| Literature DB >> 9213388 |
L Wang1, Y Xu, E W Collisson.
Abstract
Chimeric infectious bronchitis virus (IBV) genomes with cross-over sites in the S1 gene were generated by co-infection with two distinct IBV strains. Recombinant viruses were collected from chicken embryos, embryonic cultured cells and chickens co-infected with Ark99 and Mass41 strains and purified by differential centrifugation. The recombinant S1 genes were identified by reverse transcription polymerase chain reaction (RTPCR) using heterologous primers and confirmed by nucleotide sequencing. The recombinants with Ark99 5' and Mass41 3' sequences were identified following the in vitro, in ovo and in vivo co-infections. Mixed RNA extracted from Ark99 and Mass41 did not produce RTPCR products with these primers at the PCR conditions used. Cross-over sites within the amplified 580 (Mass41) or 604 (Ark99) bases of the 5' S1 gene could only be detected between nucleotides 50 and 155. While this region, lying upstream of the S1 hypervariable region, corresponded with sites commonly identified in naturally occurring isolates, recombination sites identified in these studies could not be detected within the HVR of S1 of the genomes of chimeric viruses.Entities:
Mesh:
Substances:
Year: 1997 PMID: 9213388 PMCID: PMC7126307 DOI: 10.1016/s0168-1702(97)01466-4
Source DB: PubMed Journal: Virus Res ISSN: 0168-1702 Impact factor: 3.303
Primers used for RTPCR amplification of S1 RNA of IBV
| Reference | Nucleotide sequence 5′-3′ | Location from S1 start codon |
| Ark-U | CTAAGGAACGGTAAATTGTTA | −20 |
| Mass-U | ATAGTGTGGTAAGTTACTGG | −20 |
| Ark-Db | CTACAACATCTTCAGTATAG | 580 |
| Mass-D | ATGTAACATCTGTGGTCTCA | 604 |
U refers to upstream primers.
bD refers to downstream primers.
Fig. 1Chimeric RTPCR amplified products from co-infections with Mass41 and Ark99 strains of IBV. Using primers described in Table 1, the region targeted was −20 to nt 604 for Ark99 and 580 for Mass41. The reverse transcription assays were initiated with either primer Mass-D or Ark-D. Conditions for PCR with upstream and downstream primers were as follows: 25 cycles at 94°C for 30 s, 50°C for 30 s, and 72°C for 1 min. (a) Amplified products from CEK RNA of uninfected CEK generated with Ark-D, Mass-D, Ark-U, and Mass-U primers in lane 1; of Ark99 infected CEK with Ark-U and Ark-D primers in lane 2; of Ark99 infected CEK with Mass-U and Ark-D primers in lane 3; of Ark99 infected CEK with Ark-U and Mass-D primers in lane 4; of Mass41 infected CEK with Mass-U and Mass-D primers in lane 5; of Mass infected CEK with Mass-U and Ark-D primers in lane 6; of Mass infected CEK with Ark-U and Mass-D primers in lane 7; of mixed Mass and Ark RNA with Mass-U and Ark-D primers in lane 8; of mixed Mass and Ark RNA with Ark-U and Mass-D primers in lane 9; of Mass41 and Ark99 co-infected CEK with Ark-U and Mass-D primers in lane 10; of Mass41 and Ark99 co-infected CEK with Mass-U and Ark-D primers in lane 11, and marker HindIII digested λ DNA ladder marker in lane M with nucleotide size of smaller bands (Gibco-BRL, Grand Island, NY) in lane 12. (b) Amplified chimeric products derived from RNA of Mass41 and Ark99 co-infected CEK cells and allantoic fluid of chicken embryos. HindIII digested λ phage DNA marker is shown in lane M as in 1a. Amplification of viral RNA from co-infected CEK cells with Ark-U and Mass-D primers is shown in lane 1; viral RNA from co-infected CEK cells with Mass-U and Ark-D primers in lane 2; uninfected CEK RNA with Ark-U, Mass-U, Ark-D and Mass-D primers in lane 3; viral RNA from co-infected ECE with Ark-U and Mass-D primers in lane 4; viral RNA from co-infected ECE with Mass-U and Ark-D primers in lane 5; uninfected chicken embryo RNA with Ark-U, Mass-U, Ark-D and Mass-D primers in lane 6. (c) Amplifed products derived from RNA of particles of Mass and Ark vaccine co-infected chicken lungs using Ark-U and Mass-D primers. Products were derived from an expired co-infected chick (lane 1); from two co-infected healthy chicks (lane 2 and 3); from co-infected sick chicks (lane 4, 5 and 6); from chick lung cellular RNA of an uninfected chick (lane 7), and HindIII digested lambda phage DNA marker (lane M) as in 1a.
Fig. 2Schematic representation of shifts and nucleotide sequences of cloned products. Chimeric products were amplified with the Mass-D and Ark-U primers covering nucleotide −20 to 580 in the S1 genes. DNA samples were purified with spin columns (Qiagen, Chatsworth, CA) and the DNA was sequenced using the dideoxy method according to instructions (Sequenase Kit, USB, Cleveland, OH) or by the dye terminator cycle method (Ready Reaction, Perkin-Elmer, Foster City, CA) with the Applied Biosystems/Perkin-Elmer automated DNA/RNA sequencer (model 377). Sequences labelled TC (tissue culture) were derived from RNA of co-infected CEK, ECE from RNA of co-infected ECE and C from RNA of co-infected chicks. The sequences of the first 200 nucleotides of S1 genes from recombinants and their parental strains are compared. The sequences of parental strains Mass41 and Ark99 were derived from published data (Binns et al., 1985; Wang et al., 1993).