| Literature DB >> 8812610 |
D D Hegedus1, G G Khachatourians.
Abstract
A series of genomic DNA probes which exhibit specificity for Beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal DNA (Hegedus and Khachatourians, 1993a). To improve the sensitivity of a DNA-based monitoring system for detection of this entomopathogenic fungus we have developed a PCR-based method. Using sequence information from a region of the B. bassiana-specific probe pBb22, primers P1 (5'AAGCTTCGACATGGTCTG) AND P3 (5GGAGGTGGTGAGGTTCTGTT) were generated. This primer set amplified similar-sized products from several B. Bassiana isolates, Beauveria brongniartii, Beauveria caledonica, and B. densa, but not Tolypocladium nivea, Tolypocladium cylindrospora, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus or migratory grasshoppers and locusts. Hybridization with the probe indicated the presence of DNA homology between the products. Restriction enzyme analysis of the PCR products, however, showed that sequence heterogeneity existed which was confirmed by partial sequencing of the products. Another primer, P5 (5AGGAGAGAGCTCGACGGTCA), was developed to exploit the sequence variations. When the P1-P5 primer set was used, a product was amplified from most B. bassiana isolates, including two which failed to amplify with the P1-P3 set. This amplification was not observed with the other Beauveria species tested. The nature of the sequence variations within the P1-P3 PCR-amplified region suggests the placement of B. densa and B. caledonica outside the species B. bassiana, confirming previous evidence with mitochondrial DNA and DNA probes. PCR with the P1-P3 and P1-P5 primer sets was used to discriminate isolates of B. bassiana found to be infecting a population of the migratory grasshopper, Melanoplus sanguinipes, collected in Saskatchewan. The PCR products derived from the P1-P3 primer set with the various Beauveria spp. could be differentiated by single-strand conformation polymorphisms (SSCP). Thus, analysis of PCR products using restriction enzymes, sequencing, or SSCPs allows positive differentiation of a particular B. bassiana isolate from others. The great sensitivity of these techniques should help the release and monitoring of entomopathogenic fungi in the environment.Entities:
Mesh:
Substances:
Year: 1996 PMID: 8812610 DOI: 10.1006/jipa.1996.0044
Source DB: PubMed Journal: J Invertebr Pathol ISSN: 0022-2011 Impact factor: 2.841