Mechanism of the chromosomal translocation t(14;18) in lymphoma: detection of a 45-Kd breakpoint binding protein.

The translocation t(14;18) between the BCL-2 oncogene and the Ig heavy chain (IgH) gene provides the molecular basis for the development of follicular lymphomas. The illegitimate recombination occurs in early B cells. While V(D)J-recombinase is most likely involved on the chromosome 14 part, little is known about the mechanism of breakage on chromosome 18. We investigated the BCL-2 breakpoint regions for their structural vulnerability and protein binding capacity. We found that the major breakpoint region (mbr) contains an S1 nuclease-sensitive site and is the target of an endogenous nuclease present in early B cells. A 45 Kd nuclear protein (bp45) from early B cell extracts binds to a homopurine-homopyrimidine stretch (GGGAGGACGGGAGGAAGGCG) in the mbr, which is homologous to a recombinatorial element in Escherichia coli (CHI). The protein also binds to homologous sequences in the minor breakpoint cluster region (mcr) and in the IgH locus. The localization of the binding sites on both chromosomes as well as the tissue distribution of bp45 suggest that this protein-DNA interaction is involved in the translocation t(14;18). The DNA binding motif is also present at other translocation breakpoints indicating a more general role for this mechanism.