| Literature DB >> 9710539 |
Abstract
A theoretical model of a DNA oligonucleotide duplex featuring A-tracts phased by a full helix turn is developed based on molecular dynamics computer simulation. The extent to which this model agrees with relevant experimental data on axis bending and the relationship of A-tracts to bending and other aspects of helix morphology is investigated. Specifically, a series of nanosecond-level molecular dynamics (MD) simulations have been carried out for the 25 bp duplex d(ATAGGCAAAAAATAGGCAAAAATGG) at various concentrations of saline solution. A 30 base-pair sequence composed of three 10 bp repeats of the BamHI recognition sequence ligated together, d(CGGGATCCCG. CGGGATCCCG.CGGGATCCCG), was simulated as a control. The MD was carried out using the AMBER 4.1 suite of programs, and utilized the Cornell et al. force-field with the electrostatic boundary conditions treated by the particle-mesh Ewald summation protocol. The MD results show that at a concentration of 60 mM KCl, 10 mM MgCl2 added salt plus minimal neutralizing cations, the MD model exhibits concerted axis bending to the extent of 15.5 degrees per A-tract. This compares favorably with the bending per turn of 17 to 21 degrees inferred from cyclization experiments. The MD model also exhibits a progressive 5' to 3' narrowing of the minor-groove region of A-tracts, a feature inferred from DNA footprinting experiments. Analysis of the dynamic structure of the MD models shows that the origin of the bending follows a junction-type bending model with an admixture of mixed sequence effects, with A-tracts relatively straight, as in oligonucleotide crystal structures of sequences containing A-tracts. The results are shown to be sensitive to environmental conditions: MD on d(ATAGGCAAAAAATAGGCAAAAATGG) in neutralizing Na+ buffer results in markedly reduced curvature, and the removal of Mg2+ measurably affects bending. Carrying out the simulations at experimental salt conditions appears to be essential to obtain an accurate account of the experimentally observed bending. Copyright 1998 Academic Press.Entities:
Mesh:
Substances:
Year: 1998 PMID: 9710539 DOI: 10.1006/jmbi.1998.1962
Source DB: PubMed Journal: J Mol Biol ISSN: 0022-2836 Impact factor: 5.469