp46 cDNA. Based on the sequence information obtained from this EST clone, we could isolate a
murine homologue of the NKp46 molecule that shares
69% homology with the humanNKp46 cDNA sequence
(Biassoni, R., A. Pessino, C. Bottius, A. Morette, and L.
Morette, manuscript in preparation).
Conclusion.
This study reports the molecular cloning of
the first humanNK-specific receptor involved in triggering
of non MHC-restricted natural cytotoxicity. Sequence analysis revealed a new member of the Ig superfamily, characterized by two C2-type Ig-like domains, a transmembrane
region containing at least one charged amino acid (Arg), and
a short cytoplasmic tail, that does not contain ITAM. The
presence of a positively charged amino acid within the
transmembrane domain is a typical feature of many triggering receptors, including KAR, NKG2-C, and TCRs. Since
the prediction of the transmembrane region of NKp46 is
not unequivocal from its amino acid sequence, the possibility exists that the complete transmembrane segment may
include also the two negatively charged residues Glu and
Asp. If this is the case, NKp46 would possess an unusual
transmembrane domain with several charged amino acids
potentially mediating interactions with other molecules. In
this context, previous data demonstrated that NKp46 associates with CD3ζ subunit (18), which is characterized by a
negatively charged amino acid (Asp) in its transmembrane
region and by the presence of three ITAM sequences in its
cytoplasmic portion. Although this association is likely to
be essential for signal transduction via NKp46, CD3ζ is not
required for NKp46 surface expression in cell transfectants.
It is of note that CD16, which also binds to CD3ζ, displays
an Asp residue in its transmembrane region.The specificity of the NKp46 molecule for NK cells was
shown previously by selective reactivity of NK populations
and clones with anti-NKp46 mAb (17). In this study, this
finding was further substantiated by the analysis of the expression of the Nkp46-specific transcript. Therefore, the
NKp46 molecule represents the only NK-specific marker
for humanNK cells identified thus far.The anti-NKp46 mAb has also been used to analyze the
regulatory function of the NKp46 molecule. Mab-mediated cross-linking of NKp46 molecule triggered different
NK cell functions (17). On the other hand, mAb-mediated
masking (i.e., under non–cross-linking conditions) of NKp46
molecule inhibited NKcytotoxicity against different tumor
target cells (17, 18). Here we show that the degree of this
inhibition depends upon the target cell analyzed, and that
NKp46 is involved not only in cytotoxicity against humantumor cells of different histotype and origin, but also
against murine target cells. It is likely that additional triggering receptors (including NKp44 and other as yet undefined molecules) are involved in natural cytotoxicity against
human target cells. However, NKp46 receptor would appear to play a predominant role in triggering of cytotoxicity against most tumor target cells analyzed. It is possible
that this is due to the expression of putative Nkp46 ligands
on most NK-susceptible tumor cell lines analyzed. It will
be important to identify these ligands to clarify their tissue
distribution, their expression on tumor versus normal tissues, and their expression in different species.
Authors: M Carretero; C Cantoni; T Bellón; C Bottino; R Biassoni; A Rodríguez; J J Pérez-Villar; L Moretta; A Moretta; M López-Botet Journal: Eur J Immunol Date: 1997-02 Impact factor: 5.532
Authors: N Wagtmann; R Biassoni; C Cantoni; S Verdiani; M S Malnati; M Vitale; C Bottino; L Moretta; A Moretta; E O Long Journal: Immunity Date: 1995-05 Impact factor: 31.745
Authors: C Bottino; S Sivori; M Vitale; C Cantoni; M Falco; D Pende; L Morelli; R Augugliaro; G Semenzato; R Biassoni; L Moretta; A Moretta Journal: Eur J Immunol Date: 1996-08 Impact factor: 5.532
Authors: D Pende; R Biassoni; C Cantoni; S Verdiani; M Falco; C di Donato; L Accame; C Bottino; A Moretta; L Moretta Journal: J Exp Med Date: 1996-08-01 Impact factor: 14.307
Authors: A Moretta; S Sivori; M Vitale; D Pende; L Morelli; R Augugliaro; C Bottino; L Moretta Journal: J Exp Med Date: 1995-09-01 Impact factor: 14.307
Authors: R Biassoni; C Cantoni; M Falco; S Verdiani; C Bottino; M Vitale; R Conte; A Poggi; A Moretta; L Moretta Journal: J Exp Med Date: 1996-02-01 Impact factor: 14.307
Authors: Catharina Gross; Ingo G H Schmidt-Wolf; Srinivas Nagaraj; Robert Gastpar; Joachim Ellwart; Leoni A Kunz-Schughart; Gabriele Multhoff Journal: Cell Stress Chaperones Date: 2003 Impact factor: 3.667
Authors: Ankur H Shah; Bharatwaj Sowrirajan; Zachary B Davis; Jeffrey P Ward; Edward M Campbell; Vicente Planelles; Edward Barker Journal: Cell Host Microbe Date: 2010-11-18 Impact factor: 21.023
Authors: Rachel E Owen; Eriko Yamada; Catherine I Thompson; Louisa J Phillipson; Clare Thompson; Elizabeth Taylor; Maria Zambon; Helen M I Osborn; Wendy S Barclay; Persephone Borrow Journal: J Virol Date: 2007-08-01 Impact factor: 5.103
Authors: Andrea De Maria; Elisabetta Ugolotti; Erik Rutjens; Stefania Mazza; Luana Radic; Alessandro Faravelli; Gerrit Koopman; Eddi Di Marco; Paola Costa; Barbara Ensoli; Aurelio Cafaro; Maria Cristina Mingari; Lorenzo Moretta; Jonathan Heeney; Roberto Biassoni Journal: Int Immunol Date: 2009-01-15 Impact factor: 4.823