Warning: Undefined array key "mm" in /www/wwwroot/www.ai-bt.com/si.php on line 10 Deprecated: trim(): Passing null to parameter #1 ($string) of type string is deprecated in /www/wwwroot/www.ai-bt.com/si.php on line 10 Two thraustochytrid 5S ribosomal RNAs.

Literature DB >> 7162992

Two thraustochytrid 5S ribosomal RNAs.

Abstract

The complete nucleotide sequences of the 5S ribosomal RNAs (rRNAs) of two thraustochytrids, Thraustochytrium visurgense and Schizochytrium, aggregatum, are AUGAGCCCUCAUAUCAUGUGGAGUGCACCGGAUCUCAUCCGAACUCCGUAGUUAAGCCACAUAGAGCGCGUC UAGUACUGCCGUAGGGGACUAGGUGGGAAGCACGCGUGGGGCUCAUU and ACAGCCGUUCAUACCACACGGAGA AUACCGGAUCUCGUUCGAACUCCGCAGUCAAGCCGUGUCGGGCGUGCUCAGUACUACCAUAGGGGACUGGGUGGGA AGCGUGCGUGACGGCUGUU, respectively. These sequences are discussed in terms of the apparent unity in secondary structure and strong divergence in primary structure exhibited by protist 5S rRNAs.

Entities: Species

Mesh：

Substances：
RNA, Ribosomal

Year: 1982 PMID： 7162992 PMCID： PMC327087 DOI： 10.1093/nar/10.24.8307

Source DB: PubMed Journal: Nucleic Acids Res ISSN： 0305-1048 Impact factor: 16.971

11 in total

1. Direct chemical method for sequencing RNA.

Authors: D A Peattie
Journal: Proc Natl Acad Sci U S A Date: 1979-04 Impact factor: 11.205

2. Studies on the nucleotide sequence of pseudouridine-containing 5S RNA from Saccharomyces cerevisiae.

Authors: M Miyazaki
Journal: J Biochem Date: 1974-06 Impact factor: 3.387

3. The ultrastructure of holdfasts, "rhizoids", and "slime tracks" in Thraustochytriaceous fungi and Labyrinthula spp.

Authors: F O Perkins
Journal: Arch Mikrobiol Date: 1972

Review 4. Collection of published 5S and 5.8S RNA sequences and their precursors.

Authors: V A Erdmann
Journal: Nucleic Acids Res Date: 1982-01-22 Impact factor: 16.971

5. Secondary structure of eukaryotic cytoplasmic 5S ribosomal RNA.

Authors: K R Luehrsen; G E Fox
Journal: Proc Natl Acad Sci U S A Date: 1981-04 Impact factor: 11.205

6. Comparative sequence analysis as an approach to evaluating structure, function, and evolution of 5S and 5.8S ribosomal RNAs.

Authors: R M MacKay; D F Spencer; M N Schnare; W F Doolittle; M W Gray
Journal: Can J Biochem Date: 1982-04

7. Nucleotide sequence of Crithidia fasciculata cytosol 5S ribosomal ribonucleic acid.

Authors: R M MacKay; M W Gray; W F Doolittle
Journal: Nucleic Acids Res Date: 1980-11-11 Impact factor: 16.971

8. An evaluation of the phylogenetic position of the dinoflagellate Crypthecodinium cohnii based on 5S rRNA characterization.

Authors: A G Hinnebusch; L C Klotz; R L Blanken; A R Loeblich
Journal: J Mol Evol Date: 1981 Impact factor: 2.395

9. Phy M: an RNase activity specific for U and A residues useful in RNA sequence analysis.

Authors: H Donis-Keller
Journal: Nucleic Acids Res Date: 1980-07-25 Impact factor: 16.971

10. The 5S ribosomal RNA of Euglena gracilis cytoplasmic ribosomes is closely homologous to the 5S RNA of the trypanosomatid protozoa.

Authors: N Delihas; J Andersen; W Andresini; L Kaufman; H Lyman
Journal: Nucleic Acids Res Date: 1981-12-11 Impact factor: 16.971

3 in total

1. Collection of published 5S, 5.8S and 4.5S ribosomal RNA sequences.

Authors: V A Erdmann; J Wolters; E Huysmans; R De Wachter
Journal: Nucleic Acids Res Date: 1985 Impact factor: 16.971

2. Collection of published 5S and 5.8S ribosomal RNA sequences.

Authors: V A Erdmann; J Wolters; E Huysmans; A Vandenberghe; R De Wachter
Journal: Nucleic Acids Res Date: 1984 Impact factor: 16.971

3. The nucleotide sequences of the 5S rRNAs of four mushrooms and their use in studying the phylogenetic position of basidiomycetes among the eukaryotes.

Authors: E Huysmans; E Dams; A Vandenberghe; R De Wachter
Journal: Nucleic Acids Res Date: 1983-05-11 Impact factor: 16.971

3 in total