Literature DB >> 8812610

Identification and differentiation of the entomopathogenic fungus Beauveria bassiana using polymerase chain reaction and single-strand conformation polymorphism analysis.

D D Hegedus1, G G Khachatourians.   

Abstract

A series of genomic DNA probes which exhibit specificity for Beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal DNA (Hegedus and Khachatourians, 1993a). To improve the sensitivity of a DNA-based monitoring system for detection of this entomopathogenic fungus we have developed a PCR-based method. Using sequence information from a region of the B. bassiana-specific probe pBb22, primers P1 (5'AAGCTTCGACATGGTCTG) AND P3 (5GGAGGTGGTGAGGTTCTGTT) were generated. This primer set amplified similar-sized products from several B. Bassiana isolates, Beauveria brongniartii, Beauveria caledonica, and B. densa, but not Tolypocladium nivea, Tolypocladium cylindrospora, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus or migratory grasshoppers and locusts. Hybridization with the probe indicated the presence of DNA homology between the products. Restriction enzyme analysis of the PCR products, however, showed that sequence heterogeneity existed which was confirmed by partial sequencing of the products. Another primer, P5 (5AGGAGAGAGCTCGACGGTCA), was developed to exploit the sequence variations. When the P1-P5 primer set was used, a product was amplified from most B. bassiana isolates, including two which failed to amplify with the P1-P3 set. This amplification was not observed with the other Beauveria species tested. The nature of the sequence variations within the P1-P3 PCR-amplified region suggests the placement of B. densa and B. caledonica outside the species B. bassiana, confirming previous evidence with mitochondrial DNA and DNA probes. PCR with the P1-P3 and P1-P5 primer sets was used to discriminate isolates of B. bassiana found to be infecting a population of the migratory grasshopper, Melanoplus sanguinipes, collected in Saskatchewan. The PCR products derived from the P1-P3 primer set with the various Beauveria spp. could be differentiated by single-strand conformation polymorphisms (SSCP). Thus, analysis of PCR products using restriction enzymes, sequencing, or SSCPs allows positive differentiation of a particular B. bassiana isolate from others. The great sensitivity of these techniques should help the release and monitoring of entomopathogenic fungi in the environment.

Entities:  

Mesh:

Substances:

Year:  1996        PMID: 8812610     DOI: 10.1006/jipa.1996.0044

Source DB:  PubMed          Journal:  J Invertebr Pathol        ISSN: 0022-2011            Impact factor:   2.841


  5 in total

1.  Characterization and bio-efficacy of entomopathogenic Beauveria associated with cuticle-degrading enzymes to restrain sucking pest Bemisia tabaci.

Authors:  Rushita V Bhadani; H P Gajera; Darshna G Hirpara; Harshita J Kachhadiya
Journal:  Parasitol Res       Date:  2022-05-26       Impact factor: 2.289

2.  Biosynthesis and characterization of extracellular metabolites-based nanoparticles to control the whitefly.

Authors:  Rushita V Bhadani; H P Gajera; Darshna G Hirpara; D D Savaliya; Samir A Anuj
Journal:  Arch Microbiol       Date:  2022-05-10       Impact factor: 2.552

3.  High diversity of the fungal community structure in naturally-occurring Ophiocordyceps sinensis.

Authors:  Yongjie Zhang; Shu Zhang; Mu Wang; Fengyan Bai; Xingzhong Liu
Journal:  PLoS One       Date:  2010-12-15       Impact factor: 3.240

4.  Effect of fungal colonization of wheat grains with Fusarium spp. on food choice, weight gain and mortality of meal beetle larvae (Tenebrio molitor).

Authors:  Zhiqing Guo; Katharina Döll; Raana Dastjerdi; Petr Karlovsky; Heinz-Wilhelm Dehne; Boran Altincicek
Journal:  PLoS One       Date:  2014-06-16       Impact factor: 3.240

5.  Antifungal Activity of Beauveria bassiana Endophyte against Botrytis cinerea in Two Solanaceae Crops.

Authors:  Lorena Barra-Bucarei; Andrés France Iglesias; Macarena Gerding González; Gonzalo Silva Aguayo; Jorge Carrasco-Fernández; Jean Franco Castro; Javiera Ortiz Campos
Journal:  Microorganisms       Date:  2019-12-31
  5 in total

北京卡尤迪生物科技股份有限公司 © 2022-2023.