Restriction enzyme-resistant high molecular weight telomeric DNA fragments in tobacco.

Restriction endonuclease-resistant high-molecular-weight (HMW) DNA fragments were isolated from nuclear DNA fragments in tobacco. The size of the fragments produced by EcoRI, HindIII, AfaI, and HaeIII ranged from 20 kb to over 166 kb. The kinetics of digestion by Bal31 nuclease showed that most of the HMW fragments are chromosome ends. The consensus sequence for tobacco telomere repeats was determined to be CCCTAAA by genomic sequencing using the HMW fragments and by sequencing after cloning. Besides the telomere sequence, 9 tandem repeats of a 45-bp sequence were identified, in which a 35-bp unit sequence (AGTCAGCATTAGGGTTTTAAACCCTAAACTGAACT) formed a stem structure. The front of the stem is composed of a palindrome of the telomere repeats. This highly conserved unit is surrounded by less conserved internal sequences that are around 10-11 bp in size and contain a TTTT stretch. The internal sequences resemble the 10-11 bp consensus for the scaffold attachment regions found in yeast and drosophila. The characteristic 45-bp sequence was abundant on the ends of chromosomes. The shortest distance between the repeats containing telomeric stem and the telomere was less than 20 kb. This architecture of the tobacco chromosome end region resembles the end region of yeast chromosomes in which autonomous replication sequences are present frequently.